Cancertope

In silico Platform for designing genome-based
Personalized immunotherapy or Vaccine against Cancer

Browse Results ...


The result page of search shows exclusive peptide/epitopes generated due to mutation [Neoepitope], the tissue of origin [Tissue], position of peptide in protein [Position], number of mismatches counted by aligning mutated and normal protein sequence [Num Mismatch, percentage of cell lines with this peptide over total number of cell lines [Promiscuity %]. The immune information include CTL epitopes (Yes/No), MHC I binders, MHC II binders (both given as number of alleles) and B cell epitopes (Yes/No). For more information, please click HERE


Result Reset Search:
ProteinNeoepitopesTissuePositionProt MutationcDNA MutationMutation TypeNum MismatchPromiscuity (%)Cell LineCTLMHC INHLApredMHC IIBcell
ABL1GTVTPPPGWOVARY797p.P802fsc.2404_2404delCFrame_Shift_Del20.11IGROV1N200Y
ABL1RGTVTPPPGOVARY796p.P802fsc.2404_2404delCFrame_Shift_Del10.11IGROV1N000Y
AKAP12AVEECKEEEOVARY261p.G269delc.804_806delAGGIn_Frame_Del10.88CAOV3N000N
AKAP12CKEEEEKQEOVARY265p.G269delc.804_806delAGGIn_Frame_Del30.88CAOV3N000Y
AKAP12ECKEEEEKQOVARY264p.G269delc.804_806delAGGIn_Frame_Del30.88CAOV3N000N
AKAP12EECKEEEEKOVARY263p.G269delc.804_806delAGGIn_Frame_Del20.88CAOV3N000N
AKAP12EEEEKQEKEOVARY267p.G269delc.804_806delAGGIn_Frame_Del10.88CAOV3N000N
AKAP12EEEKQEKEPOVARY268p.G269delc.804_806delAGGIn_Frame_Del10.88CAOV3N000N
AKAP12KEEEEKQEKOVARY266p.G269delc.804_806delAGGIn_Frame_Del20.88CAOV3N300N
AKAP12VEECKEEEEOVARY262p.G269delc.804_806delAGGIn_Frame_Del10.88CAOV3N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.8659MN000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86A2780N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAOV3N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAOV4N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86COLO704N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86COV318N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86COV362N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86COV434N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86COV644N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86EFO27N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86ES2N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86FUOV1N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HEYA8N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS571TN000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86IGROV1N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHOC5N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHOM1N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHOM2BN000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHOS2N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHOS4N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KURAMOCHIN000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NIHOVCAR3N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OAW28N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OAW42N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OC316N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86ONCODG1N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OV56N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OVCAR4N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OVCAR8N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OVK18N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OVKATEN000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OVMANAN000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OVTOKON000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86RMGIN000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86RMUGSN000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU119N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU840N000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TOV21GN000N
AKAP12AIEEDLEPEOVARY1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TYKNUN000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.8659MN000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86A2780N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAOV3N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAOV4N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86COLO704N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86COV318N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86COV362N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86COV434N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86COV644N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86EFO27N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86ES2N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86FUOV1N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HEYA8N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS571TN000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86IGROV1N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHOC5N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHOM1N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHOM2BN000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHOS2N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHOS4N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KURAMOCHIN000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NIHOVCAR3N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OAW28N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OAW42N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OC316N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86ONCODG1N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OV56N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OVCAR4N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OVCAR8N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OVK18N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OVKATEN000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OVMANAN000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OVTOKON000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86RMGIN000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86RMUGSN000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU119N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU840N000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TOV21GN000N
AKAP12EEDLEPENGOVARY1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TYKNUN000N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.8659MN200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86A2780N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAOV3N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAOV4N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86COLO704N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86COV318N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86COV362N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86COV434N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86COV644N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86EFO27N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86ES2N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86FUOV1N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HEYA8N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS571TN200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86IGROV1N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHOC5N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHOM1N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHOM2BN200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHOS2N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHOS4N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KURAMOCHIN200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NIHOVCAR3N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OAW28N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OAW42N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OC316N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86ONCODG1N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OV56N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OVCAR4N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OVCAR8N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OVK18N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OVKATEN200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OVMANAN200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OVTOKON200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86RMGIN200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86RMUGSN200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU119N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU840N200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TOV21GN200N
AKAP12IEEDLEPENOVARY1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TYKNUN200N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.8659MN000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86A2780N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAOV3N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAOV4N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86COLO704N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86COV318N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86COV362N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86COV434N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86COV644N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86EFO27N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86ES2N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86FUOV1N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HEYA8N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS571TN000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86IGROV1N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHOC5N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHOM1N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHOM2BN000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHOS2N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHOS4N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KURAMOCHIN000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NIHOVCAR3N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OAW28N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OAW42N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OC316N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86ONCODG1N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OV56N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OVCAR4N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OVCAR8N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OVK18N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OVKATEN000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OVMANAN000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OVTOKON000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86RMGIN000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86RMUGSN000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU119N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU840N000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TOV21GN000N
AKAP12KVSVAIEEDOVARY1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TYKNUN000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.8659MN000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86A2780N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAOV3N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAOV4N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86COLO704N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86COV318N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86COV362N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86COV434N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86COV644N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86EFO27N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86ES2N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86FUOV1N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HEYA8N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS571TN000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86IGROV1N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHOC5N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHOM1N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHOM2BN000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHOS2N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHOS4N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KURAMOCHIN000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NIHOVCAR3N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OAW28N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OAW42N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OC316N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86ONCODG1N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OV56N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OVCAR4N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OVCAR8N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OVK18N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OVKATEN000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OVMANAN000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OVTOKON000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86RMGIN000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86RMUGSN000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU119N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU840N000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TOV21GN000N
