MycoBiomDB

Filters

DB ID	Host Group	Host Name	Disease	Fungus Involved	Biomarker	Biomolecule	Biomarker Type	Site of Infection	Age Group	Geographical Location	Genus	Sample Category	Sample Type	Technique	Technique Type	PMID
MyCo_1006	Human	Human	Mucormycosis	Unclassified	Chest CT Image	NA	Diagnostic	Unspecified	None	Italy	Unclassified	Chest CT Imaging	Biopsy	Instrument-based	Imaging	31292659
MyCo_1007	Animal	Mice	Mucormycosis	Rhizopus arrhizus	Interleukin-6	Protein	Diagnostic	Unspecified	None	USA	Rhizopus	Serum	Body fluid	Immunoassay	Multiplex immunoassays	35251033
MyCo_1126	Human	Human	Mucormycosis	Lichtheimia ramosa	1-3-beta-D-Glucan	Protein	Negative	Unspecified	53	China	Lichtheimia	Blood	Body fluid	Immunoassay	ELISA	34631726
MyCo_1140	Human	Human	Mucormycosis	Unclassified	1-3-beta-D-Glucan	Protein	Negative	Unspecified	77	USA	Unclassified	Serum	Body fluid	Immunoassay	ELISA	32537269
MyCo_1145	Human	Human	Mucormycosis	Unclassified	1-3-beta-D-Glucan	Protein	Negative	Unspecified	22	Multi-Location	Unclassified	Serum	Body fluid	Immunoassay	ELISA	34075329
MyCo_1363	Human	Human	Mucormycosis	Rhizopus oryzae	Ferritin	Protein	Diagnostic	Unspecified	None	India	Rhizopus	Serum	Body fluid	Immunoassay	Chemiluminescence	38990622
MyCo_1440	Human	Human	Mucormycosis	Unclassified	Chest CT Image	NA	Diagnostic	Unspecified	None	Italy	Unclassified	Chest CT Imaging	Biopsy	Instrument-based	Imaging	31292659
MyCo_2055	Animal	Platypus	Mucormycosis	Mucor amphibiorum	CD3	Protein	Diagnostic	Unspecified	None	Australia	Mucor	Biopsies from skin lesions	Biopsy	Immunoassay	ELISA	10906254
MyCo_2056	Animal	Platypus	Mucormycosis	Mucor amphibiorum	CD4	Protein	Diagnostic	Unspecified	None	Australia	Mucor	Biopsies from skin lesions	Biopsy	Immunoassay	ELISA	10906254
MyCo_2057	Animal	Platypus	Mucormycosis	Mucor amphibiorum	CD5	Protein	Diagnostic	Unspecified	None	Australia	Mucor	Biopsies from skin lesions	Biopsy	Immunoassay	ELISA	10906254
MyCo_2058	Animal	Platypus	Mucormycosis	Mucor amphibiorum	CD79a	Protein	Diagnostic	Unspecified	None	Australia	Mucor	Biopsies from skin lesions	Biopsy	Immunoassay	ELISA	10906254
MyCo_2059	Animal	Platypus	Mucormycosis	Mucor amphibiorum	CD79b	Protein	Diagnostic	Unspecified	None	Australia	Mucor	Biopsies from skin lesions	Biopsy	Immunoassay	ELISA	10906254
MyCo_2060	Animal	Platypus	Mucormycosis	Mucor amphibiorum	CD8	Protein	Diagnostic	Unspecified	None	Australia	Mucor	Biopsies from skin lesions	Biopsy	Immunoassay	ELISA	10906254
MyCo_2333	Animal	Mice	Mucormycosis	Unclassified	Rhizopus-specific antigen (RSA)-specific rabbit monoclonal antibodies	Protein	Diagnostic	Unspecified	None	Japan	Unclassified	Serum	Body fluid	Immunoassay	ELISA	32060526
