CoronaVIR: Collection and compilation of Computational Resources on Novel Coronavirus (SARS-CoV-2 or COVID-19)

Welcome to Page of Diagnostic Primers

--------------------------------------------------------------------------------------------------------------------------------------------------------

This page provides the information of Predicted Diagnostic Primers which can be used for the diagnosis of CoVID-19. These primers are predicted by Primer3_Core tool with default parameters. These primers are designated for E-gene of the strain based in template sequences of the genes taken from NCBI Virus Resource.

Note: These primers need experimental Validation.

--------------------------------------------------------------------------------------------------------------------------------------------------------

Table representing the predicted primers by Primer3_core for N-gene of nCoV-2019 strain diagnosis

Template Source ID	Template Source country	Gene	Fwd_Primer seq	Rev_Primer seq	oligo seq	Fwd_Primer Start Position	Fwd_Length	Rev_Primer Start Position	Rev_Length	Oligo Start pos	Oligo_Length	Target_Product size	Fwd_Primer Tm	Rev_Primer Tm	Oligo Tm	Fwd (GC%)	Rev (GC%)	Oligo (GC%)
MT111896	Austrailia	E	CTGAAAAATGGGAATCTGGAG	TGCTTACAAAGGCACGCTA	CACACAATCGACGGTTCATC	76	21	338	19	246	20	263	58.632	58.243	59.967	42.857	47.368	50
MT111896	Austrailia	E	ACTGAAAAATGGGAATCTGGA	TGCTTACAAAGGCACGCTA	CACACAATCGACGGTTCATC	75	21	338	19	246	20	264	58.243	58.243	59.967	38.095	47.368	50
MT111896	Austrailia	E	TGAAAAATGGGAATCTGGAGT	TGCTTACAAAGGCACGCTA	CACACAATCGACGGTTCATC	77	21	338	19	246	20	262	58.491	58.243	59.967	38.095	47.368	50
MT111896	Austrailia	E	ACTGAAAAATGGGAATCTGGAG	TGCTTACAAAGGCACGCTA	CACACAATCGACGGTTCATC	75	22	338	19	246	20	264	59.46	58.243	59.967	40.909	47.368	50
MT111896	Austrailia	E	CTGAAAAATGGGAATCTGGAGT	TGCTTACAAAGGCACGCTA	CACACAATCGACGGTTCATC	76	22	338	19	246	20	263	59.46	58.243	59.967	40.909	47.368	50