AKAP12SVAIEEDLEOVARY1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TYKNUN000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.8659MN000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86A2780N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAOV3N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAOV4N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86COLO704N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86COV318N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86COV362N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86COV434N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86COV644N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86EFO27N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86ES2N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86FUOV1N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HEYA8N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS571TN000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86IGROV1N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHOC5N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHOM1N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHOM2BN000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHOS2N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHOS4N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KURAMOCHIN000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NIHOVCAR3N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OAW28N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OAW42N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OC316N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86ONCODG1N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OV56N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OVCAR4N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OVCAR8N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OVK18N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OVKATEN000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OVMANAN000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OVTOKON000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86RMGIN000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86RMUGSN000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU119N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU840N000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TOV21GN000N
AKAP12VAIEEDLEPOVARY1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TYKNUN000N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.8659MN002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86A2780N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAOV3N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAOV4N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86COLO704N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86COV318N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86COV362N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86COV434N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86COV644N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86EFO27N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86ES2N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86FUOV1N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HEYA8N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS571TN002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86IGROV1N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHOC5N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHOM1N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHOM2BN002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHOS2N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHOS4N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KURAMOCHIN002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NIHOVCAR3N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OAW28N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OAW42N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OC316N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86ONCODG1N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OV56N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OVCAR4N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OVCAR8N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OVK18N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OVKATEN002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OVMANAN002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OVTOKON002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86RMGIN002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86RMUGSN002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU119N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU840N002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TOV21GN002N
AKAP12VKVSVAIEEOVARY1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TYKNUN002N
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.8659MN1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86A2780N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAOV3N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAOV4N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86COLO704N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86COV318N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86COV362N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86COV434N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86COV644N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86EFO27N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86ES2N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86FUOV1N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HEYA8N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS571TN1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86IGROV1N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHOC5N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHOM1N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHOM2BN1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHOS2N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHOS4N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KURAMOCHIN1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NIHOVCAR3N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OAW28N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OAW42N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OC316N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86ONCODG1N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OV56N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OVCAR4N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OVCAR8N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OVK18N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OVKATEN1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OVMANAN1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OVTOKON1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86RMGIN1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86RMUGSN1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU119N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU840N1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TOV21GN1500Y
AKAP12VSVAIEEDLOVARY1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TYKNUN1500Y
AKAP9DLEKTKQLEOVARY1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27A2780N000N
AKAP9DLEKTKQLEOVARY1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CAOV3N000N
AKAP9DLEKTKQLEOVARY1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27COLO704N000N
AKAP9DLEKTKQLEOVARY1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27COV318N000N
AKAP9DLEKTKQLEOVARY1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27COV504N000N
AKAP9DLEKTKQLEOVARY1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27COV644N000N
AKAP9DLEKTKQLEOVARY1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27ES2N000N
AKAP9DLEKTKQLEOVARY1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27IGROV1N000N
AKAP9DLEKTKQLEOVARY1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KURAMOCHIN000N
AKAP9DLEKTKQLEOVARY1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27OAW28N000N
AKAP9DLEKTKQLEOVARY1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27OVTOKON000N
AKAP9DLEKTKQLEOVARY1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKOV3N000N
AKAP9DLEKTKQLEOVARY1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU119N000N
AKAP9DLEKTKQLEOVARY1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU8N000N
AKAP9EKTKQLEEQOVARY1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27A2780N000N
AKAP9EKTKQLEEQOVARY1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CAOV3N000N
AKAP9EKTKQLEEQOVARY1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27COLO704N000N
AKAP9EKTKQLEEQOVARY1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27COV318N000N
AKAP9EKTKQLEEQOVARY1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27COV504N000N
AKAP9EKTKQLEEQOVARY1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27COV644N000N
AKAP9EKTKQLEEQOVARY1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27ES2N000N
AKAP9EKTKQLEEQOVARY1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27IGROV1N000N
AKAP9EKTKQLEEQOVARY1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KURAMOCHIN000N
AKAP9EKTKQLEEQOVARY1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27OAW28N000N
AKAP9EKTKQLEEQOVARY1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27OVTOKON000N
AKAP9EKTKQLEEQOVARY1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKOV3N000N
AKAP9EKTKQLEEQOVARY1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU119N000N
AKAP9EKTKQLEEQOVARY1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU8N000N
AKAP9KQLEEQVQEOVARY1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27A2780N000N
AKAP9KQLEEQVQEOVARY1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CAOV3N000N
AKAP9KQLEEQVQEOVARY1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27COLO704N000N
AKAP9KQLEEQVQEOVARY1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27COV318N000N
AKAP9KQLEEQVQEOVARY1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27COV504N000N
AKAP9KQLEEQVQEOVARY1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27COV644N000N
AKAP9KQLEEQVQEOVARY1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27ES2N000N
AKAP9KQLEEQVQEOVARY1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27IGROV1N000N
AKAP9KQLEEQVQEOVARY1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KURAMOCHIN000N
AKAP9KQLEEQVQEOVARY1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27OAW28N000N
AKAP9KQLEEQVQEOVARY1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27OVTOKON000N
AKAP9KQLEEQVQEOVARY1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKOV3N000N
AKAP9KQLEEQVQEOVARY1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU119N000N
AKAP9KQLEEQVQEOVARY1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU8N000N
AKAP9KTKQLEEQVOVARY1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27A2780N200N
AKAP9KTKQLEEQVOVARY1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27CAOV3N200N
AKAP9KTKQLEEQVOVARY1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27COLO704N200N
AKAP9KTKQLEEQVOVARY1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27COV318N200N
AKAP9KTKQLEEQVOVARY1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27COV504N200N
AKAP9KTKQLEEQVOVARY1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27COV644N200N
AKAP9KTKQLEEQVOVARY1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27ES2N200N
AKAP9KTKQLEEQVOVARY1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27IGROV1N200N
AKAP9KTKQLEEQVOVARY1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27KURAMOCHIN200N
AKAP9KTKQLEEQVOVARY1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27OAW28N200N
AKAP9KTKQLEEQVOVARY1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27OVTOKON200N
AKAP9KTKQLEEQVOVARY1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SKOV3N200N
AKAP9KTKQLEEQVOVARY1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SNU119N200N
AKAP9KTKQLEEQVOVARY1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SNU8N200N
AKAP9LEKTKQLEEOVARY1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27A2780N000N
AKAP9LEKTKQLEEOVARY1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CAOV3N000N
AKAP9LEKTKQLEEOVARY1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27COLO704N000N
AKAP9LEKTKQLEEOVARY1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27COV318N000N
AKAP9LEKTKQLEEOVARY1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27COV504N000N
AKAP9LEKTKQLEEOVARY1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27COV644N000N
AKAP9LEKTKQLEEOVARY1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27ES2N000N
AKAP9LEKTKQLEEOVARY1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27IGROV1N000N
AKAP9LEKTKQLEEOVARY1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KURAMOCHIN000N
AKAP9LEKTKQLEEOVARY1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27OAW28N000N
AKAP9LEKTKQLEEOVARY1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27OVTOKON000N
AKAP9LEKTKQLEEOVARY1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKOV3N000N
AKAP9LEKTKQLEEOVARY1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU119N000N
AKAP9LEKTKQLEEOVARY1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU8N000N
AKAP9LQDLEKTKQOVARY1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27A2780N000N
AKAP9LQDLEKTKQOVARY1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27CAOV3N000N
AKAP9LQDLEKTKQOVARY1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27COLO704N000N
AKAP9LQDLEKTKQOVARY1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27COV318N000N
AKAP9LQDLEKTKQOVARY1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27COV504N000N
AKAP9LQDLEKTKQOVARY1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27COV644N000N
AKAP9LQDLEKTKQOVARY1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27ES2N000N
AKAP9LQDLEKTKQOVARY1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27IGROV1N000N
AKAP9LQDLEKTKQOVARY1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KURAMOCHIN000N
AKAP9LQDLEKTKQOVARY1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27OAW28N000N
AKAP9LQDLEKTKQOVARY1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27OVTOKON000N
AKAP9LQDLEKTKQOVARY1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SKOV3N000N
AKAP9LQDLEKTKQOVARY1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SNU119N000N
AKAP9LQDLEKTKQOVARY1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SNU8N000N
AKAP9QDLEKTKQLOVARY1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27A2780N900N
AKAP9QDLEKTKQLOVARY1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CAOV3N900N
AKAP9QDLEKTKQLOVARY1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27COLO704N900N
AKAP9QDLEKTKQLOVARY1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27COV318N900N
AKAP9QDLEKTKQLOVARY1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27COV504N900N
AKAP9QDLEKTKQLOVARY1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27COV644N900N
AKAP9QDLEKTKQLOVARY1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27ES2N900N
AKAP9QDLEKTKQLOVARY1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27IGROV1N900N
AKAP9QDLEKTKQLOVARY1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KURAMOCHIN900N
AKAP9QDLEKTKQLOVARY1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27OAW28N900N
