Welcome to Page of Diagnostic Primers
--------------------------------------------------------------------------------------------------------------------------------------------------------
This page provides the information of Diagnostic Primers which can be used for the diagnosis of the recently emerged new strain of coronavirus SARS-CoV-2 or its resulting disease CoVID-19 and other strains of coronavirus. We are providing Experimental Validated, Predicted Primers and Primers for other strains of Corona Virus.(1) Table below contains Primers for the Specific strain, i.e. SARS-CoV-2, most of them are experimentally validated that are mined from the recent literature, (2) Next, we are providing predicted primers (using Primer_core tool) designed using whole genome and different genes of SARS-CoV-2 strain, and (3)Finally, primers for the other strains of Corona virus are also provided. These primers are extracted from the public database of primers for viruses, i.e. MRPrimerV. Here, we have provided the Gene symbol of the gene against which primers are designed, Forward Primer, Reverse Primer, Probe, Experimental conditions like Tm, Concentration, etc., specific comments for desired test from the reference study.
--------------------------------------------------------------------------------------------------------------------------------------------------------
Table representing the Experimentally Validated primers (that are mined from the literature) specific to 2019-nCoV strain
| ID | Comment | Reference | Gene | Forward primer | Reverse primer | probe | Reporters tagged with probes | Reaction conditions | comment from study | Publication Date |
| CoronaVIR_1 | Specific/Conformatory for 2019-nCoV | 31992387 | RdRP | GTGARATGGTCATGTGTGGCGG | CARATGTTAAASACACTATTAGCATA | FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ | FAM: reporter 6-carboxyfluorescein; BBQ: BlackBerry Quencher | Use 600 nM, 800nM and 100nM of forward primer, reverse primer and probe, respectively per reaction.Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. | Specific for 2019-nCoV, will not detect SARS-CoV. (Use 100 nM per reaction and mix with P1); Confirmatory testing with the RdRp gene assay;Application of the RdRp gene assay with dual colour technology can discriminate 2019-nCoV (both probes positive) from SARS-CoV RNA if the latter is used as positive control. | Jan 23, 2020 |
| CoronaVIR_2 | Detect 2019-nCoV and similar strains | 31992387 | RdRP | GTGARATGGTCATGTGTGGCGG | CARATGTTAAASACACTATTAGCATA | FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ | FAM: reporter 6-carboxyfluorescein; BBQ: BlackBerry Quencher | Use 600 nM, 800nM and 100nM of forward primer, reverse primer and probe, respectively per reaction.Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. | Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs. Use 100 nM per reaction and mix with P2 | Jan 23, 2020 |
| CoronaVIR_3 | First-line screening | 31992387 | E | ACAGGTACGTTAATAGTTAATAGCGT | ATATTGCAGCAGTACGCACACA | FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ | FAM: reporter 6-carboxyfluorescein; BBQ: BlackBerry Quencher | Use 400 nM, 400nM and 200nM of forward primer, reverse primer and probe, respectively per reaction.Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. | E gene assay as the first-line screening tool and followed by confirmatory testing with the RdRp gene assay; | Jan 23, 2020 |
| CoronaVIR_4 | First-line screening(less sensitive) | 31992387 | N | CACATTGGCACCCGCAATC | GAGGAACGAGAAGAGGCTTG | FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ | FAM: reporter 6-carboxyfluorescein; BBQ: BlackBerry Quencher | Use 600 nM, 800nM and 200nM of forward primer, reverse primer and probe, respectively per reaction.Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. | N gene assay also performed well but was not subjected to intensive further validation because it was slightly less sensitive | Jan 23, 2020 |