MyCo_2334	Animal	Mice	Mucormycosis	Unclassified	Rhizopus-specific antigen (RSA)-specific rabbit monoclonal antibodies	Protein	Diagnostic	Unspecified	None	Japan	Unclassified	bronchoalveolar lavage fluid (BALF)	Body fluid	Immunoassay	ELISA	32060526
MyCo_2380	Human	Human	Mucormycosis	Rhizomucor pusillus	Interferon gamma	Protein	Diagnostic	Unspecified	None	Italy	Rhizomucor	Blood	Body fluid	Immunoassay	ELISA	21931119
MyCo_2381	Human	Human	Mucormycosis	Rhizomucor pusillus	Interleukin-10	Protein	Diagnostic	Unspecified	None	Italy	Rhizomucor	Blood	Body fluid	Immunoassay	ELISA	21931119
MyCo_2382	Human	Human	Mucormycosis	Rhizomucor pusillus	Interleukin-17	Protein	Diagnostic	Unspecified	None	Italy	Rhizomucor	Blood	Body fluid	Immunoassay	ELISA	21931119
MyCo_2383	Human	Human	Mucormycosis	Rhizomucor pusillus	Interleukin-4	Protein	Diagnostic	Unspecified	None	Italy	Rhizomucor	Blood	Body fluid	Immunoassay	ELISA	21931119
MyCo_2384	Human	Human	Mucormycosis	Rhizomucor pusillus	Mucorales-specific T cells	NA	Diagnostic	Unspecified	None	Italy	Rhizomucor	Blood	Body fluid	Immunoassay	ELISA	21931119
MyCo_2385	Human	Human	Mucormycosis	Rhizopus oryzae	Interferon gamma	Protein	Diagnostic	Unspecified	None	Italy	Rhizopus	Blood	Body fluid	Immunoassay	ELISA	21931119
MyCo_2386	Human	Human	Mucormycosis	Rhizopus oryzae	Interleukin-10	Protein	Diagnostic	Unspecified	None	Italy	Rhizopus	Blood	Body fluid	Immunoassay	ELISA	21931119
MyCo_2387	Human	Human	Mucormycosis	Rhizopus oryzae	Interleukin-17	Protein	Diagnostic	Unspecified	None	Italy	Rhizopus	Blood	Body fluid	Immunoassay	ELISA	21931119
MyCo_2388	Human	Human	Mucormycosis	Rhizopus oryzae	Interleukin-4	Protein	Diagnostic	Unspecified	None	Italy	Rhizopus	Blood	Body fluid	Immunoassay	ELISA	21931119
MyCo_2389	Human	Human	Mucormycosis	Rhizopus oryzae	Mucorales-specific T cells	NA	Diagnostic	Unspecified	None	Italy	Rhizopus	Blood	Body fluid	Immunoassay	ELISA	21931119
MyCo_2441	Human	Human	Mucormycosis	Unclassified	Galactomannan	Protein	Diagnostic	Unspecified	21-89	Spain	Unclassified	Serum	Body fluid	Immunoassay	ELISA	21811868
MyCo_2657	Animal	Mice	Mucormycosis	Rhizopus oryzae	Candidate-A [Rhizopus specific antigen (RSA)]	Protein	Diagnostic	Unspecified	None	Japan	Rhizopus	Serum	Body fluid	Immunoassay	ELISA	38825527
MyCo_2658	Animal	Mice	Mucormycosis	Rhizopus oryzae	Candidate-A [Rhizopus specific antigen (RSA)]	Protein	Diagnostic	Unspecified	None	Japan	Rhizopus	Alveolar Lavage Fluid	Body fluid	Immunoassay	ELISA	38825527
MyCo_2724	Animal	Mice	Mucormycosis	Rhizopus oryzae	Hypothetical protein-RSA (23 kDa)	Protein	Diagnostic	Unspecified	None	Japan	Rhizopus	Serum	Body fluid	Immunoassay	ELISA	28199672
MyCo_2725	Animal	Mice	Mucormycosis	Rhizopus oryzae	Hypothetical protein-RSA (23 kDa)	Protein	Diagnostic	Unspecified	None	Japan	Rhizopus	Extracted Lungs tissue	Biopsy	Immunoassay	ELISA	28199672