AKAP9QDLEKTKQLOVARY1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27OVTOKON900N
AKAP9QDLEKTKQLOVARY1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKOV3N900N
AKAP9QDLEKTKQLOVARY1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU119N900N
AKAP9QDLEKTKQLOVARY1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU8N900N
AKAP9QLEEQVQELOVARY1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27A2780N1200N
AKAP9QLEEQVQELOVARY1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27CAOV3N1200N
AKAP9QLEEQVQELOVARY1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27COLO704N1200N
AKAP9QLEEQVQELOVARY1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27COV318N1200N
AKAP9QLEEQVQELOVARY1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27COV504N1200N
AKAP9QLEEQVQELOVARY1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27COV644N1200N
AKAP9QLEEQVQELOVARY1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27ES2N1200N
AKAP9QLEEQVQELOVARY1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27IGROV1N1200N
AKAP9QLEEQVQELOVARY1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KURAMOCHIN1200N
AKAP9QLEEQVQELOVARY1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27OAW28N1200N
AKAP9QLEEQVQELOVARY1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27OVTOKON1200N
AKAP9QLEEQVQELOVARY1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SKOV3N1200N
AKAP9QLEEQVQELOVARY1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SNU119N1200N
AKAP9QLEEQVQELOVARY1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SNU8N1200N
AKAP9TKQLEEQVQOVARY1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27A2780N000N
AKAP9TKQLEEQVQOVARY1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CAOV3N000N
AKAP9TKQLEEQVQOVARY1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27COLO704N000N
AKAP9TKQLEEQVQOVARY1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27COV318N000N
AKAP9TKQLEEQVQOVARY1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27COV504N000N
AKAP9TKQLEEQVQOVARY1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27COV644N000N
AKAP9TKQLEEQVQOVARY1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27ES2N000N
AKAP9TKQLEEQVQOVARY1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27IGROV1N000N
AKAP9TKQLEEQVQOVARY1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KURAMOCHIN000N
AKAP9TKQLEEQVQOVARY1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27OAW28N000N
AKAP9TKQLEEQVQOVARY1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27OVTOKON000N
AKAP9TKQLEEQVQOVARY1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKOV3N000N
AKAP9TKQLEEQVQOVARY1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU119N000N
AKAP9TKQLEEQVQOVARY1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU8N000N
AKAP9AMELQEQLSOVARY3147p.T3148Mc.9443C>TMissense_Mutation10.11OC316N000N
AKAP9DGLQNEMGQOVARY668p.S675Gc.2023A>GMissense_Mutation10.11OVMANAN000N
AKAP9DQLNGQVTKOVARY2295p.E2299Gc.6896A>GMissense_Mutation10.11OV56N200Y
AKAP9DRAMELQEQOVARY3145p.T3148Mc.9443C>TMissense_Mutation10.11OC316N000N
AKAP9EEKRESRKIOVARY3451p.R3458Kc.10373G>AMissense_Mutation10.11EFO27N600N
AKAP9EIDQLNGQVOVARY2293p.E2299Gc.6896A>GMissense_Mutation10.11OV56N200N
AKAP9EKRESRKILOVARY3452p.R3458Kc.10373G>AMissense_Mutation10.11EFO27N600N
AKAP9ELRVLLESEOVARY3297p.Q3299Rc.9896A>GMissense_Mutation10.11OVK18N000N
AKAP9EMGQKIETMOVARY673p.S675Gc.2023A>GMissense_Mutation10.11OVMANAN300N
AKAP9EQGRNLELROVARY3291p.Q3299Rc.9896A>GMissense_Mutation10.11OVK18Y4110N
AKAP9ESRKILYQNOVARY3455p.R3458Kc.10373G>AMissense_Mutation10.11EFO27N000N
AKAP9ESTIMRTLYOVARY80p.H88Yc.262C>TMissense_Mutation10.11OC316N600N
AKAP9EVEIDQLNGOVARY2291p.E2299Gc.6896A>GMissense_Mutation10.11OV56N100N
AKAP9GLQNEMGQKOVARY669p.S675Gc.2023A>GMissense_Mutation10.11OVMANAN500Y
AKAP9GQKIETMQFOVARY675p.S675Gc.2023A>GMissense_Mutation10.11OVMANAN400N
AKAP9GQVTKLQQQOVARY2299p.E2299Gc.6896A>GMissense_Mutation10.11OV56N000N
AKAP9GRNLELRVLOVARY3293p.Q3299Rc.9896A>GMissense_Mutation10.11OVK18Y6100N
AKAP9GTLKISSSHOVARY2784p.N2792Hc.8374A>CMissense_Mutation10.11JHOC5N000N
AKAP9HQTPQILVKOVARY2792p.N2792Hc.8374A>CMissense_Mutation10.11JHOC5N500N
AKAP9IDGLQNEMGOVARY667p.S675Gc.2023A>GMissense_Mutation10.11OVMANAN100N
AKAP9IDQLNGQVTOVARY2294p.E2299Gc.6896A>GMissense_Mutation10.11OV56N200N
AKAP9IMRTLYSGEOVARY83p.H88Yc.262C>TMissense_Mutation10.11OC316N000N
AKAP9ISSSHQTPQOVARY2788p.N2792Hc.8374A>CMissense_Mutation10.11JHOC5N000Y
AKAP9KDRAMELQEOVARY3144p.T3148Mc.9443C>TMissense_Mutation10.11OC316N000Y
AKAP9KILYQNLNEOVARY3458p.R3458Kc.10373G>AMissense_Mutation10.11EFO27N000N
AKAP9KISSSHQTPOVARY2787p.N2792Hc.8374A>CMissense_Mutation10.11JHOC5N000Y
AKAP9KRESRKILYOVARY3453p.R3458Kc.10373G>AMissense_Mutation10.11EFO27N400N
AKAP9LELRVLLESOVARY3296p.Q3299Rc.9896A>GMissense_Mutation10.11OVK18N5023N
AKAP9LKISSSHQTOVARY2786p.N2792Hc.8374A>CMissense_Mutation10.11JHOC5N1010Y
AKAP9LNGQVTKLQOVARY2297p.E2299Gc.6896A>GMissense_Mutation10.11OV56N0012N
AKAP9LQNEMGQKIOVARY670p.S675Gc.2023A>GMissense_Mutation10.11OVMANAN1002Y
AKAP9LRVLLESEKOVARY3298p.Q3299Rc.9896A>GMissense_Mutation10.11OVK18N202N
AKAP9LSSMKDRAMOVARY3140p.T3148Mc.9443C>TMissense_Mutation10.11OC316N400Y
AKAP9LYSGEITSHOVARY87p.H88Yc.262C>TMissense_Mutation10.11OC316N005N
AKAP9MELQEQLSSOVARY3148p.T3148Mc.9443C>TMissense_Mutation10.11OC316N4016N
AKAP9MGQKIETMQOVARY674p.S675Gc.2023A>GMissense_Mutation10.11OVMANAN000N
AKAP9MKDRAMELQOVARY3143p.T3148Mc.9443C>TMissense_Mutation10.11OC316N000Y
AKAP9MRTLYSGEIOVARY84p.H88Yc.262C>TMissense_Mutation10.11OC316N4022N
AKAP9NEMGQKIETOVARY672p.S675Gc.2023A>GMissense_Mutation10.11OVMANAN500N
AKAP9NGQVTKLQQOVARY2298p.E2299Gc.6896A>GMissense_Mutation10.11OV56N000N
AKAP9NLELRVLLEOVARY3295p.Q3299Rc.9896A>GMissense_Mutation10.11OVK18N000N
AKAP9QGRNLELRVOVARY3292p.Q3299Rc.9896A>GMissense_Mutation10.11OVK18N400N
AKAP9QLNGQVTKLOVARY2296p.E2299Gc.6896A>GMissense_Mutation10.11OV56Y12120N
AKAP9QNEMGQKIEOVARY671p.S675Gc.2023A>GMissense_Mutation10.11OVMANAN000Y
AKAP9RAMELQEQLOVARY3146p.T3148Mc.9443C>TMissense_Mutation10.11OC316Y1990N
AKAP9REEKRESRKOVARY3450p.R3458Kc.10373G>AMissense_Mutation10.11EFO27Y2140N
AKAP9RESRKILYQOVARY3454p.R3458Kc.10373G>AMissense_Mutation10.11EFO27N000Y
AKAP9RKILYQNLNOVARY3457p.R3458Kc.10373G>AMissense_Mutation10.11EFO27N100N
AKAP9RNLELRVLLOVARY3294p.Q3299Rc.9896A>GMissense_Mutation10.11OVK18Y17180N
AKAP9RTLYSGEITOVARY85p.H88Yc.262C>TMissense_Mutation10.11OC316N100N
AKAP9RVLLESEKVOVARY3299p.Q3299Rc.9896A>GMissense_Mutation10.11OVK18N700N
AKAP9SHQTPQILVOVARY2791p.N2792Hc.8374A>CMissense_Mutation10.11JHOC5N300N
AKAP9SMKDRAMELOVARY3142p.T3148Mc.9443C>TMissense_Mutation10.11OC316Y1290Y
AKAP9SRKILYQNLOVARY3456p.R3458Kc.10373G>AMissense_Mutation10.11EFO27Y6100N
AKAP9SSHQTPQILOVARY2790p.N2792Hc.8374A>CMissense_Mutation10.11JHOC5Y9110Y
AKAP9SSMKDRAMEOVARY3141p.T3148Mc.9443C>TMissense_Mutation10.11OC316N000Y
AKAP9SSSHQTPQIOVARY2789p.N2792Hc.8374A>CMissense_Mutation10.11JHOC5N400Y
AKAP9STIMRTLYSOVARY81p.H88Yc.262C>TMissense_Mutation10.11OC316N100N
AKAP9TIMRTLYSGOVARY82p.H88Yc.262C>TMissense_Mutation10.11OC316N000N
AKAP9TLKISSSHQOVARY2785p.N2792Hc.8374A>CMissense_Mutation10.11JHOC5N000N
AKAP9TLYSGEITSOVARY86p.H88Yc.262C>TMissense_Mutation10.11OC316N100N
AKAP9VEIDQLNGQOVARY2292p.E2299Gc.6896A>GMissense_Mutation10.11OV56N2010Y
AKAP9YSGEITSHEOVARY88p.H88Yc.262C>TMissense_Mutation10.11OC316N102N
ALKAAPVQSQRAOVARY165p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N400N
ALKAPPSLPDLROVARY213p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N300Y
ALKAPVQSQRAVOVARY166p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316Y1290N
ALKAREEGVGSGOVARY191p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N100N
ALKATEDPPDAROVARY184p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N500N
ALKAVQLVDSPROVARY173p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N600N
ALKAVRGNSRLPOVARY204p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N000N
ALKCGAAPVQSQOVARY163p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N000N
ALKCVGPPRGGGOVARY154p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N000Y
ALKDAREEGVGSOVARY190p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N300N
ALKDPPDAREEGOVARY187p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N000N
ALKDSPRRRATEOVARY178p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N000N
ALKEDPPDAREEOVARY186p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N000N
ALKEEGVGSGQROVARY193p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N100N
ALKEGCVGPPRGOVARY152p.P158fsc.474_475insCFrame_Shift_Ins20.11OC316N000N
ALKEGVGSGQRGOVARY194p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N000N
ALKGAAPVQSQROVARY164p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316Y3100N
ALKGCGAAPVQSOVARY162p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N000N
ALKGCVGPPRGGOVARY153p.P158fsc.474_475insCFrame_Shift_Ins30.11OC316N000N
ALKGGCGAAPVQOVARY161p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N000N
ALKGGGCGAAPVOVARY160p.P158fsc.474_475insCFrame_Shift_Ins30.11OC316N700N
ALKGKAVRGNSROVARY202p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N100N
ALKGNSRLPAPPOVARY207p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N000N
ALKGPPRGGGCGOVARY156p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N000N
ALKGQRGKAVRGOVARY199p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N000N
ALKGSGQRGKAVOVARY197p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N400N
ALKGVGSGQRGKOVARY195p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N300N
ALKKAVRGNSRLOVARY203p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N1600N
ALKLEGCVGPPROVARY151p.P158fsc.474_475insCFrame_Shift_Ins10.11OC316N000N
ALKLPAPPSLPDOVARY211p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N200N
ALKLVDSPRRRAOVARY176p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316Y2115N
ALKNSRLPAPPSOVARY208p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N000N
ALKPAPPSLPDLOVARY212p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N100N
ALKPDAREEGVGOVARY189p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N000N
ALKPPDAREEGVOVARY188p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N500N
ALKPPRGGGCGAOVARY157p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N400N
ALKPPSLPDLRDOVARY214p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N000N
ALKPRGGGCGAAOVARY158p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N100N
ALKPRRRATEDPOVARY180p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N000N
ALKPSLPDLRDWOVARY215p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N100N
ALKPVQSQRAVQOVARY167p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N000N
ALKQLVDSPRRROVARY175p.P158fsc.474_475insCFrame_Shift_Ins60.11OC316N500N
ALKQRAVQLVDSOVARY171p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N200N
ALKQRGKAVRGNOVARY200p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N200N
ALKQSQRAVQLVOVARY169p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N200N
ALKRATEDPPDAOVARY183p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N300N
ALKRAVQLVDSPOVARY172p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N000N
ALKREEGVGSGQOVARY192p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N000N
ALKRGGGCGAAPOVARY159p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N000N
ALKRGKAVRGNSOVARY201p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N000N
ALKRGNSRLPAPOVARY206p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N000N
ALKRLPAPPSLPOVARY210p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N000N
ALKRRATEDPPDOVARY182p.P158fsc.474_475insCFrame_Shift_Ins60.11OC316N200N
ALKRRRATEDPPOVARY181p.P158fsc.474_475insCFrame_Shift_Ins60.11OC316N300N
ALKSGQRGKAVROVARY198p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N100N
ALKSLPDLRDWSOVARY216p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N000N
ALKSPRRRATEDOVARY179p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N200N
ALKSQRAVQLVDOVARY170p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316N100N
ALKSRLPAPPSLOVARY209p.P158fsc.474_475insCFrame_Shift_Ins40.11OC316Y7100N
ALKTEDPPDAREOVARY185p.P158fsc.474_475insCFrame_Shift_Ins60.11OC316N000N
ALKVDSPRRRATOVARY177p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N100N
ALKVGPPRGGGCOVARY155p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N100Y
ALKVGSGQRGKAOVARY196p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N201N
ALKVQLVDSPRROVARY174p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N604N
ALKVQSQRAVQLOVARY168p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N1302N
ALKVRGNSRLPAOVARY205p.P158fsc.474_475insCFrame_Shift_Ins50.11OC316N6037N
ALKAAGGGGCWNOVARY876p.G882Cc.2644G>TMissense_Mutation10.11EFO27N100N
ALKAGGGGCWNDOVARY877p.G882Cc.2644G>TMissense_Mutation10.11EFO27N000N
ALKALQRSFTCWOVARY436p.S439Rc.1317C>GMissense_Mutation10.11OV56N400N
ALKCWNDNTSLLOVARY882p.G882Cc.2644G>TMissense_Mutation10.11EFO27Y9110N
ALKGAAGGGGCWOVARY875p.G882Cc.2644G>TMissense_Mutation10.11EFO27N200N
ALKGCWNDNTSLOVARY881p.G882Cc.2644G>TMissense_Mutation10.11EFO27N600N
ALKGGCWNDNTSOVARY880p.G882Cc.2644G>TMissense_Mutation10.11EFO27N000N
ALKGGGCWNDNTOVARY879p.G882Cc.2644G>TMissense_Mutation10.11EFO27N100N
ALKGGGGCWNDNOVARY878p.G882Cc.2644G>TMissense_Mutation10.11EFO27N000N
ALKGSKMALQRSOVARY432p.S439Rc.1317C>GMissense_Mutation10.11OV56N000N
ALKKMALQRSFTOVARY434p.S439Rc.1317C>GMissense_Mutation10.11OV56N300N
ALKKVGSVRKLROVARY128p.G129Vc.386G>TMissense_Mutation10.11OVTOKOY690N
ALKLKVGSVRKLOVARY127p.G129Vc.386G>TMissense_Mutation10.11OVTOKON701N
ALKLQRSFTCWNOVARY437p.S439Rc.1317C>GMissense_Mutation10.11OV56N107N
ALKLSRVLKVGSOVARY123p.G129Vc.386G>TMissense_Mutation10.11OVTOKON0012N
ALKMALQRSFTCOVARY435p.S439Rc.1317C>GMissense_Mutation10.11OV56N507N
ALKPGSKMALQROVARY431p.S439Rc.1317C>GMissense_Mutation10.11OV56N000N
ALKQRSFTCWNGOVARY438p.S439Rc.1317C>GMissense_Mutation10.11OV56N100N
ALKRSFTCWNGTOVARY439p.S439Rc.1317C>GMissense_Mutation10.11OV56N200N
ALKRTLSRVLKVOVARY121p.G129Vc.386G>TMissense_Mutation10.11OVTOKOY10120N
ALKRVLKVGSVROVARY125p.G129Vc.386G>TMissense_Mutation10.11OVTOKON600N
ALKSGAAGGGGCOVARY874p.G882Cc.2644G>TMissense_Mutation10.11EFO27N100Y
ALKSKMALQRSFOVARY433p.S439Rc.1317C>GMissense_Mutation10.11OV56N200N
ALKSRVLKVGSVOVARY124p.G129Vc.386G>TMissense_Mutation10.11OVTOKOY4110N
ALKTLSRVLKVGOVARY122p.G129Vc.386G>TMissense_Mutation10.11OVTOKON000N
ALKVGSVRKLRROVARY129p.G129Vc.386G>TMissense_Mutation10.11OVTOKON108N
ALKVLKVGSVRKOVARY126p.G129Vc.386G>TMissense_Mutation10.11OVTOKOY4174N
ALKAVEGGHVNTOVARY1470p.M1478Tc.4433T>CMissense_Mutation10.55TYKNUN100N
