Welcome to Page of Predicted Diagnostic Primers for nCOV-2019 (CoVID-19)
--------------------------------------------------------------------------------------------------------------------------------------------------------
This page provides the information of Predicted Diagnostic Primers which can be used for the diagnosis of CoVID-19. These primers are predicted by Primer3_Core tool with default parameters. These primers are designated from the complete genome of 53 different nucleotide sequences samples taken from NCBI Virus Resource. These primers can be considered as "Universal" primer pair sets as these are common among all the samples.
Note: These primers need experimental Validation.
--------------------------------------------------------------------------------------------------------------------------------------------------------
Table representing the predicted universal primers by Primer3_core of nCoV-2019 strain diagnosis
ID | Fwd | Rev | Oligo | Fwd_length | Rev_length | Oligo_length | Fwd_Tm | Rev_Tm | Oligo_Tm | Fwd_GC | Rev_GC | Oligo_GC | Target_size |
CornaVIR_1 | CTCTTCTCGTTCCTCATCACG | CCAGACATTTTGCTCTCAAGC | TTGCTGCTGCTTGACAGATT | 21 | 21 | 20 | 59.997 | 60.008 | 59.746 | 52.381 | 47.619 | 45 | 162 |
CornaVIR_2 | AGTCAAGCCTCTTCTCGTTCC | CCAGACATTTTGCTCTCAAGC | TTGCTGCTGCTTGACAGATT | 21 | 21 | 20 | 60.009 | 60.008 | 59.746 | 52.381 | 47.619 | 45 | 170 |
CornaVIR_3 | GTCAAGCCTCTTCTCGTTCCT | CCAGACATTTTGCTCTCAAGC | TTGCTGCTGCTTGACAGATT | 21 | 21 | 20 | 60.009 | 60.008 | 59.746 | 52.381 | 47.619 | 45 | 169 |
CornaVIR_4 | AGCCTCTTCTCGTTCCTCATC | CCAGACATTTTGCTCTCAAGC | TTGCTGCTGCTTGACAGATT | 21 | 21 | 20 | 59.972 | 60.008 | 59.746 | 52.381 | 47.619 | 45 | 165 |
CornaVIR_5 | GGGGGACAACCAATCACTAAT | TAACCTTTCCACATACCGCAG | CAGTTACACCGGAAGCCAAT | 21 | 21 | 20 | 59.933 | 60.004 | 59.993 | 47.619 | 47.619 | 50 | 278 |