Welcome to Page of Diagnostic Primers
--------------------------------------------------------------------------------------------------------------------------------------------------------
This page provides the information of Predicted Diagnostic Primers which can be used for the diagnosis of CoVID-19. These primers are predicted by Primer3_Core tool with default parameters. These primers are designated for complete genome of CoVID-19 strain (53 different genome sequences) and various genes, i.e. N, ORF1ab, E, M, and ORF1ab-RdRP of the strain based on their sequences obtained from NCBI Virus Resource.
Note: These primers need experimental Validation.
--------------------------------------------------------------------------------------------------------------------------------------------------------
Predicted primers by Primer3_core for Diagnosis of nCoV-2019 strain
Table representing the predicted universal primers (based on 53 complete genome sequences) by Primer3_core of nCoV-2019 strain diagnosis
ID | Fwd | Rev | Oligo | Fwd_length | Rev_length | Oligo_length | Fwd_Tm | Rev_Tm | Oligo_Tm | Fwd_GC | Rev_GC | Oligo_GC | Target_size |
CornaVIR_1 | CTCTTCTCGTTCCTCATCACG | CCAGACATTTTGCTCTCAAGC | TTGCTGCTGCTTGACAGATT | 21 | 21 | 20 | 59.997 | 60.008 | 59.746 | 52.381 | 47.619 | 45 | 162 |
CornaVIR_2 | AGTCAAGCCTCTTCTCGTTCC | CCAGACATTTTGCTCTCAAGC | TTGCTGCTGCTTGACAGATT | 21 | 21 | 20 | 60.009 | 60.008 | 59.746 | 52.381 | 47.619 | 45 | 170 |
CornaVIR_3 | GTCAAGCCTCTTCTCGTTCCT | CCAGACATTTTGCTCTCAAGC | TTGCTGCTGCTTGACAGATT | 21 | 21 | 20 | 60.009 | 60.008 | 59.746 | 52.381 | 47.619 | 45 | 169 |
CornaVIR_4 | AGCCTCTTCTCGTTCCTCATC | CCAGACATTTTGCTCTCAAGC | TTGCTGCTGCTTGACAGATT | 21 | 21 | 20 | 59.972 | 60.008 | 59.746 | 52.381 | 47.619 | 45 | 165 |
CornaVIR_5 | GGGGGACAACCAATCACTAAT | TAACCTTTCCACATACCGCAG | CAGTTACACCGGAAGCCAAT | 21 | 21 | 20 | 59.933 | 60.004 | 59.993 | 47.619 | 47.619 | 50 | 278 |