ALKEGGHVNTAFOVARY1472p.M1478Tc.4433T>CMissense_Mutation10.55TYKNUN600N
ALKGGHVNTAFSOVARY1473p.M1478Tc.4433T>CMissense_Mutation10.55TYKNUN100N
ALKGHVNTAFSQOVARY1474p.M1478Tc.4433T>CMissense_Mutation10.55TYKNUN000N
ALKHVNTAFSQSOVARY1475p.M1478Tc.4433T>CMissense_Mutation10.55TYKNUN000N
ALKNTAFSQSNPOVARY1477p.M1478Tc.4433T>CMissense_Mutation10.55TYKNUN000N
ALKTAFSQSNPPOVARY1478p.M1478Tc.4433T>CMissense_Mutation10.55TYKNUN000N
ALKVEGGHVNTAOVARY1471p.M1478Tc.4433T>CMissense_Mutation10.55TYKNUY694N
ALKVNTAFSQSNOVARY1476p.M1478Tc.4433T>CMissense_Mutation10.55TYKNUN000N
ALPK2APVLLKKSKOVARY1785p.K1791fsc.5373_5373delGFrame_Shift_Del20.11COV318N200N
ALPK2KKSKLRCSLOVARY1790p.K1791fsc.5373_5373delGFrame_Shift_Del40.11COV318N600N
ALPK2KLRCSLNTLOVARY1793p.K1791fsc.5373_5373delGFrame_Shift_Del50.11COV318Y14140N
ALPK2KSKLRCSLNOVARY1791p.K1791fsc.5373_5373delGFrame_Shift_Del50.11COV318N300N
ALPK2LKKSKLRCSOVARY1789p.K1791fsc.5373_5373delGFrame_Shift_Del50.11COV318N109N
ALPK2LLKKSKLRCOVARY1788p.K1791fsc.5373_5373delGFrame_Shift_Del50.11COV318N1024N
ALPK2LRCSLNTLEOVARY1794p.K1791fsc.5373_5373delGFrame_Shift_Del50.11COV318N104N
ALPK2PVLLKKSKLOVARY1786p.K1791fsc.5373_5373delGFrame_Shift_Del30.11COV318N100N
ALPK2RAPVLLKKSOVARY1784p.K1791fsc.5373_5373delGFrame_Shift_Del10.11COV318N200N
ALPK2RCSLNTLEMOVARY1795p.K1791fsc.5373_5373delGFrame_Shift_Del50.11COV318Y5100N
ALPK2SKLRCSLNTOVARY1792p.K1791fsc.5373_5373delGFrame_Shift_Del50.11COV318N100N
ALPK2VLLKKSKLROVARY1787p.K1791fsc.5373_5373delGFrame_Shift_Del40.11COV318N509N
ALPK2LLGTEHVFYOVARY348p.L356fsc.1067_1067delTFrame_Shift_Del10.33OC316N600N
ALPK2AADKRVGGROVARY515p.K523fsc.1568_1568delAFrame_Shift_Del10.55IGROV1N400N
ALPK2ADKRVGGRTOVARY516p.K523fsc.1568_1568delAFrame_Shift_Del20.55IGROV1N200N
ALPK2ARGVQGNLPOVARY527p.K523fsc.1568_1568delAFrame_Shift_Del50.55IGROV1N100N
ALPK2DKRVGGRTYOVARY517p.K523fsc.1568_1568delAFrame_Shift_Del30.55IGROV1N200N
ALPK2GARGVQGNLOVARY526p.K523fsc.1568_1568delAFrame_Shift_Del50.55IGROV1Y10130N
ALPK2GGRTYGARGOVARY521p.K523fsc.1568_1568delAFrame_Shift_Del50.55IGROV1N000N
ALPK2GRTYGARGVOVARY522p.K523fsc.1568_1568delAFrame_Shift_Del50.55IGROV1N300N
ALPK2KRVGGRTYGOVARY518p.K523fsc.1568_1568delAFrame_Shift_Del40.55IGROV1Y2110Y
ALPK2RGVQGNLPGOVARY528p.K523fsc.1568_1568delAFrame_Shift_Del50.55IGROV1N100N
ALPK2RTYGARGVQOVARY523p.K523fsc.1568_1568delAFrame_Shift_Del60.55IGROV1N000N
ALPK2RVGGRTYGAOVARY519p.K523fsc.1568_1568delAFrame_Shift_Del50.55IGROV1Y3120N
ALPK2TYGARGVQGOVARY524p.K523fsc.1568_1568delAFrame_Shift_Del60.55IGROV1N000N
ALPK2VGGRTYGAROVARY520p.K523fsc.1568_1568delAFrame_Shift_Del50.55IGROV1N100N
ALPK2YGARGVQGNOVARY525p.K523fsc.1568_1568delAFrame_Shift_Del50.55IGROV1N105N
ALPK2DKTLEVFFSOVARY857p.F864fsc.2592_2593insTFrame_Shift_Ins10.11EFO27N100N
ALPK2EVFFSDTSVOVARY861p.F864fsc.2592_2593insTFrame_Shift_Ins50.11EFO27N600Y
ALPK2KTLEVFFSDOVARY858p.F864fsc.2592_2593insTFrame_Shift_Ins20.11EFO27N100N
ALPK2LEVFFSDTSOVARY860p.F864fsc.2592_2593insTFrame_Shift_Ins40.11EFO27N402Y
ALPK2TLEVFFSDTOVARY859p.F864fsc.2592_2593insTFrame_Shift_Ins30.11EFO27N300N
ALPK2AGEESPIHWOVARY677p.P682fsc.2045_2046insCFrame_Shift_Ins30.66NIHOVCAR3N300N
ALPK2AGEESPIHWOVARY677p.P682fsc.2045_2046insCFrame_Shift_Ins30.66OAW28N300N
ALPK2AGEESPIHWOVARY677p.P682fsc.2045_2046insCFrame_Shift_Ins30.66ONCODG1N300N
ALPK2CIISSTLGGOVARY702p.P682fsc.2045_2046insCFrame_Shift_Ins40.66NIHOVCAR3N000N
ALPK2CIISSTLGGOVARY702p.P682fsc.2045_2046insCFrame_Shift_Ins40.66OAW28N000N
ALPK2CIISSTLGGOVARY702p.P682fsc.2045_2046insCFrame_Shift_Ins40.66ONCODG1N000N
ALPK2DHNNFLLKLOVARY686p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3Y6100Y
ALPK2DHNNFLLKLOVARY686p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28Y6100Y
ALPK2DHNNFLLKLOVARY686p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1Y6100Y
ALPK2EESPIHWDHOVARY679p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N000N
ALPK2EESPIHWDHOVARY679p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N000N
ALPK2EESPIHWDHOVARY679p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N000N
ALPK2EPAGEESPIOVARY675p.P682fsc.2045_2046insCFrame_Shift_Ins10.66NIHOVCAR3N1200N
ALPK2EPAGEESPIOVARY675p.P682fsc.2045_2046insCFrame_Shift_Ins10.66OAW28N1200N
ALPK2EPAGEESPIOVARY675p.P682fsc.2045_2046insCFrame_Shift_Ins10.66ONCODG1N1200N
ALPK2ESPIHWDHNOVARY680p.P682fsc.2045_2046insCFrame_Shift_Ins60.66NIHOVCAR3N100N
ALPK2ESPIHWDHNOVARY680p.P682fsc.2045_2046insCFrame_Shift_Ins60.66OAW28N100N
ALPK2ESPIHWDHNOVARY680p.P682fsc.2045_2046insCFrame_Shift_Ins60.66ONCODG1N100N
ALPK2FLLKLRRGPOVARY690p.P682fsc.2045_2046insCFrame_Shift_Ins60.66NIHOVCAR3N2018N
ALPK2FLLKLRRGPOVARY690p.P682fsc.2045_2046insCFrame_Shift_Ins60.66OAW28N2018N
ALPK2FLLKLRRGPOVARY690p.P682fsc.2045_2046insCFrame_Shift_Ins60.66ONCODG1N2018N
ALPK2GEESPIHWDOVARY678p.P682fsc.2045_2046insCFrame_Shift_Ins40.66NIHOVCAR3N000N
ALPK2GEESPIHWDOVARY678p.P682fsc.2045_2046insCFrame_Shift_Ins40.66OAW28N000N
ALPK2GEESPIHWDOVARY678p.P682fsc.2045_2046insCFrame_Shift_Ins40.66ONCODG1N000N
ALPK2GGQTLYLWSOVARY709p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N200N
ALPK2GGQTLYLWSOVARY709p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N200N
ALPK2GGQTLYLWSOVARY709p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N200N
ALPK2GKCIISSTLOVARY700p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N400Y
ALPK2GKCIISSTLOVARY700p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N400Y
ALPK2GKCIISSTLOVARY700p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N400Y
ALPK2GPQGKCIISOVARY697p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N300N
ALPK2GPQGKCIISOVARY697p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N300N
ALPK2GPQGKCIISOVARY697p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N300N
ALPK2GQTLYLWSTOVARY710p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N400N
ALPK2GQTLYLWSTOVARY710p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N400N
ALPK2GQTLYLWSTOVARY710p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N400N
ALPK2HNNFLLKLROVARY687p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N200Y
ALPK2HNNFLLKLROVARY687p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N200Y
ALPK2HNNFLLKLROVARY687p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N200Y
ALPK2HWDHNNFLLOVARY684p.P682fsc.2045_2046insCFrame_Shift_Ins60.66NIHOVCAR3Y8100N
ALPK2HWDHNNFLLOVARY684p.P682fsc.2045_2046insCFrame_Shift_Ins60.66OAW28Y8100N
ALPK2HWDHNNFLLOVARY684p.P682fsc.2045_2046insCFrame_Shift_Ins60.66ONCODG1Y8100N
ALPK2IHWDHNNFLOVARY683p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N1107N
ALPK2IHWDHNNFLOVARY683p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N1107N
ALPK2IHWDHNNFLOVARY683p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N1107N
ALPK2IISSTLGGQOVARY703p.P682fsc.2045_2046insCFrame_Shift_Ins40.66NIHOVCAR3N002N
ALPK2IISSTLGGQOVARY703p.P682fsc.2045_2046insCFrame_Shift_Ins40.66OAW28N002N
ALPK2IISSTLGGQOVARY703p.P682fsc.2045_2046insCFrame_Shift_Ins40.66ONCODG1N002N
ALPK2ISSTLGGQTOVARY704p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N100N
ALPK2ISSTLGGQTOVARY704p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N100N
ALPK2ISSTLGGQTOVARY704p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N100N
ALPK2KCIISSTLGOVARY701p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N000N
ALPK2KCIISSTLGOVARY701p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N000N
ALPK2KCIISSTLGOVARY701p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N000N
ALPK2KLRRGPQGKOVARY693p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3Y5150N
ALPK2KLRRGPQGKOVARY693p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28Y5150N
ALPK2KLRRGPQGKOVARY693p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1Y5150N
ALPK2LGGQTLYLWOVARY708p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N400N
ALPK2LGGQTLYLWOVARY708p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N400N
ALPK2LGGQTLYLWOVARY708p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N400N
ALPK2LKLRRGPQGOVARY692p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N003N
ALPK2LKLRRGPQGOVARY692p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N003N
ALPK2LKLRRGPQGOVARY692p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N003N
ALPK2LLKLRRGPQOVARY691p.P682fsc.2045_2046insCFrame_Shift_Ins60.66NIHOVCAR3N2011N
ALPK2LLKLRRGPQOVARY691p.P682fsc.2045_2046insCFrame_Shift_Ins60.66OAW28N2011N
ALPK2LLKLRRGPQOVARY691p.P682fsc.2045_2046insCFrame_Shift_Ins60.66ONCODG1N2011N
ALPK2LRRGPQGKCOVARY694p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N203N
ALPK2LRRGPQGKCOVARY694p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N203N
ALPK2LRRGPQGKCOVARY694p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N203N
ALPK2NFLLKLRRGOVARY689p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N000Y
ALPK2NFLLKLRRGOVARY689p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N000Y
ALPK2NFLLKLRRGOVARY689p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N000Y
ALPK2NNFLLKLRROVARY688p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N400Y
ALPK2NNFLLKLRROVARY688p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N400Y
ALPK2NNFLLKLRROVARY688p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N400Y
ALPK2PAGEESPIHOVARY676p.P682fsc.2045_2046insCFrame_Shift_Ins20.66NIHOVCAR3N000N
ALPK2PAGEESPIHOVARY676p.P682fsc.2045_2046insCFrame_Shift_Ins20.66OAW28N000N
ALPK2PAGEESPIHOVARY676p.P682fsc.2045_2046insCFrame_Shift_Ins20.66ONCODG1N000N
ALPK2PIHWDHNNFOVARY682p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N000N
ALPK2PIHWDHNNFOVARY682p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N000N
ALPK2PIHWDHNNFOVARY682p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N000N
ALPK2PQGKCIISSOVARY698p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N000Y
ALPK2PQGKCIISSOVARY698p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N000Y
ALPK2PQGKCIISSOVARY698p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N000Y
ALPK2QGKCIISSTOVARY699p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N000Y
ALPK2QGKCIISSTOVARY699p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N000Y
ALPK2QGKCIISSTOVARY699p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N000Y
ALPK2QTLYLWSTAOVARY711p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N100N
ALPK2QTLYLWSTAOVARY711p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N100N
ALPK2QTLYLWSTAOVARY711p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N100N
ALPK2RGPQGKCIIOVARY696p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N900N
ALPK2RGPQGKCIIOVARY696p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N900N
ALPK2RGPQGKCIIOVARY696p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N900N
ALPK2RRGPQGKCIOVARY695p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N400N
ALPK2RRGPQGKCIOVARY695p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N400N
ALPK2RRGPQGKCIOVARY695p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N400N
ALPK2SPIHWDHNNOVARY681p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N300N
ALPK2SPIHWDHNNOVARY681p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N300N
ALPK2SPIHWDHNNOVARY681p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N300N
ALPK2SSTLGGQTLOVARY705p.P682fsc.2045_2046insCFrame_Shift_Ins40.66NIHOVCAR3N700N
ALPK2SSTLGGQTLOVARY705p.P682fsc.2045_2046insCFrame_Shift_Ins40.66OAW28N700N
ALPK2SSTLGGQTLOVARY705p.P682fsc.2045_2046insCFrame_Shift_Ins40.66ONCODG1N700N
ALPK2STLGGQTLYOVARY706p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3N700N
ALPK2STLGGQTLYOVARY706p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28N700N
ALPK2STLGGQTLYOVARY706p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1N700N
ALPK2TLGGQTLYLOVARY707p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3Y11130N
ALPK2TLGGQTLYLOVARY707p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28Y11130N
ALPK2TLGGQTLYLOVARY707p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1Y11130N
ALPK2WDHNNFLLKOVARY685p.P682fsc.2045_2046insCFrame_Shift_Ins50.66NIHOVCAR3Y3160N
ALPK2WDHNNFLLKOVARY685p.P682fsc.2045_2046insCFrame_Shift_Ins50.66OAW28Y3160N
ALPK2WDHNNFLLKOVARY685p.P682fsc.2045_2046insCFrame_Shift_Ins50.66ONCODG1Y3160N
ALPK2AFKKFLTCPOVARY1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27COV434N000N
ALPK2AFKKFLTCPOVARY1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27OAW42N000N
ALPK2DHTAFKKFLOVARY1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27COV434N600N
ALPK2DHTAFKKFLOVARY1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27OAW42N600N
ALPK2HTAFKKFLTOVARY1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27COV434N100N
ALPK2HTAFKKFLTOVARY1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27OAW42N100N
ALPK2KMDHTAFKKOVARY1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27COV434N600N
ALPK2KMDHTAFKKOVARY1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27OAW42N600N
ALPK2LKMDHTAFKOVARY1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27COV434N1017N
ALPK2LKMDHTAFKOVARY1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27OAW42N1017N
ALPK2MDHTAFKKFOVARY1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27COV434N600N
ALPK2MDHTAFKKFOVARY1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27OAW42N600N
ALPK2TAFKKFLTCOVARY1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27COV434N600N
ALPK2TAFKKFLTCOVARY1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27OAW42N600N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74CAOV3Y1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74CAOV4Y1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74COV318Y1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74COV362Y1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74COV504Y1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74COV644Y1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74FUOV1Y1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HEYA8Y1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HS571TY1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74JHOC5Y1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74JHOS2Y1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74JHOS4Y1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74KURAMOCHIY1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74OV90Y1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74OVK18Y1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74RMGIY1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74RMUGSY1140N