MyCo_3221	Human	Human	Mucormycosis	Unclassified	1-3-beta-D-Glucan	Protein	Diagnostic	Unspecified	21-89	Spain	Unclassified	Serum	Body fluid	Immunoassay	Chemiluminescence	21811868
MyCo_3232	Human	Human	Mucormycosis	Unclassified	Fibrinogen	Protein	Diagnostic	Unspecified	23–83	France	Unclassified	Serum	Body fluid	Biochemical Assay	Clinical chemistry	26931315
MyCo_3428	Human	Human	Mucormycosis	Rhizopus arrhizus	CD154	Protein	Diagnostic	Unspecified	None	Germany	Rhizopus	Blood	Body fluid	Cell-based Assay	Flow cytometry	30201279
MyCo_3429	Human	Human	Mucormycosis	Rhizopus arrhizus	CD154	Protein	Diagnostic	Unspecified	None	USA	Rhizopus	Blood	Body fluid	Cell-based Assay	Flow cytometry	31095327
MyCo_3430	Human	Human	Mucormycosis	Rhizopus pusillus	CD154	Protein	Diagnostic	Unspecified	None	USA	Rhizopus	Blood	Body fluid	Cell-based Assay	Flow cytometry	31095327
MyCo_3431	Human	Human	Mucormycosis	Rhizopus arrhizus	Interleukin-13	Protein	Diagnostic	Unspecified	None	Germany	Rhizopus	Blood	Body fluid	Cell-based Assay	Flow cytometry	30201279
MyCo_3432	Human	Human	Mucormycosis	Rhizopus arrhizus	Interleukin-17A	Protein	Diagnostic	Unspecified	None	Germany	Rhizopus	Blood	Body fluid	Cell-based Assay	Flow cytometry	30201279
MyCo_3433	Human	Human	Mucormycosis	Rhizopus spp.	PD-	Protein	Predictive	Unspecified	15-79	Germany	Rhizopus	Blood	Body fluid	Cell-based Assay	Flow cytometry	40095363
MyCo_3434	Animal	Mice	Mucormycosis	Rhizopus arrhizus	PD-1/PD-L1	Protein	Diagnostic	Unspecified	None	USA	Rhizopus	Lung Tissue Homogenate	Biopsy	Cell-based Assay	Flow cytometry	35251033
MyCo_3443	Human	Human	Mucormycosis	Unclassified	CD4+ HLA-	Protein	Diagnostic	Unspecified	None	India	Unclassified	Blood	Body fluid	Cell-based Assay	Flow cytometry	36305225
MyCo_3444	Human	Human	Mucormycosis	Unclassified	CD4+ LAG-	Protein	Diagnostic	Unspecified	None	India	Unclassified	Blood	Body fluid	Cell-based Assay	Flow cytometry	36305225
MyCo_3445	Human	Human	Mucormycosis	Unclassified	CD4+ PD-	Protein	Diagnostic	Unspecified	None	India	Unclassified	Blood	Body fluid	Cell-based Assay	Flow cytometry	36305225
MyCo_3446	Human	Human	Mucormycosis	Unclassified	CD4+CD38+ (% CD4+)	Protein	Diagnostic	Unspecified	None	India	Unclassified	Blood	Body fluid	Cell-based Assay	Flow cytometry	36305225
MyCo_3448	Human	Human	Mucormycosis	Unclassified	CD8+ CD38+ (% CD8+)	Protein	Diagnostic	Unspecified	None	India	Unclassified	Blood	Body fluid	Cell-based Assay	Flow cytometry	36305225
MyCo_3449	Human	Human	Mucormycosis	Unclassified	CD8+ CD69+ (% CD8+)	Protein	Diagnostic	Unspecified	None	India	Unclassified	Blood	Body fluid	Cell-based Assay	Flow cytometry	36305225
MyCo_3450	Human	Human	Mucormycosis	Unclassified	CD8+ HLA-	Protein	Diagnostic	Unspecified	None	India	Unclassified	Blood	Body fluid	Cell-based Assay	Flow cytometry	36305225