| CoronaVIR_5 | Detect 2019-nCoV and similar strains | 32007145 | ORF1a | AGAAGATTGGTTAGATGATGATAGT | TTCCATCTCTAATTGAGGTTGAACC | FAM-TCCTCACTGCCGTCTTGTTGACCA-BHQ1 | FAM: reporter 6-carboxyfluorescein; BHQ1: quencher Black Hole Quencher 1 | RT-PCR was done with 30 μL reaction volumes consisting of 14 μL of diluted RNA, 15 μL of 2X Taqman One-Step RT-PCR Master Mix Reagents 0·5 μL of 40X MultiScribe and RNase inhibitor mixture, 0·75 μL forward primer (10 μmol/L), 0·75 μL reverse primer (10 μmol/L), and 0·375 μL probe (10 μmol/L). Thermal cycling parameters were 30 min at 42°C, followed by 10 min at 95°C, and a subsequent 40 cycles of amplification (95°C for 15 s and 58°C for 45 s). Fluorescence was recorded during the 58°C phase. | Notably, 2019-nCoV was closely related (with 88% identity) to two bat-derived severe acute respiratory syndrome (SARS)-like coronaviruses, bat-SL-CoVZC45 and bat-SL-CoVZXC21, collected in 2018 in Zhoushan, eastern China, but were more distant from SARS-CoV (about 79%) and MERS-CoV (about 50%); Importantly, structural analysis suggests that 2019-nCoV might be able to bind to the angiotensin-converting enzyme 2 receptor in humans. | Jan 30, 2020 |
| CoronaVIR_6 | Screen 2019-nCoV and similar strains (less sensitive) | 32031583 | ORF1b | TGGGGYTTTACRGGTAACCT ( Y = C/T, R = A/G) | AACRCGCTTAACAAAGCACTC (R = A/G) | FAM/ZEN-TAGTTGTGATGCWATCATGACTAG-IBFQ format (W = A/T) | FAM: reporter 6-carboxyfluorescein; BHQ1: quencher Black Hole Quencher 1 | A typical 20 µL monoplex RT-PCR assay contained 5 μL of 4X master reaction mixture , 0.5 µmol/L of forward primer, 0.5 μmol/L of reverse primer, 0.25 μmo/L of probe, and 4 μl of RNA sample. RT-PCR reactions were conducted by a thermal cycler (ViiA7 Real-Time PCR system) with the following conditions: reverse transcription at 50°C for 5 min, inactivation of reverse transcriptase at 95°C for 20 s, 40 cycles of PCR amplification (Denaturing at 95°C for 5 s; Annealing/Extending at 60°C for 30 s). The time for each RT-PCR run was about 1 h and 15 min. | N gene assay is about 10 times more sensitive than the ORF-1b gene assay in detecting positive clinical specimens; this assay targeting the viruses (multiple viruses) in the subgenus Sarbecovirus were made and evaluated, because there is insufficient public information about the genetic diversity of 2019-nCoV | Jan 31, 2020 |
| CoronaVIR_7 | Screen 2019-nCoV and similar strains (less sensitive) | 32031583 | N | TAATCAGACAAGGAACTGATTA | CGAAGGTGTGACTTCCATG | FAM/ZEN-GCAAATTGTGCAATTTGCGG-IBFQ format | FAM: reporter 6-carboxyfluorescein; BHQ1: quencher Black Hole Quencher 1 | A typical 20 µL monoplex RT-PCR assay contained 5 μL of 4X master reaction mixture , 0.5 µmol/L of forward primer, 0.5 μmol/L of reverse primer, 0.25 μmo/L of probe, and 4 μl of RNA sample. RT-PCR reactions were conducted by a thermal cycler (ViiA7 Real-Time PCR system) with the following conditions: reverse transcription at 50°C for 5 min, inactivation of reverse transcriptase at 95°C for 20 s, 40 cycles of PCR amplification (Denaturing at 95°C for 5 s; Annealing/Extending at 60°C for 30 s). The time for each RT-PCR run was about 1 h and 15 min. | N gene assay is about 10 times more sensitive than the ORF-1b gene assay in detecting positive clinical specimens; this assay targeting the viruses (multiple viruses) in the subgenus Sarbecovirus were made and evaluated, because there is insufficient public information about the genetic diversity of 2019-nCoV | Jan 31, 2020 |
| CoronaVIR_8 | NA | 31986264 | NP | ACTTCTTTTTCTTGCTTTCGTGGT | GCAGCAGTACGCACACAATC | CY5-CTAGTTACACTAGCCATCCTTACTGC-BHQ1 | CY5: reporter cyanine; BHQ1: quencher Black Hole Quencher 1 | Conditions for the amplifications were 50°C for 15 min, 95°C for 3 min, followed by 45 cycles of 95°C for 15 s and 60°C for 30 s. 5 μL RNA was used for real-time RT-PCR, which targeted the NP gene using AgPath-ID One-Step RT-PCR Reagent (AM1005; Thermo Fisher Scientific). The final reaction mix concentration of the primers was 500 nM and probe was 200 nM. Real-time RT-PCR was performed using the following conditions: 50°C for 15 min and 95°C for 3 min, 50 cycles of amplification at 95°C for 10 s and 60°C for 45 s. | NA | Feb 15, 2020 |