ALPK2ATRETVTIAOVARY1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74TYKNUY1140N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74CAOV3Y2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74CAOV4Y2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74COV318Y2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74COV362Y2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74COV504Y2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74COV644Y2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74FUOV1Y2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HEYA8Y2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HS571TY2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74JHOC5Y2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74JHOS2Y2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74JHOS4Y2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KURAMOCHIY2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74OV90Y2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74OVK18Y2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74RMGIY2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74RMUGSY2110N
ALPK2CFQATRETVOVARY998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74TYKNUY2110N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74CAOV3N400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74CAOV4N400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74COV318N400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74COV362N400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74COV504N400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74COV644N400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74FUOV1N400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HEYA8N400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HS571TN400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74JHOC5N400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74JHOS2N400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74JHOS4N400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KURAMOCHIN400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74OV90N400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74OVK18N400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74RMGIN400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74RMUGSN400N
ALPK2ETVTIATEVOVARY1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74TYKNUN400N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74CAOV3N600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74CAOV4N600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74COV318N600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74COV362N600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74COV504N600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74COV644N600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74FUOV1N600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HEYA8N600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HS571TN600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74JHOC5N600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74JHOS2N600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74JHOS4N600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KURAMOCHIN600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74OV90N600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74OVK18N600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74RMGIN600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74RMUGSN600N
ALPK2FQATRETVTOVARY999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74TYKNUN600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74CAOV3N600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74CAOV4N600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74COV318N600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74COV362N600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74COV504N600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74COV644N600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74FUOV1N600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HEYA8N600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HS571TN600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74JHOC5N600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74JHOS2N600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74JHOS4N600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KURAMOCHIN600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74OV90N600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74OVK18N600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74RMGIN600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74RMUGSN600N
ALPK2QATRETVTIOVARY1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74TYKNUN600N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74CAOV3N100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74CAOV4N100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74COV318N100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74COV362N100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74COV504N100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74COV644N100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74FUOV1N100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HEYA8N100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HS571TN100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74JHOC5N100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74JHOS2N100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74JHOS4N100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KURAMOCHIN100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74OV90N100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74OVK18N100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74RMGIN100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74RMUGSN100N
ALPK2RETVTIATEOVARY1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74TYKNUN100N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74CAOV3N200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74CAOV4N200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74COV318N200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74COV362N200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74COV504N200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74COV644N200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74FUOV1N200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HEYA8N200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HS571TN200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74JHOC5N200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74JHOS2N200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74JHOS4N200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KURAMOCHIN200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74OV90N200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74OVK18N200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74RMGIN200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74RMUGSN200N
ALPK2TRETVTIATOVARY1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74TYKNUN200N
ALPK2ATDTTATPAOVARY968p.A969Tc.2905G>AMissense_Mutation10.11EFO27N200N
ALPK2DKSPSPSATOVARY961p.A969Tc.2905G>AMissense_Mutation10.11EFO27N100N
ALPK2KSPSPSATDOVARY962p.A969Tc.2905G>AMissense_Mutation10.11EFO27N000N
ALPK2PSATDTTATOVARY966p.A969Tc.2905G>AMissense_Mutation10.11EFO27N000N
ALPK2PSPSATDTTOVARY964p.A969Tc.2905G>AMissense_Mutation10.11EFO27N000N
ALPK2SATDTTATPOVARY967p.A969Tc.2905G>AMissense_Mutation10.11EFO27N000N
ALPK2SPSATDTTAOVARY965p.A969Tc.2905G>AMissense_Mutation10.11EFO27N800N
ALPK2SPSPSATDTOVARY963p.A969Tc.2905G>AMissense_Mutation10.11EFO27N400N
ALPK2TDTTATPASOVARY969p.A969Tc.2905G>AMissense_Mutation10.11EFO27N100N
ATMAVNFQIRVCOVARY244p.R248Qc.743G>AMissense_Mutation10.11IGROV1Y0100N
ATMDFSFQEPMMOVARY2216p.I2223Mc.6669C>GMissense_Mutation10.11KURAMOCHIN200N
ATMDGITVKLVVOVARY1641p.M1644Tc.4931T>CMissense_Mutation10.11KURAMOCHIN600N
ATMDHRGEYGNLOVARY2672p.T2674Rc.8021C>GMissense_Mutation10.11JHOS4N400N
ATMDNPQDGITVOVARY1637p.M1644Tc.4931T>CMissense_Mutation10.11KURAMOCHIN100N
ATMEIKVDHRGEOVARY2668p.T2674Rc.8021C>GMissense_Mutation10.11JHOS4N000N
ATMEKILLSLTMOVARY609p.V613Lc.1837G>TMissense_Mutation10.11OVCAR8N400N
ATMEKSSSGLTHOVARY223p.N230Tc.689A>CMissense_Mutation10.11OVCAR4N100N
ATMEPMMALRTVOVARY2221p.I2223Mc.6669C>GMissense_Mutation10.11KURAMOCHIN1400N
ATMFQEPMMALROVARY2219p.I2223Mc.6669C>GMissense_Mutation10.11KURAMOCHIN800N
ATMFQIRVCELGOVARY247p.R248Qc.743G>AMissense_Mutation10.11IGROV1N206N
ATMFSFQEPMMAOVARY2217p.I2223Mc.6669C>GMissense_Mutation10.11KURAMOCHIN608N
ATMGITVKLVVNOVARY1642p.M1644Tc.4931T>CMissense_Mutation10.11KURAMOCHIN000N
ATMGLTHILAALOVARY228p.N230Tc.689A>CMissense_Mutation10.11OVCAR4Y12120N
ATMHLVLEKILLOVARY605p.V613Lc.1837G>TMissense_Mutation10.11OVCAR8N1100N
ATMHRGEYGNLVOVARY2673p.T2674Rc.8021C>GMissense_Mutation10.11JHOS4N400N
ATMIKVDHRGEYOVARY2669p.T2674Rc.8021C>GMissense_Mutation10.11JHOS4N408N
ATMILLSLTMKNOVARY611p.V613Lc.1837G>TMissense_Mutation10.11OVCAR8N1022N
ATMITVKLVVNLOVARY1643p.M1644Tc.4931T>CMissense_Mutation10.11KURAMOCHIY17124N
ATMKILLSLTMKOVARY610p.V613Lc.1837G>TMissense_Mutation10.11OVCAR8N500N
ATMKSSSGLTHIOVARY224p.N230Tc.689A>CMissense_Mutation10.11OVCAR4Y6110N
ATMKTLAVNFQIOVARY241p.R248Qc.743G>AMissense_Mutation10.11IGROV1Y11120N
ATMKVDHRGEYGOVARY2670p.T2674Rc.8021C>GMissense_Mutation10.11JHOS4N000N
ATMLAVNFQIRVOVARY243p.R248Qc.743G>AMissense_Mutation10.11IGROV1N1000N
ATMLEKILLSLTOVARY608p.V613Lc.1837G>TMissense_Mutation10.11OVCAR8N600N
ATMLKTLAVNFQOVARY240p.R248Qc.743G>AMissense_Mutation10.11IGROV1N0034N
ATMLLSLTMKNCOVARY612p.V613Lc.1837G>TMissense_Mutation10.11OVCAR8N300N
ATMLSLTMKNCKOVARY613p.V613Lc.1837G>TMissense_Mutation10.11OVCAR8N100N
ATMLTHILAALTOVARY229p.N230Tc.689A>CMissense_Mutation10.11OVCAR4N100N
ATMLVLEKILLSOVARY606p.V613Lc.1837G>TMissense_Mutation10.11OVCAR8N0044N
ATMMEIKVDHRGOVARY2667p.T2674Rc.8021C>GMissense_Mutation10.11JHOS4N200N
ATMMMALRTVILOVARY2223p.I2223Mc.6669C>GMissense_Mutation10.11KURAMOCHIY151012N
ATMNFQIRVCELOVARY246p.R248Qc.743G>AMissense_Mutation10.11IGROV1Y790N
ATMNPQDGITVKOVARY1638p.M1644Tc.4931T>CMissense_Mutation10.11KURAMOCHIY1120N
ATMPMMALRTVIOVARY2222p.I2223Mc.6669C>GMissense_Mutation10.11KURAMOCHIN200N
ATMPQDGITVKLOVARY1639p.M1644Tc.4931T>CMissense_Mutation10.11KURAMOCHIN100N
ATMQDGITVKLVOVARY1640p.M1644Tc.4931T>CMissense_Mutation10.11KURAMOCHIN400N
ATMQDNPQDGITOVARY1636p.M1644Tc.4931T>CMissense_Mutation10.11KURAMOCHIN100N
ATMQEKSSSGLTOVARY222p.N230Tc.689A>CMissense_Mutation10.11OVCAR4N600N
ATMQEPMMALRTOVARY2220p.I2223Mc.6669C>GMissense_Mutation10.11KURAMOCHIN500N
ATMQIRVCELGDOVARY248p.R248Qc.743G>AMissense_Mutation10.11IGROV1N000N
ATMRGEYGNLVTOVARY2674p.T2674Rc.8021C>GMissense_Mutation10.11JHOS4N200N
ATMSDFSFQEPMOVARY2215p.I2223Mc.6669C>GMissense_Mutation10.11KURAMOCHIN800N
ATMSFQEPMMALOVARY2218p.I2223Mc.6669C>GMissense_Mutation10.11KURAMOCHIY890N
ATMSGLTHILAAOVARY227p.N230Tc.689A>CMissense_Mutation10.11OVCAR4N300N
ATMSSGLTHILAOVARY226p.N230Tc.689A>CMissense_Mutation10.11OVCAR4N100N
ATMSSSGLTHILOVARY225p.N230Tc.689A>CMissense_Mutation10.11OVCAR4Y1090N
ATMTHILAALTIOVARY230p.N230Tc.689A>CMissense_Mutation10.11OVCAR4N500N
ATMTLAVNFQIROVARY242p.R248Qc.743G>AMissense_Mutation10.11IGROV1Y5100N
ATMTMEIKVDHROVARY2666p.T2674Rc.8021C>GMissense_Mutation10.11JHOS4N700N
ATMTVKLVVNLLOVARY1644p.M1644Tc.4931T>CMissense_Mutation10.11KURAMOCHIY8110N
ATMVDHRGEYGNOVARY2671p.T2674Rc.8021C>GMissense_Mutation10.11JHOS4N200Y
ATMVLEKILLSLOVARY607p.V613Lc.1837G>TMissense_Mutation10.11OVCAR8Y14111N
ATMVNFQIRVCEOVARY245p.R248Qc.743G>AMissense_Mutation10.11IGROV1N004N
ATMDSSRLEPTKOVARY932p.T935Rc.2804C>GMissense_Mutation10.44OVKATEN200N
ATMIDSSRLEPTOVARY931p.T935Rc.2804C>GMissense_Mutation10.44OVKATEN100N
ATMLIDSSRLEPOVARY930p.T935Rc.2804C>GMissense_Mutation10.44OVKATEN000N
ATMLLMLIDSSROVARY927p.T935Rc.2804C>GMissense_Mutation10.44OVKATEN604N
ATMLMLIDSSRLOVARY928p.T935Rc.2804C>GMissense_Mutation10.44OVKATEN15016N
ATMMLIDSSRLEOVARY929p.T935Rc.2804C>GMissense_Mutation10.44OVKATEN006N
ATMRLEPTKSLHOVARY935p.T935Rc.2804C>GMissense_Mutation10.44OVKATEN100N
ATMSRLEPTKSLOVARY934p.T935Rc.2804C>GMissense_Mutation10.44OVKATEN700N
ATMSSRLEPTKSOVARY933p.T935Rc.2804C>GMissense_Mutation10.44OVKATEN100N
BRAFDFSLYVCASOVARY742p.A747Vc.2240C>TMissense_Mutation10.11OC316N000N
BRAFEDFSLYVCAOVARY741p.A747Vc.2240C>TMissense_Mutation10.11OC316N800N
BRAFEELHVEMLEOVARY220p.V226Mc.676G>AMissense_Mutation10.11A2780N100N
BRAFELHVEMLENOVARY221p.V226Mc.676G>AMissense_Mutation10.11A2780N000N
BRAFEMLENVPLTOVARY225p.V226Mc.676G>AMissense_Mutation10.11A2780N500N
BRAFESGSFGTVYOVARY464p.G464Ec.1391G>AMissense_Mutation10.11HEYA8N700N
BRAFFSLYVCASPOVARY743p.A747Vc.2240C>TMissense_Mutation10.11OC316N202N
BRAFGEELHVEMLOVARY219p.V226Mc.676G>AMissense_Mutation10.11A2780Y7120N
BRAFGQRIESGSFOVARY460p.G464Ec.1391G>AMissense_Mutation10.11HEYA8N400N
BRAFHVEMLENVPOVARY223p.V226Mc.676G>AMissense_Mutation10.11A2780N000N
BRAFIESGSFGTVOVARY463p.G464Ec.1391G>AMissense_Mutation10.11HEYA8Y7100N
BRAFITVGQRIESOVARY457p.G464Ec.1391G>AMissense_Mutation10.11HEYA8N008N
BRAFLHVEMLENVOVARY222p.V226Mc.676G>AMissense_Mutation10.11A2780N400N
BRAFLYVCASPKTOVARY745p.A747Vc.2240C>TMissense_Mutation10.11OC316N300N
BRAFMLENVPLTTOVARY226p.V226Mc.676G>AMissense_Mutation10.11A2780N100N
BRAFQITVGQRIEOVARY456p.G464Ec.1391G>AMissense_Mutation10.11HEYA8N000N
BRAFQRIESGSFGOVARY461p.G464Ec.1391G>AMissense_Mutation10.11HEYA8N100N
BRAFQTEDFSLYVOVARY739p.A747Vc.2240C>TMissense_Mutation10.11OC316Y4140N
BRAFRIESGSFGTOVARY462p.G464Ec.1391G>AMissense_Mutation10.11HEYA8N100N
BRAFSLYVCASPKOVARY744p.A747Vc.2240C>TMissense_Mutation10.11OC316N500N
BRAFTEDFSLYVCOVARY740p.A747Vc.2240C>TMissense_Mutation10.11OC316N500N
BRAFTGEELHVEMOVARY218p.V226Mc.676G>AMissense_Mutation10.11A2780N300N
BRAFTVGQRIESGOVARY458p.G464Ec.1391G>AMissense_Mutation10.11HEYA8N000N
BRAFVCASPKTPIOVARY747p.A747Vc.2240C>TMissense_Mutation10.11OC316N500N
BRAFVEMLENVPLOVARY224p.V226Mc.676G>AMissense_Mutation10.11A2780N12014N
BRAFVGQRIESGSOVARY459p.G464Ec.1391G>AMissense_Mutation10.11HEYA8N100N
BRAFYVCASPKTPOVARY746p.A747Vc.2240C>TMissense_Mutation10.11OC316N108N
BRAFATEKSRWSGOVARY598p.V600Ec.1799T>AMissense_Mutation16.08ES2N000N
BRAFATEKSRWSGOVARY598p.V600Ec.1799T>AMissense_Mutation16.08JHOM2BN000N
BRAFDFGLATEKSOVARY594p.V600Ec.1799T>AMissense_Mutation16.08ES2N000N
BRAFDFGLATEKSOVARY594p.V600Ec.1799T>AMissense_Mutation16.08JHOM2BN000N
BRAFEKSRWSGSHOVARY600p.V600Ec.1799T>AMissense_Mutation16.08ES2N100N