MyCo_3451	Human	Human	Mucormycosis	Unclassified	CD8+ LAG-	Protein	Diagnostic	Unspecified	None	India	Unclassified	Blood	Body fluid	Cell-based Assay	Flow cytometry	36305225
MyCo_3468	Human	Human	Mucormycosis	Unclassified	MIF	Protein	Diagnostic	Unspecified	None	India	Unclassified	Plasma	Body fluid	Cell-based Assay	Ex-vivo	37052373
MyCo_3469	Human	Human	Mucormycosis	Unclassified	potentiate phagocytosis in myeloid cell	Protein	Diagnostic	Unspecified	None	India	Unclassified	Plasma	Body fluid	Cell-based Assay	Ex-vivo	37052373
MyCo_3470	Human	Human	Mucormycosis	Unclassified	RANTES	Protein	Diagnostic	Unspecified	None	India	Unclassified	Plasma	Body fluid	Cell-based Assay	Ex-vivo	37052373
MyCo_3743	Human	Human	Mucormycosis	Lichtheimia ramosa	Galactomannan	Protein	Negative	Unspecified	53	China	Lichtheimia	Blood	Body fluid	Immunoassay	Lateral flow	34631726
MyCo_3746	Human	Human	Mucormycosis	Unclassified	Galactomannan	Protein	Negative	Unspecified	77	USA	Unclassified	Serum	Body fluid	Immunoassay	Lateral flow	32537269
MyCo_3747	Human	Human	Mucormycosis	Unclassified	Galactomannan	Protein	Negative	Unspecified	22	UK	Unclassified	Serum	Body fluid	Immunoassay	Lateral flow	34075329
MyCo_3771	Human	Human	Mucormycosis	Unclassified	Corticosteroids	Hormone	Diagnostic	Lungs	None	Iran	Unclassified	Homogenized Lungs tissue	biopsy	Instrument-based	Imaging	35389322
MyCo_3863	Human	Human	Mucormycosis	Rhizopus microsporus	Interferon gamma	Protein	Diagnostic	Unspecified	61	France	Rhizopus	Extracted tissue	Biopsy	Immunoassay	Immunofluorescence	36072605
MyCo_3883	Human	Human	Mucormycosis	Unclassified	Procalcitonin	Protein	Diagnostic	Unspecified	23–83	France	Unclassified	Serum	Body fluid	Immunoassay	Immunofluorescence	26931315
MyCo_3985	NA	NA	Mucormycosis	Rhizopus spp.	MUC5B	Protein	Diagnostic	Unspecified	None	China	Rhizopus	NA	None	Instrument-based	Histology	18439938
MyCo_4120	Human	Human	Mucormycosis	Rhizopus nigricans	Immunoglobulin E	Protein	Prognostic	Unspecified	18-35	Ireland	Rhizopus	Serum	Body fluid	Immunoassay	Chemiluminescence	11127497
MyCo_4124	Human	Human	Mucormycosis	Zygomycetes spp.	Procalcitonin	Protein	Diagnostic	Unspecified	47.1±13.6	Poland	Zygomycetes	Lower respiratory tract fluids	Body fluid	Immunoassay	Chemiluminescence	21996233
MyCo_5005	Human	Human	Mucormycosis	Lichtheimia corymbifera	Serum disaccharide	Protein	Diagnostic	Unspecified	None	France	Lichtheimia	Serum	Body fluid	Mass Spectrometry	MALDI	27605710
MyCo_5006	Human	Human	Mucormycosis	Lichtheimia ramosa	Serum disaccharide	Protein	Diagnostic	Unspecified	None	France	Lichtheimia	Serum	Body fluid	Mass Spectrometry	MALDI	27605710
MyCo_5007	Human	Human	Mucormycosis	Lichtheimia spp.	Serum disaccharide	Protein	Diagnostic	Unspecified	None	France	Lichtheimia	Serum	Body fluid	Mass Spectrometry	MALDI	27605710