| CoronaVIR_9 | One of Markers for 2019-nCoV screening (not validated on multiple platform) | CDC | N (N1) | GACCCCAAAATCAGCGAAAT | TCTGGTTACTGCCAGTTGAATCTG | FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 | FAM: reporter 6-carboxyfluorescein; BHQ1: quencher Black Hole Quencher 1 | Use 20 µM, 20 µM and 5 µM working concentarion of forward primer, reverse primer and proble, respectively. UNG Incubation (1 cycle, 25 C for 2 minutes), Reverse Transcription Incubation (1 cycle, 50 C for 15 minutes), Enzyme activation (1 cycle, 95 C for 2 minutes), Amplification(45 cycle, 95 C for 3 second; 55 for 30 sec). | The rRT-PCR assays described here have not been validated for platforms. Inferences from results as following: (1) When all controls exhibit the expected performance, a specimen is considered negative if all 2019-nCoV markers (N1, N2, N3) cycle threshold growth curves DO NOT cross the threshold AND the RNase P growth curve DOES cross the threshold line. (2)When all controls exhibit the expected performance, a specimen is considered positive for 2019-nCoV if all markers (N1, N2, N3) cycle threshold growth curve crosses the threshold line. The RNase P may or may not be positive as described above, but the 2019-nCoV result is still valid. (3) When all controls exhibit the expected performance and the growth curves for the 2019-nCoV markers (N1, N2, N3) AND the RNase P marker DO NOT cross the cycle threshold growth curve, the result is invalid. The extracted RNA from the specimen should be re-tested. If residual RNA is not available, re-extract RNA from residual specimen and re-test. If the re-tested sample is negative for all markers and all controls exhibit the expected performance, the result is “Invalid.” (4) When all controls exhibit the expected performance and the cycle threshold growth curve for any one or two markers, (N1, N2, N3) but not all three crosses the threshold line the result is inconclusive for 2019-nCoV. Re-extract RNA from residual specimen and re-test. | Jan, 2020 |
| CoronaVIR_10 | One of Markers for 2019-nCoV screening (not validated on multiple platform) | CDC | N (N2) | TTACAAACATTGGCCGCAAA | GCGCGACATTCCGAAGAA | FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ1 | FAM: reporter 6-carboxyfluorescein; BHQ1: quencher Black Hole Quencher 1 | Use 20 µM, 20 µM and 5 µM working concentarion of forward primer, reverse primer and proble, respectively. UNG Incubation (1 cycle, 25 C for 2 minutes), Reverse transcription Incubation (1 cycle, 50 C for 15 minutes), Enzyme activation (1 cycle, 95 C for 2 minutes), Amplification(45 cycle, 95 C for 3 second; 55 for 30 sec). | The rRT-PCR assays described here have not been validated for platforms. Inferences from results as following: (1) When all controls exhibit the expected performance, a specimen is considered negative if all 2019-nCoV markers (N1, N2, N3) cycle threshold growth curves DO NOT cross the threshold AND the RNase P growth curve DOES cross the threshold line. (2). When all controls exhibit the expected performance, a specimen is considered positive for 2019-nCoV if all markers (N1, N2, N3) cycle threshold growth curve crosses the threshold line. The RNase P may or may not be positive as described above, but the 2019-nCoV result is still valid. (3) When all controls exhibit the expected performance and the growth curves for the 2019-nCoV markers (N1, N2, N3) AND the RNase P marker DO NOT cross the cycle threshold growth curve, the result is invalid. The extracted RNA from the specimen should be re-tested. If residual RNA is not available, re-extract RNA from residual specimen and re-test. If the re-tested sample is negative for all markers and all controls exhibit the expected performance, the result is “Invalid.” (4) When all controls exhibit the expected performance and the cycle threshold growth curve for any one or two markers, (N1, N2, N3) but not all three crosses the threshold line the result is inconclusive for 2019-nCoV. Re-extract RNA from residual specimen and re-test. | Jan, 2020 |