BRAFEKSRWSGSHOVARY600p.V600Ec.1799T>AMissense_Mutation16.08JHOM2BN100N
BRAFFGLATEKSROVARY595p.V600Ec.1799T>AMissense_Mutation16.08ES2N302N
BRAFFGLATEKSROVARY595p.V600Ec.1799T>AMissense_Mutation16.08JHOM2BN302N
BRAFGDFGLATEKOVARY593p.V600Ec.1799T>AMissense_Mutation16.08ES2N100N
BRAFGDFGLATEKOVARY593p.V600Ec.1799T>AMissense_Mutation16.08JHOM2BN100N
BRAFGLATEKSRWOVARY596p.V600Ec.1799T>AMissense_Mutation16.08ES2N400N
BRAFGLATEKSRWOVARY596p.V600Ec.1799T>AMissense_Mutation16.08JHOM2BN400N
BRAFIGDFGLATEOVARY592p.V600Ec.1799T>AMissense_Mutation16.08ES2N000N
BRAFIGDFGLATEOVARY592p.V600Ec.1799T>AMissense_Mutation16.08JHOM2BN000N
BRAFLATEKSRWSOVARY597p.V600Ec.1799T>AMissense_Mutation16.08ES2N200N
BRAFLATEKSRWSOVARY597p.V600Ec.1799T>AMissense_Mutation16.08JHOM2BN200N
BRAFTEKSRWSGSOVARY599p.V600Ec.1799T>AMissense_Mutation16.08ES2N300N
BRAFTEKSRWSGSOVARY599p.V600Ec.1799T>AMissense_Mutation16.08JHOM2BN300N
CBLAEPIVVDPFOVARY426p.T426Ac.1276A>GMissense_Mutation10.11IGROV1N800N
CBLCEIKGAEPIOVARY421p.T426Ac.1276A>GMissense_Mutation10.11IGROV1N700N
CBLCRCEIKGAEOVARY419p.T426Ac.1276A>GMissense_Mutation10.11IGROV1N100N
CBLEIKGAEPIVOVARY422p.T426Ac.1276A>GMissense_Mutation10.11IGROV1N300N
CBLFCRCEIKGAOVARY418p.T426Ac.1276A>GMissense_Mutation10.11IGROV1N404N
CBLGAEPIVVDPOVARY425p.T426Ac.1276A>GMissense_Mutation10.11IGROV1N100N
CBLIKGAEPIVVOVARY423p.T426Ac.1276A>GMissense_Mutation10.11IGROV1N304N
CBLKGAEPIVVDOVARY424p.T426Ac.1276A>GMissense_Mutation10.11IGROV1N000N
CBLRCEIKGAEPOVARY420p.T426Ac.1276A>GMissense_Mutation10.11IGROV1N000N
CHD1AKQLLMLAIOVARY234p.K210fsc.629_629delAFrame_Shift_Del40.22IGROV1N100N
CHD1DRLIHLRRMOVARY211p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1Y590N
CHD1EVLVAKQLLOVARY230p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N1100N
CHD1GKKILGQKROVARY202p.K210fsc.629_629delAFrame_Shift_Del10.22IGROV1N100N
CHD1GQKRDRLIHOVARY207p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N100Y
CHD1HLRRMMMKKOVARY215p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1Y5150N
CHD1IHLRRMMMKOVARY214p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1Y0114N
CHD1IKEVLVAKQOVARY228p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N009N
CHD1ILGQKRDRLOVARY205p.K210fsc.629_629delAFrame_Shift_Del40.22IGROV1N1200Y
CHD1IMIKEVLVAOVARY226p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N6039N
CHD1IMIMIKEVLOVARY224p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N18036N
CHD1KEVLVAKQLOVARY229p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N1000N
CHD1KILGQKRDROVARY204p.K210fsc.629_629delAFrame_Shift_Del30.22IGROV1N400Y
CHD1KIMIMIKEVOVARY223p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N400N
CHD1KKILGQKRDOVARY203p.K210fsc.629_629delAFrame_Shift_Del20.22IGROV1N000Y
CHD1KKIMIMIKEOVARY222p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N000N
CHD1KQLLMLAIROVARY235p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N700N
CHD1KRDRLIHLROVARY209p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1Y390Y
CHD1LGQKRDRLIOVARY206p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N800Y
CHD1LIHLRRMMMOVARY213p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1Y5936N
CHD1LLMLAIRRMOVARY237p.K210fsc.629_629delAFrame_Shift_Del40.22IGROV1Y4934N
CHD1LMLAIRRMKOVARY238p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N3020N
CHD1LRRMMMKKIOVARY216p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N3033N
CHD1LVAKQLLMLOVARY232p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N10028N
CHD1MIKEVLVAKOVARY227p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1Y3140N
CHD1MIMIKEVLVOVARY225p.K210fsc.629_629delAFrame_Shift_Del60.22IGROV1N502N
CHD1MKKIMIMIKOVARY221p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N1019N
CHD1MLAIRRMKKOVARY239p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1Y61419N
CHD1MMKKIMIMIOVARY220p.K210fsc.629_629delAFrame_Shift_Del60.22IGROV1N1000N
CHD1MMMKKIMIMOVARY219p.K210fsc.629_629delAFrame_Shift_Del60.22IGROV1N9036N
CHD1QKRDRLIHLOVARY208p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1Y6110N
CHD1QLLMLAIRROVARY236p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N600N
CHD1RDRLIHLRROVARY210p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N100N
CHD1RLIHLRRMMOVARY212p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1Y5100N
CHD1RMMMKKIMIOVARY218p.K210fsc.629_629delAFrame_Shift_Del60.22IGROV1N1300N
CHD1RRMMMKKIMOVARY217p.K210fsc.629_629delAFrame_Shift_Del60.22IGROV1N400N
CHD1VAKQLLMLAOVARY233p.K210fsc.629_629delAFrame_Shift_Del40.22IGROV1N600N
CHD1VLVAKQLLMOVARY231p.K210fsc.629_629delAFrame_Shift_Del50.22IGROV1N8010N
CHD1DQRSYGSRSOVARY1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86COV434N100N
CHD1DQRSYGSRSOVARY1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HEYA8N100N
CHD1DQRSYGSRSOVARY1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HS571TN100N
CHD1DQRSYGSRSOVARY1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86OAW42N100N
CHD1DQRSYGSRSOVARY1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86OV56N100N
CHD1DQRSYGSRSOVARY1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86OVCAR8N100N
CHD1DQRSYGSRSOVARY1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SKOV3N100N
CHD1LDQRSYGSROVARY1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86COV434N000N
CHD1LDQRSYGSROVARY1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HEYA8N000N
CHD1LDQRSYGSROVARY1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HS571TN000N
CHD1LDQRSYGSROVARY1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86OAW42N000N
CHD1LDQRSYGSROVARY1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86OV56N000N
CHD1LDQRSYGSROVARY1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86OVCAR8N000N
CHD1LDQRSYGSROVARY1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SKOV3N000N
CHD1PLDQRSYGSOVARY1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86COV434N000N
CHD1PLDQRSYGSOVARY1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HEYA8N000N
CHD1PLDQRSYGSOVARY1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HS571TN000N
CHD1PLDQRSYGSOVARY1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86OAW42N000N
CHD1PLDQRSYGSOVARY1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86OV56N000N
CHD1PLDQRSYGSOVARY1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86OVCAR8N000N
CHD1PLDQRSYGSOVARY1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SKOV3N000N
CHD1QRSYGSRSPOVARY1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86COV434N000N
CHD1QRSYGSRSPOVARY1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HEYA8N000N
CHD1QRSYGSRSPOVARY1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HS571TN000N
CHD1QRSYGSRSPOVARY1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86OAW42N000N
CHD1QRSYGSRSPOVARY1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86OV56N000N
CHD1QRSYGSRSPOVARY1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86OVCAR8N000N
CHD1QRSYGSRSPOVARY1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SKOV3N000N
CHD1RSPLDQRSYOVARY1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86COV434N600N
CHD1RSPLDQRSYOVARY1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HEYA8N600N
CHD1RSPLDQRSYOVARY1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HS571TN600N
CHD1RSPLDQRSYOVARY1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86OAW42N600N
CHD1RSPLDQRSYOVARY1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86OV56N600N
CHD1RSPLDQRSYOVARY1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86OVCAR8N600N
CHD1RSPLDQRSYOVARY1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SKOV3N600N
CHD1RSYGSRSPFOVARY1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86COV434N900N
CHD1RSYGSRSPFOVARY1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HEYA8N900N
CHD1RSYGSRSPFOVARY1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HS571TN900N
CHD1RSYGSRSPFOVARY1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86OAW42N900N
CHD1RSYGSRSPFOVARY1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86OV56N900N
CHD1RSYGSRSPFOVARY1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86OVCAR8N900N
CHD1RSYGSRSPFOVARY1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SKOV3N900N
CHD1SPLDQRSYGOVARY1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86COV434N000N
CHD1SPLDQRSYGOVARY1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HEYA8N000N
CHD1SPLDQRSYGOVARY1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HS571TN000N
CHD1SPLDQRSYGOVARY1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86OAW42N000N
CHD1SPLDQRSYGOVARY1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86OV56N000N
CHD1SPLDQRSYGOVARY1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86OVCAR8N000N
CHD1SPLDQRSYGOVARY1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SKOV3N000N
CHD1SYGSRSPFEOVARY1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86COV434N000N
CHD1SYGSRSPFEOVARY1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HEYA8N000N
CHD1SYGSRSPFEOVARY1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HS571TN000N
CHD1SYGSRSPFEOVARY1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86OAW42N000N
CHD1SYGSRSPFEOVARY1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86OV56N000N
CHD1SYGSRSPFEOVARY1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86OVCAR8N000N
CHD1SYGSRSPFEOVARY1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SKOV3N000N
CHD1AEHKSTPEHOVARY1695p.V1695Ac.5084T>CMissense_Mutation10.11EFO27N000N
CHD1DSSPVPSEKOVARY1354p.L1358Vc.4072C>GMissense_Mutation10.11OVTOKON300N
CHD1EEIIPENQROVARY1044p.D1050Nc.3148G>AMissense_Mutation10.11RMUGSN300N
CHD1EHSAEHKSTOVARY1692p.V1695Ac.5084T>CMissense_Mutation10.11EFO27N100N
CHD1EIIPENQRROVARY1045p.D1050Nc.3148G>AMissense_Mutation10.11RMUGSN400N
CHD1EIKSDSSPVOVARY1350p.L1358Vc.4072C>GMissense_Mutation10.11OVTOKON200N
CHD1ENQRRRLEEOVARY1049p.D1050Nc.3148G>AMissense_Mutation10.11RMUGSN000N
CHD1FEHSAEHKSOVARY1691p.V1695Ac.5084T>CMissense_Mutation10.11EFO27N500N
CHD1HSAEHKSTPOVARY1693p.V1695Ac.5084T>CMissense_Mutation10.11EFO27N000N
CHD1IIPENQRRROVARY1046p.D1050Nc.3148G>AMissense_Mutation10.11RMUGSY390N
CHD1IKSDSSPVPOVARY1351p.L1358Vc.4072C>GMissense_Mutation10.11OVTOKON004N
CHD1IPENQRRRLOVARY1047p.D1050Nc.3148G>AMissense_Mutation10.11RMUGSY14110N
CHD1KSDSSPVPSOVARY1352p.L1358Vc.4072C>GMissense_Mutation10.11OVTOKON200N
CHD1NQRRRLEEEOVARY1050p.D1050Nc.3148G>AMissense_Mutation10.11RMUGSN000N
CHD1NWEEIIPENOVARY1042p.D1050Nc.3148G>AMissense_Mutation10.11RMUGSN000N
CHD1PENQRRRLEOVARY1048p.D1050Nc.3148G>AMissense_Mutation10.11RMUGSN000N
CHD1PFEHSAEHKOVARY1690p.V1695Ac.5084T>CMissense_Mutation10.11EFO27N000N
CHD1PVPSEKSDEOVARY1357p.L1358Vc.4072C>GMissense_Mutation10.11OVTOKON000N
CHD1RSPFEHSAEOVARY1688p.V1695Ac.5084T>CMissense_Mutation10.11EFO27N000N
CHD1SAEHKSTPEOVARY1694p.V1695Ac.5084T>CMissense_Mutation10.11EFO27N000N
CHD1SDSSPVPSEOVARY1353p.L1358Vc.4072C>GMissense_Mutation10.11OVTOKON000N
CHD1SPFEHSAEHOVARY1689p.V1695Ac.5084T>CMissense_Mutation10.11EFO27N100N
CHD1SPVPSEKSDOVARY1356p.L1358Vc.4072C>GMissense_Mutation10.11OVTOKON000N
CHD1SRSPFEHSAOVARY1687p.V1695Ac.5084T>CMissense_Mutation10.11EFO27Y290N
CHD1SSPVPSEKSOVARY1355p.L1358Vc.4072C>GMissense_Mutation10.11OVTOKON100N
CHD1VPSEKSDEDOVARY1358p.L1358Vc.4072C>GMissense_Mutation10.11OVTOKON100N
CHD1WEEIIPENQOVARY1043p.D1050Nc.3148G>AMissense_Mutation10.11RMUGSN100N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47COLO704N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47COV318N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47COV434N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47EFO21N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47EFO27N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47FUOV1N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47JHOM1N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47JHOS2N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47MCASN801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47NIHOVCAR3N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47OAW28N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47OAW42N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47OC316N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47OV90N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47OVCAR4N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47OVCAR8N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47OVKATEN801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47OVSAHON801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47SKOV3N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47SNU8N801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47TOV21GN801N
CREB3L2FTHITSDSFOVARY95p.T100delc.299_301delCCAIn_Frame_Del444.47TYKNUN801N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47COLO704N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47COV318N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47COV434N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47EFO21N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47EFO27N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47FUOV1N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47JHOM1N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47JHOS2N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47MCASN000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47NIHOVCAR3N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47OAW28N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47OAW42N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47OC316N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47OV90N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47OVCAR4N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47OVCAR8N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47OVKATEN000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47OVSAHON000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47SKOV3N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47SNU8N000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47TOV21GN000N