MyCo_5008	Human	Human	Mucormycosis	Mucor circinelloides	Serum disaccharide	Protein	Diagnostic	Unspecified	None	France	Mucor	Serum	Body fluid	Mass Spectrometry	MALDI	27605710
MyCo_5009	Human	Human	Mucormycosis	Rhizopus arrhizus	Serum disaccharide	Protein	Diagnostic	Unspecified	None	France	Rhizopus	Serum	Body fluid	Mass Spectrometry	MALDI	27605710
MyCo_5010	Human	Human	Mucormycosis	Rhizopus microsporus	Serum disaccharide	Protein	Diagnostic	Unspecified	None	France	Rhizopus	Serum	Body fluid	Mass Spectrometry	MALDI	27605710
MyCo_5011	Human	Human	Mucormycosis	Rhizopus pusillus	Serum disaccharide	Protein	Diagnostic	Unspecified	None	France	Rhizopus	Serum	Body fluid	Mass Spectrometry	MALDI	27605710
MyCo_5308	Human	Human	Mucormycosis	Mucor spp.	RANTES	Protein	Diagnostic	Unspecified	None	USA	Mucor	Serum	Body fluid	Immunoassay	Multiplex immunoassays	26110227
MyCo_5316	Human	Human	Mucormycosis	Unclassified	C-reactive protein	Protein	Diagnostic	Unspecified	23–83	France	Unclassified	Serum	Body fluid	Immunoassay	ELISA	26931315
MyCo_5348	Human	Human	Mucormycosis	Rhizopus microsporus	1-3-beta-D-Glucan	Protein	Negative	Unspecified	42–58	Germany	Rhizopus	Plasma	Body fluid	Computational	Genomics	30834971
MyCo_5349	Human	Human	Mucormycosis	Rhizopus microsporus	Galactomannan	Protein	Diagnostic	Unspecified	42–58	Germany	Rhizopus	Plasma	Body fluid	Computational	Genomics	30834971
MyCo_5350	Human	Human	Mucormycosis	Rhizopus microsporus	Interleukin-17A	Protein	Diagnostic	Unspecified	42–58	Germany	Rhizopus	Plasma	Body fluid	Computational	Genomics	30834971
MyCo_5351	Human	Human	Mucormycosis	Rhizopus microsporus	Mid-regional proadrenomedullin	Protein	Diagnostic	Unspecified	42–58	Germany	Rhizopus	Plasma	Body fluid	Computational	Genomics	30834971
MyCo_5492	Human	Human	Mucormycosis	Mucor spp.	Internal Transcribed Spacer	Gene	Prognostic	Unspecified	None	USA	Mucor	Plasma	Body fluid	Molecular Methods	PCR	38602412
MyCo_5493	Human	Human	Mucormycosis	Mucor spp.	Internal Transcribed Spacer	Gene	Prognostic	Unspecified	None	USA	Mucor	Plasma	Body fluid	Molecular Methods	PCR	38602412
MyCo_5494	Human	Human	Mucormycosis	Mucor spp.	Internal Transcribed Spacer	Gene	Prognostic	Unspecified	None	USA	Mucor	Plasma	Body fluid	Molecular Methods	PCR	38602412
MyCo_5495	Human	Human	Mucormycosis	Mucor spp.	Internal Transcribed Spacer	Gene	Prognostic	Unspecified	None	USA	Mucor	Plasma	Body fluid	Molecular Methods	PCR	38602412
MyCo_5496	Human	Human	Mucormycosis	Rhizomucor spp.	Internal Transcribed Spacer	Gene	Prognostic	Unspecified	None	USA	Rhizomucor	Plasma	Body fluid	Molecular Methods	PCR	38602412
MyCo_5497	Human	Human	Mucormycosis	Rhizomucor spp.	Internal Transcribed Spacer	Gene	Prognostic	Unspecified	None	USA	Rhizomucor	Plasma	Body fluid	Molecular Methods	PCR	38602412