| CoronaVIR_11 | One of Markers for 2019-nCoV screening (not validated on multiple platform) | CDC | N (N3) | GGGAGCCTTGAATACACCAAAA | TGTAGCACGATTGCAGCATTG | FAM-AYCACATTGGCACCCGCAATCCTG-BHQ1 | FAM: reporter 6-carboxyfluorescein; BHQ1: quencher Black Hole Quencher 1 | Use 20 µM, 20 µM and 5 µM working concentarion of forward primer, reverse primer and proble, respectively. UNG Incubation (1 cycle, 25 C for 2 minutes), Reverse transcription Incubation (1 cycle, 50 C for 15 minutes), Enzyme activation (1 cycle, 95 C for 2 minutes), Amplification(45 cycle, 95 C for 3 second; 55 for 30 sec). | The rRT-PCR assays described here have not been validated for platforms. Inferences from results as following: (1) When all controls exhibit the expected performance, a specimen is considered negative if all 2019-nCoV markers (N1, N2, N3) cycle threshold growth curves DO NOT cross the threshold AND the RNase P growth curve DOES cross the threshold line. (2) When all controls exhibit the expected performance, a specimen is considered positive for 2019-nCoV if all markers (N1, N2, N3) cycle threshold growth curve crosses the threshold line. The RNase P may or may not be positive as described above, but the 2019-nCoV result is still valid. (3) When all controls exhibit the expected performance and the growth curves for the 2019-nCoV markers (N1, N2, N3) AND the RNase P marker DO NOT cross the cycle threshold growth curve, the result is invalid. The extracted RNA from the specimen should be re-tested. If residual RNA is not available, re-extract RNA from residual specimen and re-test. If the re-tested sample is negative for all markers and all controls exhibit the expected performance, the result is “Invalid.” (4) When all controls exhibit the expected performance and the cycle threshold growth curve for any one or two markers, (N1, N2, N3) but not all three crosses the threshold line the result is inconclusive for 2019-nCoV. Re-extract RNA from residual specimen and re-test. | Jan, 2020 |
| CoronaVIR_12 | Control for reaction 2019-nCoV | CDC | RNAse P | AGATTTGGACCTGCGAGCG | GAGCGGCTGTCTCCACAAGT | FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ-1 | FAM: reporter 6-carboxyfluorescein; BHQ1: quencher Black Hole Quencher 1 | Use 20 µM, 20 µM and 5 µM working concentarion of forward primer, reverse primer and proble, respectively. UNG Incubation (1 cycle, 25 C for 2 minutes), Reverse transcription Incubation (1 cycle, 50 C for 15 minutes), Enzyme activation (1 cycle, 95 C for 2 minutes), Amplification(45 cycle, 95 C for 3 second; 55 for 30 sec). | Tested for human RNAse P (RNP) gene to assess specimen quality. The rRT-PCR assays described here have not been validated for platforms. Inferences from results as following: (1) When all controls exhibit the expected performance, a specimen is considered negative if all 2019-nCoV markers (N1, N2, N3) cycle threshold growth curves DO NOT cross the threshold AND the RNase P growth curve DOES cross the threshold line. (2) When all controls exhibit the expected performance, a specimen is considered positive for 2019-nCoV if all markers (N1, N2, N3) cycle threshold growth curve crosses the threshold line. The RNase P may or may not be positive as described above, but the 2019-nCoV result is still valid. (3) When all controls exhibit the expected performance and the growth curves for the 2019-nCoV markers (N1, N2, N3) AND the RNase P marker DO NOT cross the cycle threshold growth curve, the result is invalid. The extracted RNA from the specimen should be re-tested. If residual RNA is not available, re-extract RNA from residual specimen and re-test. If the re-tested sample is negative for all markers and all controls exhibit the expected performance, the result is “Invalid.” (4) When all controls exhibit the expected performance and the cycle threshold growth curve for any one or two markers, (N1, N2, N3) but not all three crosses the threshold line the result is inconclusive for 2019-nCoV. Re-extract RNA from residual specimen and re-test. | Jan, 2020 |
Primers for other strains of Corona virus extracted from latest version of MRPrimerV.
|| CoronaVir || India_MOHFW || WHO Advisory || Status || Diagnostics Tests || Genome || Patient Mangagement || Drug Design || Raghava's Group ||
Disclaimer and CopyrightThis web site maintains information or links, collected and compiled from a wide range of sources (e.g., literature, databases, internet). Our aim is to facilitate the community to fight against COVID-19 but WITHOUT ANY WARRANTY OF RELIABILITY.