CREB3L2HITSDSFNDOVARY97p.T100delc.299_301delCCAIn_Frame_Del244.47TYKNUN000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47COLO704N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47COV318N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47COV434N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47EFO21N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47EFO27N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47FUOV1N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47JHOM1N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47JHOS2N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47MCASN000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47NIHOVCAR3N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47OAW28N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47OAW42N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47OC316N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47OV90N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47OVCAR4N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47OVCAR8N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47OVKATEN000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47OVSAHON000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47SKOV3N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47SNU8N000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47TOV21GN000N
CREB3L2ITSDSFNDDOVARY98p.T100delc.299_301delCCAIn_Frame_Del144.47TYKNUN000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47COLO704N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47COV318N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47COV434N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47EFO21N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47EFO27N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47FUOV1N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47JHOM1N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47JHOS2N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47MCASN000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47NIHOVCAR3N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47OAW28N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47OAW42N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47OC316N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47OV90N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47OVCAR4N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47OVCAR8N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47OVKATEN000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47OVSAHON000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47SKOV3N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47SNU8N000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47TOV21GN000N
CREB3L2PFTHITSDSOVARY94p.T100delc.299_301delCCAIn_Frame_Del344.47TYKNUN000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47COLO704N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47COV318N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47COV434N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47EFO21N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47EFO27N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47FUOV1N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47JHOM1N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47JHOS2N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47MCASN000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47NIHOVCAR3N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47OAW28N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47OAW42N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47OC316N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47OV90N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47OVCAR4N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47OVCAR8N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47OVKATEN000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47OVSAHON000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47SKOV3N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47SNU8N000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47TOV21GN000N
CREB3L2QSPFTHITSOVARY92p.T100delc.299_301delCCAIn_Frame_Del144.47TYKNUN000N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47COLO704N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47COV318N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47COV434N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47EFO21N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47EFO27N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47FUOV1N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47JHOM1N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47JHOS2N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47MCASN100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47NIHOVCAR3N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47OAW28N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47OAW42N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47OC316N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47OV90N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47OVCAR4N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47OVCAR8N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47OVKATEN100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47OVSAHON100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47SKOV3N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47SNU8N100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47TOV21GN100N
CREB3L2SPFTHITSDOVARY93p.T100delc.299_301delCCAIn_Frame_Del244.47TYKNUN100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47COLO704N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47COV318N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47COV434N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47EFO21N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47EFO27N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47FUOV1N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47JHOM1N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47JHOS2N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47MCASN100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47NIHOVCAR3N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47OAW28N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47OAW42N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47OC316N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47OV90N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47OVCAR4N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47OVCAR8N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47OVKATEN100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47OVSAHON100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47SKOV3N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47SNU8N100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47TOV21GN100N
CREB3L2THITSDSFNOVARY96p.T100delc.299_301delCCAIn_Frame_Del344.47TYKNUN100N
CTBP2APSPNQPTNOVARY966p.K974fsc.2922_2922delAFrame_Shift_Del124.34CAOV4N300N
CTBP2APSPNQPTNOVARY966p.K974fsc.2922_2922delAFrame_Shift_Del124.34JHOC5N300N
CTBP2APSPNQPTNOVARY966p.K974fsc.2922_2922delAFrame_Shift_Del124.34JHOM2BN300N
CTBP2APSPNQPTNOVARY966p.K974fsc.2922_2922delAFrame_Shift_Del124.34KURAMOCHIN300N
CTBP2APSPNQPTNOVARY966p.K974fsc.2922_2922delAFrame_Shift_Del124.34OAW42N300N
CTBP2APSPNQPTNOVARY966p.K974fsc.2922_2922delAFrame_Shift_Del124.34OC316N300N
CTBP2APSPNQPTNOVARY966p.K974fsc.2922_2922delAFrame_Shift_Del124.34OVK18N300N
CTBP2APSPNQPTNOVARY966p.K974fsc.2922_2922delAFrame_Shift_Del124.34OVKATEN300N
CTBP2APSPNQPTNOVARY966p.K974fsc.2922_2922delAFrame_Shift_Del124.34OVTOKON300N
CTBP2APSPNQPTNOVARY966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SNU840N300N
CTBP2APSPNQPTNOVARY966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SNU8N300N
CTBP2GTIESTPTSOVARY976p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAOV4N100N
CTBP2GTIESTPTSOVARY976p.K974fsc.2922_2922delAFrame_Shift_Del524.34JHOC5N100N
CTBP2GTIESTPTSOVARY976p.K974fsc.2922_2922delAFrame_Shift_Del524.34JHOM2BN100N
CTBP2GTIESTPTSOVARY976p.K974fsc.2922_2922delAFrame_Shift_Del524.34KURAMOCHIN100N
CTBP2GTIESTPTSOVARY976p.K974fsc.2922_2922delAFrame_Shift_Del524.34OAW42N100N
CTBP2GTIESTPTSOVARY976p.K974fsc.2922_2922delAFrame_Shift_Del524.34OC316N100N
CTBP2GTIESTPTSOVARY976p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVK18N100N
CTBP2GTIESTPTSOVARY976p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVKATEN100N
CTBP2GTIESTPTSOVARY976p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVTOKON100N
CTBP2GTIESTPTSOVARY976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU840N100N
CTBP2GTIESTPTSOVARY976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU8N100N
CTBP2NQPTNTGTIOVARY970p.K974fsc.2922_2922delAFrame_Shift_Del424.34CAOV4N1000N
CTBP2NQPTNTGTIOVARY970p.K974fsc.2922_2922delAFrame_Shift_Del424.34JHOC5N1000N
CTBP2NQPTNTGTIOVARY970p.K974fsc.2922_2922delAFrame_Shift_Del424.34JHOM2BN1000N
CTBP2NQPTNTGTIOVARY970p.K974fsc.2922_2922delAFrame_Shift_Del424.34KURAMOCHIN1000N
CTBP2NQPTNTGTIOVARY970p.K974fsc.2922_2922delAFrame_Shift_Del424.34OAW42N1000N
CTBP2NQPTNTGTIOVARY970p.K974fsc.2922_2922delAFrame_Shift_Del424.34OC316N1000N
CTBP2NQPTNTGTIOVARY970p.K974fsc.2922_2922delAFrame_Shift_Del424.34OVK18N1000N
CTBP2NQPTNTGTIOVARY970p.K974fsc.2922_2922delAFrame_Shift_Del424.34OVKATEN1000N
CTBP2NQPTNTGTIOVARY970p.K974fsc.2922_2922delAFrame_Shift_Del424.34OVTOKON1000N
CTBP2NQPTNTGTIOVARY970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SNU840N1000N
CTBP2NQPTNTGTIOVARY970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SNU8N1000N
CTBP2NTGTIESTPOVARY974p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAOV4N000N
CTBP2NTGTIESTPOVARY974p.K974fsc.2922_2922delAFrame_Shift_Del524.34JHOC5N000N
CTBP2NTGTIESTPOVARY974p.K974fsc.2922_2922delAFrame_Shift_Del524.34JHOM2BN000N
CTBP2NTGTIESTPOVARY974p.K974fsc.2922_2922delAFrame_Shift_Del524.34KURAMOCHIN000N
CTBP2NTGTIESTPOVARY974p.K974fsc.2922_2922delAFrame_Shift_Del524.34OAW42N000N
CTBP2NTGTIESTPOVARY974p.K974fsc.2922_2922delAFrame_Shift_Del524.34OC316N000N
CTBP2NTGTIESTPOVARY974p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVK18N000N
CTBP2NTGTIESTPOVARY974p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVKATEN000N
CTBP2NTGTIESTPOVARY974p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVTOKON000N
CTBP2NTGTIESTPOVARY974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU840N000N
CTBP2NTGTIESTPOVARY974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU8N000N
CTBP2PNQPTNTGTOVARY969p.K974fsc.2922_2922delAFrame_Shift_Del324.34CAOV4N000N
CTBP2PNQPTNTGTOVARY969p.K974fsc.2922_2922delAFrame_Shift_Del324.34JHOC5N000N
CTBP2PNQPTNTGTOVARY969p.K974fsc.2922_2922delAFrame_Shift_Del324.34JHOM2BN000N
CTBP2PNQPTNTGTOVARY969p.K974fsc.2922_2922delAFrame_Shift_Del324.34KURAMOCHIN000N
CTBP2PNQPTNTGTOVARY969p.K974fsc.2922_2922delAFrame_Shift_Del324.34OAW42N000N
CTBP2PNQPTNTGTOVARY969p.K974fsc.2922_2922delAFrame_Shift_Del324.34OC316N000N
CTBP2PNQPTNTGTOVARY969p.K974fsc.2922_2922delAFrame_Shift_Del324.34OVK18N000N
CTBP2PNQPTNTGTOVARY969p.K974fsc.2922_2922delAFrame_Shift_Del324.34OVKATEN000N
CTBP2PNQPTNTGTOVARY969p.K974fsc.2922_2922delAFrame_Shift_Del324.34OVTOKON000N
CTBP2PNQPTNTGTOVARY969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SNU840N000N
CTBP2PNQPTNTGTOVARY969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SNU8N000N
CTBP2PSPNQPTNTOVARY967p.K974fsc.2922_2922delAFrame_Shift_Del224.34CAOV4N000N
CTBP2PSPNQPTNTOVARY967p.K974fsc.2922_2922delAFrame_Shift_Del224.34JHOC5N000N
CTBP2PSPNQPTNTOVARY967p.K974fsc.2922_2922delAFrame_Shift_Del224.34JHOM2BN000N
CTBP2PSPNQPTNTOVARY967p.K974fsc.2922_2922delAFrame_Shift_Del224.34KURAMOCHIN000N
CTBP2PSPNQPTNTOVARY967p.K974fsc.2922_2922delAFrame_Shift_Del224.34OAW42N000N
CTBP2PSPNQPTNTOVARY967p.K974fsc.2922_2922delAFrame_Shift_Del224.34OC316N000N
CTBP2PSPNQPTNTOVARY967p.K974fsc.2922_2922delAFrame_Shift_Del224.34OVK18N000N
CTBP2PSPNQPTNTOVARY967p.K974fsc.2922_2922delAFrame_Shift_Del224.34OVKATEN000N
CTBP2PSPNQPTNTOVARY967p.K974fsc.2922_2922delAFrame_Shift_Del224.34OVTOKON000N
CTBP2PSPNQPTNTOVARY967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU840N000N
CTBP2PSPNQPTNTOVARY967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU8N000N
CTBP2PTNTGTIESOVARY972p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAOV4N000N
CTBP2PTNTGTIESOVARY972p.K974fsc.2922_2922delAFrame_Shift_Del524.34JHOC5N000N
CTBP2PTNTGTIESOVARY972p.K974fsc.2922_2922delAFrame_Shift_Del524.34JHOM2BN000N
CTBP2PTNTGTIESOVARY972p.K974fsc.2922_2922delAFrame_Shift_Del524.34KURAMOCHIN000N
CTBP2PTNTGTIESOVARY972p.K974fsc.2922_2922delAFrame_Shift_Del524.34OAW42N000N
CTBP2PTNTGTIESOVARY972p.K974fsc.2922_2922delAFrame_Shift_Del524.34OC316N000N
CTBP2PTNTGTIESOVARY972p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVK18N000N
CTBP2PTNTGTIESOVARY972p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVKATEN000N
CTBP2PTNTGTIESOVARY972p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVTOKON000N
CTBP2PTNTGTIESOVARY972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU840N000N
CTBP2PTNTGTIESOVARY972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU8N000N
CTBP2QPTNTGTIEOVARY971p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAOV4N000N
CTBP2QPTNTGTIEOVARY971p.K974fsc.2922_2922delAFrame_Shift_Del524.34JHOC5N000N
CTBP2QPTNTGTIEOVARY971p.K974fsc.2922_2922delAFrame_Shift_Del524.34JHOM2BN000N
CTBP2QPTNTGTIEOVARY971p.K974fsc.2922_2922delAFrame_Shift_Del524.34KURAMOCHIN000N
CTBP2QPTNTGTIEOVARY971p.K974fsc.2922_2922delAFrame_Shift_Del524.34OAW42N000N
CTBP2QPTNTGTIEOVARY971p.K974fsc.2922_2922delAFrame_Shift_Del524.34OC316N000N
CTBP2QPTNTGTIEOVARY971p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVK18N000N
CTBP2QPTNTGTIEOVARY971p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVKATEN000N
CTBP2QPTNTGTIEOVARY971p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVTOKON000N
CTBP2QPTNTGTIEOVARY971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU840N000N
CTBP2QPTNTGTIEOVARY971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU8N000N
CTBP2SPNQPTNTGOVARY968p.K974fsc.2922_2922delAFrame_Shift_Del224.34CAOV4N000N
CTBP2SPNQPTNTGOVARY968p.K974fsc.2922_2922delAFrame_Shift_Del224.34JHOC5N000N
CTBP2SPNQPTNTGOVARY968p.K974fsc.2922_2922delAFrame_Shift_Del224.34JHOM2BN000N
CTBP2SPNQPTNTGOVARY968p.K974fsc.2922_2922delAFrame_Shift_Del224.34KURAMOCHIN000N
CTBP2SPNQPTNTGOVARY968p.K974fsc.2922_2922delAFrame_Shift_Del224.34OAW42N000N
CTBP2SPNQPTNTGOVARY968p.K974fsc.2922_2922delAFrame_Shift_Del224.34OC316N000N
CTBP2SPNQPTNTGOVARY968p.K974fsc.2922_2922delAFrame_Shift_Del224.34OVK18N000N
CTBP2SPNQPTNTGOVARY968p.K974fsc.2922_2922delAFrame_Shift_Del224.34OVKATEN000N
CTBP2SPNQPTNTGOVARY968p.K974fsc.2922_2922delAFrame_Shift_Del224.34OVTOKON000N
CTBP2SPNQPTNTGOVARY968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU840N000N
CTBP2SPNQPTNTGOVARY968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU8N000N