MyCo_5498	Human	Human	Mucormycosis	Rhizomucor spp.	Internal Transcribed Spacer	Gene	Prognostic	Unspecified	None	USA	Rhizomucor	Plasma	Body fluid	Molecular Methods	PCR	38602412
MyCo_5499	Human	Human	Mucormycosis	Rhizomucor spp.	Internal Transcribed Spacer	Gene	Prognostic	Unspecified	None	USA	Rhizomucor	Plasma	Body fluid	Molecular Methods	PCR	38602412
MyCo_5500	Human	Human	Mucormycosis	Rhizopus spp.	Internal Transcribed Spacer	Gene	Prognostic	Unspecified	None	USA	Rhizopus	Plasma	Body fluid	Molecular Methods	PCR	38602412
MyCo_5501	Human	Human	Mucormycosis	Rhizopus spp.	Internal Transcribed Spacer	Gene	Prognostic	Unspecified	None	USA	Rhizopus	Plasma	Body fluid	Molecular Methods	PCR	38602412
MyCo_5502	Human	Human	Mucormycosis	Rhizopus spp.	Internal Transcribed Spacer	Gene	Prognostic	Unspecified	None	USA	Rhizopus	Plasma	Body fluid	Molecular Methods	PCR	38602412
MyCo_5503	Human	Human	Mucormycosis	Rhizopus spp.	Internal Transcribed Spacer	Gene	Prognostic	Unspecified	None	USA	Rhizopus	Plasma	Body fluid	Molecular Methods	PCR	38602412
MyCo_5518	Human	Human	Mucormycosis	Cunninghamella bertholletiae	146-bp portion of the D1/D2 region	Protein	Diagnostic	Unspecified	23	Japan	Cunninghamella	Extracted DNA	Biopsy	Molecular Methods	PCR	32461900
MyCo_5519	Animal	Rabbit	Mucormycosis	Cunninghamella bertholletiae	28S rRNA gene	Gene	Diagnostic	Unspecified	None	Greece	Cunninghamella	Serum	Body fluid	Molecular Methods	PCR	22686246
MyCo_5520	Animal	Rabbit	Mucormycosis	Cunninghamella bertholletiae	28S rRNA gene	Gene	Diagnostic	Unspecified	None	USA	Cunninghamella	Bronchoalveolar lavage fluid (BALF)	Body fluid	Molecular Methods	PCR	18845827
MyCo_5521	Animal	Rabbit	Mucormycosis	Cunninghamella bertholletiae	28S rRNA gene	Gene	Diagnostic	Unspecified	None	USA	Cunninghamella	Extracted Lungs tissue	Biopsy	Molecular Methods	PCR	18845827
MyCo_5522	Animal	Rabbit	Mucormycosis	Mucor circinelloides	28S rRNA gene	Gene	Diagnostic	Unspecified	None	Greece	Mucor	Serum	Body fluid	Molecular Methods	PCR	22686246
MyCo_5523	Animal	Rabbit	Mucormycosis	Mucor circinelloides	28S rRNA gene	Gene	Diagnostic	Unspecified	None	USA	Mucor	Bronchoalveolar lavage fluid (BALF)	Body fluid	Molecular Methods	PCR	18845827
MyCo_5524	Animal	Rabbit	Mucormycosis	Mucor circinelloides	28S rRNA gene	Gene	Diagnostic	Unspecified	None	USA	Mucor	Extracted Lungs tissue	Biopsy	Molecular Methods	PCR	18845827
MyCo_5525	Human	Human	Mucormycosis	Pneumocystis jirovecii	1-3-beta-D-Glucan	Protein	Diagnostic	Lungs	None	Belgium	Pneumocystis	Bronchoalveolar lavage fluid (BALF)	Body fluid	Molecular Methods	PCR	30918045
MyCo_5526	Human	Human	Mucormycosis	Rhizomucor pusillus	DNA	Protein	Diagnostic	Unspecified	3	Japan	Rhizomucor	Serum	Body fluid	Molecular Methods	PCR	24848632
MyCo_5527	Animal	Rabbit	Mucormycosis	Rhizopus microsporus	28S rRNA gene	Gene	Diagnostic	Unspecified	None	Greece	Rhizopus	Serum	Body fluid	Molecular Methods	PCR	22686246
MyCo_5528	Animal	Rabbit	Mucormycosis	Rhizopus oryzae	28S rRNA gene	Gene	Diagnostic	Unspecified	None	Greece	Rhizopus	Serum	Body fluid	Molecular Methods	PCR	22686246
MyCo_5529	Animal	Rabbit	Mucormycosis	Rhizopus microsporus	28S rRNA gene	Gene	Diagnostic	Unspecified	None	USA	Rhizopus	Bronchoalveolar lavage fluid (BALF)	Body fluid	Molecular Methods	PCR	18845827
MyCo_5530	Animal	Rabbit	Mucormycosis	Rhizopus microsporus	28S rRNA gene	Gene	Diagnostic	Unspecified	None	USA	Rhizopus	Extracted Lungs tissue	Biopsy	Molecular Methods	PCR	18845827
MyCo_5531	Animal	Rabbit	Mucormycosis	Rhizopus oryzae	28S rRNA gene	Gene	Diagnostic	Unspecified	None	USA	Rhizopus	Bronchoalveolar lavage fluid (BALF)	Body fluid	Molecular Methods	PCR	18845827
MyCo_5532	Animal	Rabbit	Mucormycosis	Rhizopus oryzae	28S rRNA gene	Gene	Diagnostic	Unspecified	None	USA	Rhizopus	Extracted Lungs tissue	Biopsy	Molecular Methods	PCR	18845827
MyCo_5670	Human	Human	Mucormycosis	Cunninghamella bertholletiae	(FAM)TCGGTCGGCGTGGTTCTCTGCCCA (TAMRA)	Gene	Diagnostic	Unspecified	61	France	Cunninghamella	Serum	Body fluid	Molecular Methods	PCR	29712993
MyCo_5736	Human	Human	Mucormycosis	Rhizopus microsporus	Internal Transcribed Spacer	Gene	Diagnostic	Unspecified	17	France	Rhizopus	Serum	Body fluid	Molecular Methods	PCR	32156450
MyCo_5825	Human	Human	Mucormycosis	Unclassified	Galactomannan	Protein	Diagnostic	Unspecified	None	Italy	Unclassified	Serum	Body fluid	Molecular Methods	PCR	31292659
MyCo_5833	Human	Human	Mucormycosis	Unclassified	Tumour necrosis factor alpha	Protein	Diagnostic	Unspecified	None	UK	Unclassified	Blood	Body fluid	Molecular Methods	PCR	22974244
MyCo_6527	Human	Human	Mucormycosis	Mucor mucado	Antigen skin prick test	Antigen	Prognostic	Unspecified	18-35	Ireland	Mucor	Serum	Body fluid	Cell-based Assay	Cell-activation	11127497
MyCo_6529	Human	Human	Mucormycosis	Rhizopus nigricans	Antigen skin prick test	Antigen	Prognostic	Unspecified	18-35	Ireland	Rhizopus	Serum	Body fluid	Cell-based Assay	Cell-activation	11127497
MyCo_7191	Human	Human	Mucormycosis	Mucor spp.	1-3-beta-D-Glucan	Protein	Negative	Unspecified	None	Japan	Mucor	NA	None	Instrument-based	Imaging	32190545
MyCo_7193	Animal	Mice	Mucormycosis	Rhizopus oryzae	Spore coat protein Cot-H1-3	Protein	Diagnostic	Unspecified	None	Japan	Rhizopus	Serum	Body fluid	Immunoassay	Serology	38825527
MyCo_7194	Animal	Mice	Mucormycosis	Rhizopus oryzae	Spore coat protein CotH3-1	Protein	Diagnostic	Unspecified	None	Japan	Rhizopus	Urine	Body fluid	Immunoassay	Serology	38825527

Search Results for Mucormycosis

Filters