CTBP2TGTIESTPTOVARY975p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAOV4N000N
CTBP2TGTIESTPTOVARY975p.K974fsc.2922_2922delAFrame_Shift_Del524.34JHOC5N000N
CTBP2TGTIESTPTOVARY975p.K974fsc.2922_2922delAFrame_Shift_Del524.34JHOM2BN000N
CTBP2TGTIESTPTOVARY975p.K974fsc.2922_2922delAFrame_Shift_Del524.34KURAMOCHIN000N
CTBP2TGTIESTPTOVARY975p.K974fsc.2922_2922delAFrame_Shift_Del524.34OAW42N000N
CTBP2TGTIESTPTOVARY975p.K974fsc.2922_2922delAFrame_Shift_Del524.34OC316N000N
CTBP2TGTIESTPTOVARY975p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVK18N000N
CTBP2TGTIESTPTOVARY975p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVKATEN000N
CTBP2TGTIESTPTOVARY975p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVTOKON000N
CTBP2TGTIESTPTOVARY975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU840N000N
CTBP2TGTIESTPTOVARY975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU8N000N
CTBP2TIESTPTSNOVARY977p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAOV4N100N
CTBP2TIESTPTSNOVARY977p.K974fsc.2922_2922delAFrame_Shift_Del524.34JHOC5N100N
CTBP2TIESTPTSNOVARY977p.K974fsc.2922_2922delAFrame_Shift_Del524.34JHOM2BN100N
CTBP2TIESTPTSNOVARY977p.K974fsc.2922_2922delAFrame_Shift_Del524.34KURAMOCHIN100N
CTBP2TIESTPTSNOVARY977p.K974fsc.2922_2922delAFrame_Shift_Del524.34OAW42N100N
CTBP2TIESTPTSNOVARY977p.K974fsc.2922_2922delAFrame_Shift_Del524.34OC316N100N
CTBP2TIESTPTSNOVARY977p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVK18N100N
CTBP2TIESTPTSNOVARY977p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVKATEN100N
CTBP2TIESTPTSNOVARY977p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVTOKON100N
CTBP2TIESTPTSNOVARY977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU840N100N
CTBP2TIESTPTSNOVARY977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU8N100N
CTBP2TNTGTIESTOVARY973p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAOV4N000N
CTBP2TNTGTIESTOVARY973p.K974fsc.2922_2922delAFrame_Shift_Del524.34JHOC5N000N
CTBP2TNTGTIESTOVARY973p.K974fsc.2922_2922delAFrame_Shift_Del524.34JHOM2BN000N
CTBP2TNTGTIESTOVARY973p.K974fsc.2922_2922delAFrame_Shift_Del524.34KURAMOCHIN000N
CTBP2TNTGTIESTOVARY973p.K974fsc.2922_2922delAFrame_Shift_Del524.34OAW42N000N
CTBP2TNTGTIESTOVARY973p.K974fsc.2922_2922delAFrame_Shift_Del524.34OC316N000N
CTBP2TNTGTIESTOVARY973p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVK18N000N
CTBP2TNTGTIESTOVARY973p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVKATEN000N
CTBP2TNTGTIESTOVARY973p.K974fsc.2922_2922delAFrame_Shift_Del524.34OVTOKON000N
CTBP2TNTGTIESTOVARY973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU840N000N
CTBP2TNTGTIESTOVARY973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU8N000N
CTBP2AADTEQGCIOVARY176p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N500N
CTBP2AARHQVWGGOVARY192p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N000N
CTBP2ACLPPQPGLOVARY202p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N1100N
CTBP2ADTEQGCISOVARY177p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N100N
CTBP2ARHQVWGGGOVARY193p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N100N
CTBP2AVWTGAARHOVARY187p.Q175fsc.524_525delAGFrame_Shift_Del40.44OVCAR4N000N
CTBP2CISRAVWTGOVARY183p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N000N
CTBP2CLPPQPGLQOVARY203p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N000N
CTBP2DPGGKMIPROVARY167p.Q175fsc.524_525delAGFrame_Shift_Del10.44OVCAR4Y590N
CTBP2DTEQGCISROVARY178p.Q175fsc.524_525delAGFrame_Shift_Del60.44OVCAR4N500N
CTBP2EQGCISRAVOVARY180p.Q175fsc.524_525delAGFrame_Shift_Del40.44OVCAR4Y2130Y
CTBP2GAARHQVWGOVARY191p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N000N
CTBP2GACLPPQPGOVARY201p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N000N
CTBP2GCISRAVWTOVARY182p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N100N
CTBP2GGACLPPQPOVARY200p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N000N
CTBP2GGGACLPPQOVARY199p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N000N
CTBP2GGKMIPRAAOVARY169p.Q175fsc.524_525delAGFrame_Shift_Del30.44OVCAR4N100N
CTBP2GKMIPRAADOVARY170p.Q175fsc.524_525delAGFrame_Shift_Del40.44OVCAR4N000N
CTBP2GLQRHQRKTOVARY209p.Q175fsc.524_525delAGFrame_Shift_Del60.44OVCAR4N100N
CTBP2HQVWGGGACOVARY195p.Q175fsc.524_525delAGFrame_Shift_Del60.44OVCAR4N200N
CTBP2IPRAADTEQOVARY173p.Q175fsc.524_525delAGFrame_Shift_Del40.44OVCAR4N100N
CTBP2ISRAVWTGAOVARY184p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4Y2110N
CTBP2KMIPRAADTOVARY171p.Q175fsc.524_525delAGFrame_Shift_Del40.44OVCAR4N400N
CTBP2LPPQPGLQROVARY204p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N600N
CTBP2LQRHQRKTHOVARY210p.Q175fsc.524_525delAGFrame_Shift_Del60.44OVCAR4N0021N
CTBP2MIPRAADTEOVARY172p.Q175fsc.524_525delAGFrame_Shift_Del40.44OVCAR4N001N
CTBP2PGGKMIPRAOVARY168p.Q175fsc.524_525delAGFrame_Shift_Del20.44OVCAR4N000N
CTBP2PGLQRHQRKOVARY208p.Q175fsc.524_525delAGFrame_Shift_Del60.44OVCAR4N000N
CTBP2PPQPGLQRHOVARY205p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N000N
CTBP2PQPGLQRHQOVARY206p.Q175fsc.524_525delAGFrame_Shift_Del60.44OVCAR4N000N
CTBP2PRAADTEQGOVARY174p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N000N
CTBP2QGCISRAVWOVARY181p.Q175fsc.524_525delAGFrame_Shift_Del40.44OVCAR4N100N
CTBP2QPGLQRHQROVARY207p.Q175fsc.524_525delAGFrame_Shift_Del60.44OVCAR4N300N
CTBP2QVWGGGACLOVARY196p.Q175fsc.524_525delAGFrame_Shift_Del60.44OVCAR4N1200N
CTBP2RAADTEQGCOVARY175p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N200N
CTBP2RAVWTGAAROVARY186p.Q175fsc.524_525delAGFrame_Shift_Del30.44OVCAR4Y490N
CTBP2RHQVWGGGAOVARY194p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N100N
CTBP2SRAVWTGAAOVARY185p.Q175fsc.524_525delAGFrame_Shift_Del40.44OVCAR4N200N
CTBP2TEQGCISRAOVARY179p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N500N
CTBP2TGAARHQVWOVARY190p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N200N
CTBP2VWGGGACLPOVARY197p.Q175fsc.524_525delAGFrame_Shift_Del60.44OVCAR4N000N
CTBP2VWTGAARHQOVARY188p.Q175fsc.524_525delAGFrame_Shift_Del40.44OVCAR4N000N
CTBP2WGGGACLPPOVARY198p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N200N
CTBP2WTGAARHQVOVARY189p.Q175fsc.524_525delAGFrame_Shift_Del50.44OVCAR4N500N
CTBP2AALPMAAEPOVARY60p.V64Mc.190G>AMissense_Mutation10.11OC316N000N
CTBP2ADIKSVTPNOVARY327p.A333Tc.997G>AMissense_Mutation10.11IGROV1N300N
CTBP2ALPMAAEPYOVARY61p.V64Mc.190G>AMissense_Mutation10.11OC316N600N
CTBP2DAALPMAAEOVARY59p.V64Mc.190G>AMissense_Mutation10.11OC316N000N
CTBP2DADIKSVTPOVARY326p.A333Tc.997G>AMissense_Mutation10.11IGROV1N000N
CTBP2DGIERFLGVOVARY755p.S760Fc.2279C>TMissense_Mutation10.11ES2N800N
CTBP2DIKSVTPNLOVARY328p.A333Tc.997G>AMissense_Mutation10.11IGROV1Y6100N
CTBP2DLKKFKALROVARY631p.E633Kc.1897G>AMissense_Mutation10.11JHOM2BY6100N
CTBP2EDADIKSVTOVARY325p.A333Tc.997G>AMissense_Mutation10.11IGROV1N200N
CTBP2EDLKKFKALOVARY630p.E633Kc.1897G>AMissense_Mutation10.11JHOM2BN1000N
CTBP2ERFLGVQRVOVARY758p.S760Fc.2279C>TMissense_Mutation10.11ES2Y4100N
CTBP2FLGVQRVYTOVARY760p.S760Fc.2279C>TMissense_Mutation10.11ES2N500N
CTBP2GIERFLGVQOVARY756p.S760Fc.2279C>TMissense_Mutation10.11ES2N000N
CTBP2IERFLGVQROVARY757p.S760Fc.2279C>TMissense_Mutation10.11ES2N000N
CTBP2IKSVTPNLGOVARY329p.A333Tc.997G>AMissense_Mutation10.11IGROV1N003N
CTBP2ITLTREDLKOVARY625p.E633Kc.1897G>AMissense_Mutation10.11JHOM2BY3110N
CTBP2KKFKALRVIOVARY633p.E633Kc.1897G>AMissense_Mutation10.11JHOM2BN600N
CTBP2KSVTPNLGQOVARY330p.A333Tc.997G>AMissense_Mutation10.11IGROV1N000N
CTBP2LKKFKALRVOVARY632p.E633Kc.1897G>AMissense_Mutation10.11JHOM2BN4017N
CTBP2LPMAAEPYLOVARY62p.V64Mc.190G>AMissense_Mutation10.11OC316N1800N
CTBP2LQDGIERFLOVARY753p.S760Fc.2279C>TMissense_Mutation10.11ES2N900N
CTBP2LTREDLKKFOVARY627p.E633Kc.1897G>AMissense_Mutation10.11JHOM2BN600N
CTBP2MAAEPYLYROVARY64p.V64Mc.190G>AMissense_Mutation10.11OC316Y490N
CTBP2PMAAEPYLYOVARY63p.V64Mc.190G>AMissense_Mutation10.11OC316N100N
CTBP2PQDAALPMAOVARY57p.V64Mc.190G>AMissense_Mutation10.11OC316N000N
CTBP2QDAALPMAAOVARY58p.V64Mc.190G>AMissense_Mutation10.11OC316N300N
CTBP2QDGIERFLGOVARY754p.S760Fc.2279C>TMissense_Mutation10.11ES2N100N
CTBP2REDLKKFKAOVARY629p.E633Kc.1897G>AMissense_Mutation10.11JHOM2BN600N
CTBP2RFLGVQRVYOVARY759p.S760Fc.2279C>TMissense_Mutation10.11ES2N300N
CTBP2RPQDAALPMOVARY56p.V64Mc.190G>AMissense_Mutation10.11OC316Y1290N
CTBP2SVTPNLGQAOVARY331p.A333Tc.997G>AMissense_Mutation10.11IGROV1N400N
CTBP2TLTREDLKKOVARY626p.E633Kc.1897G>AMissense_Mutation10.11JHOM2BN500Y
CTBP2TPNLGQARVOVARY333p.A333Tc.997G>AMissense_Mutation10.11IGROV1Y1290N
CTBP2TREDLKKFKOVARY628p.E633Kc.1897G>AMissense_Mutation10.11JHOM2BN300N
CTBP2VTPNLGQAROVARY332p.A333Tc.997G>AMissense_Mutation10.11IGROV1N400Y
CTBP2YLQDGIERFOVARY752p.S760Fc.2279C>TMissense_Mutation10.11ES2Y999N
CTNNB1AAVSHWRQQOVARY20p.Q26Rc.77A>GMissense_Mutation10.11OVCAR8N000N
CTNNB1AGATTTAPSOVARY37p.S37Ac.109T>GMissense_Mutation10.11HS571TN000N
CTNNB1ALLNKTNVNOVARY284p.K292Nc.876A>TMissense_Mutation10.11TOV21GN000N
CTNNB1AVSHWRQQSOVARY21p.Q26Rc.77A>GMissense_Mutation10.11OVCAR8N000N
CTNNB1DSGIHAGATOVARY32p.S37Ac.109T>GMissense_Mutation10.11HS571TN100N
CTNNB1GIHAGATTTOVARY34p.S37Ac.109T>GMissense_Mutation10.11HS571TN000N
CTNNB1HAGATTTAPOVARY36p.S37Ac.109T>GMissense_Mutation10.11HS571TN000N
CTNNB1HWRQQSYLDOVARY24p.Q26Rc.77A>GMissense_Mutation10.11OVCAR8N000N
CTNNB1IHAGATTTAOVARY35p.S37Ac.109T>GMissense_Mutation10.11HS571TN201N
CTNNB1KAAVSHWRQOVARY19p.Q26Rc.77A>GMissense_Mutation10.11OVCAR8N000N
CTNNB1KTNVNFLAIOVARY288p.K292Nc.876A>TMissense_Mutation10.11TOV21GY7140N
CTNNB1LDSGIHAGAOVARY31p.S37Ac.109T>GMissense_Mutation10.11HS571TN400N
CTNNB1LLNKTNVNFOVARY285p.K292Nc.876A>TMissense_Mutation10.11TOV21GY791N
CTNNB1LNKTNVNFLOVARY286p.K292Nc.876A>TMissense_Mutation10.11TOV21GN1002N
CTNNB1NFLAITTDCOVARY292p.K292Nc.876A>TMissense_Mutation10.11TOV21GN100N
CTNNB1NKTNVNFLAOVARY287p.K292Nc.876A>TMissense_Mutation10.11TOV21GN200N
CTNNB1NVNFLAITTOVARY290p.K292Nc.876A>TMissense_Mutation10.11TOV21GN100N
CTNNB1RKAAVSHWROVARY18p.Q26Rc.77A>GMissense_Mutation10.11OVCAR8N100N
CTNNB1RQQSYLDSGOVARY26p.Q26Rc.77A>GMissense_Mutation10.11OVCAR8N000N
CTNNB1SGIHAGATTOVARY33p.S37Ac.109T>GMissense_Mutation10.11HS571TN200N
CTNNB1SHWRQQSYLOVARY23p.Q26Rc.77A>GMissense_Mutation10.11OVCAR8Y490N
CTNNB1SYLDSGIHAOVARY29p.S37Ac.109T>GMissense_Mutation10.11HS571TY3100N
CTNNB1TNVNFLAITOVARY289p.K292Nc.876A>TMissense_Mutation10.11TOV21GN000N
CTNNB1VNFLAITTDOVARY291p.K292Nc.876A>TMissense_Mutation10.11TOV21GN003N
CTNNB1VSHWRQQSYOVARY22p.Q26Rc.77A>GMissense_Mutation10.11OVCAR8Y7130N
CTNNB1WRQQSYLDSOVARY25p.Q26Rc.77A>GMissense_Mutation10.11OVCAR8N5016N
CTNNB1YLDSGIHAGOVARY30p.S37Ac.109T>GMissense_Mutation10.11HS571TN300N
EGFRAPSRDPQYQOVARY1118p.H1124Qc.3372C>GMissense_Mutation10.11COV362N000N
EGFRCLVCRKFQDOVARY248p.R255Qc.764G>AMissense_Mutation10.11CAOV3N000N
EGFRCRKFQDEATOVARY251p.R255Qc.764G>AMissense_Mutation10.11CAOV3N200N
EGFRDCLVCRKFQOVARY247p.R255Qc.764G>AMissense_Mutation10.11CAOV3N000N
EGFRDPQYQDPHSOVARY1122p.H1124Qc.3372C>GMissense_Mutation10.11COV362N300N
EGFRFQDEATCKDOVARY254p.R255Qc.764G>AMissense_Mutation10.11CAOV3N103N
EGFRKFQDEATCKOVARY253p.R255Qc.764G>AMissense_Mutation10.11CAOV3N100N
EGFRLVCRKFQDEOVARY249p.R255Qc.764G>AMissense_Mutation10.11CAOV3N002N
EGFRNPAPSRDPQOVARY1116p.H1124Qc.3372C>GMissense_Mutation10.11COV362N100N
EGFRPAPSRDPQYOVARY1117p.H1124Qc.3372C>GMissense_Mutation10.11COV362N000Y
EGFRPQYQDPHSTOVARY1123p.H1124Qc.3372C>GMissense_Mutation10.11COV362N000N
EGFRPSRDPQYQDOVARY1119p.H1124Qc.3372C>GMissense_Mutation10.11COV362N000Y
EGFRQDEATCKDTOVARY255p.R255Qc.764G>AMissense_Mutation10.11CAOV3N100N
EGFRQYQDPHSTAOVARY1124p.H1124Qc.3372C>GMissense_Mutation10.11COV362N300N
EGFRRDPQYQDPHOVARY1121p.H1124Qc.3372C>GMissense_Mutation10.11COV362N000Y
EGFRRKFQDEATCOVARY252p.R255Qc.764G>AMissense_Mutation10.11CAOV3N100N
EGFRSRDPQYQDPOVARY1120p.H1124Qc.3372C>GMissense_Mutation10.11COV362N100N
EGFRVCRKFQDEAOVARY250p.R255Qc.764G>AMissense_Mutation10.11CAOV3N300N
ERBB2AVVGSPYVSOVARY775p.G776Vc.2327G>TMissense_Mutation10.11OVCAR8N000N
ERBB2AYVMAVVGSOVARY771p.G776Vc.2327G>TMissense_Mutation10.11OVCAR8N200N
ERBB2DEAYVMAVVOVARY769p.G776Vc.2327G>TMissense_Mutation10.11OVCAR8N700N
ERBB2EAYVMAVVGOVARY770p.G776Vc.2327G>TMissense_Mutation10.11OVCAR8N000N
ERBB2MAVVGSPYVOVARY774p.G776Vc.2327G>TMissense_Mutation10.11OVCAR8N700N
ERBB2VMAVVGSPYOVARY773p.G776Vc.2327G>TMissense_Mutation10.11OVCAR8N700N
ERBB2VVGSPYVSROVARY776p.G776Vc.2327G>TMissense_Mutation10.11OVCAR8Y6110N
ERBB2YVMAVVGSPOVARY772p.G776Vc.2327G>TMissense_Mutation10.11OVCAR8N2027N
ERBB2LDEAYVMAVOVARY768p.G776Vc.2327G>TMissense_Mutation10.22OVCAR8N700N
ERBB2DVRLIHRDLOVARY838p.V842Ic.2524G>AMissense_Mutation10.44EFO27Y8100N
ERBB2EDVRLIHRDOVARY837p.V842Ic.2524G>AMissense_Mutation10.44EFO27N000N
ERBB2LEDVRLIHROVARY836p.V842Ic.2524G>AMissense_Mutation10.44EFO27Y190N
ERBB2LIHRDLAAROVARY841p.V842Ic.2524G>AMissense_Mutation10.44EFO27N504N
ERBB2RLIHRDLAAOVARY840p.V842Ic.2524G>AMissense_Mutation10.44EFO27N500N
ERBB2SYLEDVRLIOVARY834p.V842Ic.2524G>AMissense_Mutation10.44EFO27Y8100N
ERBB2VRLIHRDLAOVARY839p.V842Ic.2524G>AMissense_Mutation10.44EFO27N4021N
ERBB2YLEDVRLIHOVARY835p.V842Ic.2524G>AMissense_Mutation10.44EFO27N407N
FBXW7AAVLCVQYDOVARY502p.R505Lc.1514G>TMissense_Mutation10.11SKOV3N000N
FBXW7AVLCVQYDGOVARY503p.R505Lc.1514G>TMissense_Mutation10.11SKOV3N000N
FBXW7GHVAAVLCVOVARY499p.R505Lc.1514G>TMissense_Mutation10.11SKOV3N200N
FBXW7HVAAVLCVQOVARY500p.R505Lc.1514G>TMissense_Mutation10.11SKOV3N000N
FBXW7LCVQYDGRROVARY505p.R505Lc.1514G>TMissense_Mutation10.11SKOV3N400N
FBXW7LMGHVAAVLOVARY497p.R505Lc.1514G>TMissense_Mutation10.11SKOV3N1208N
FBXW7MGHVAAVLCOVARY498p.R505Lc.1514G>TMissense_Mutation10.11SKOV3N202N
FBXW7VAAVLCVQYOVARY501p.R505Lc.1514G>TMissense_Mutation10.11SKOV3N700N
FBXW7VLCVQYDGROVARY504p.R505Lc.1514G>TMissense_Mutation10.11SKOV3N500N
FGFR3APPPCTRSPOVARY409p.S402fsc.1206_1206delCFrame_Shift_Del50.11TOV21GN000N
FGFR3ASRSSDRCPOVARY418p.S402fsc.1206_1206delCFrame_Shift_Del50.11TOV21GN000N
FGFR3AWAPPPCTROVARY407p.S402fsc.1206_1206delCFrame_Shift_Del60.11TOV21GY190N
FGFR3CRLRSPPRKOVARY398p.S402fsc.1206_1206delCFrame_Shift_Del10.11TOV21GY2120Y
FGFR3CTRSPASRSOVARY413p.S402fsc.1206_1206delCFrame_Shift_Del50.11TOV21GN000N
FGFR3DRCPWSPTROVARY423p.S402fsc.1206_1206delCFrame_Shift_Del50.11TOV21GN300N
FGFR3KAWAPPPCTOVARY406p.S402fsc.1206_1206delCFrame_Shift_Del50.11TOV21GN400N
FGFR3LCRLRSPPROVARY397p.S402fsc.1206_1206delCFrame_Shift_Del10.11TOV21GN400Y
FGFR3LRSPPRKAWOVARY400p.S402fsc.1206_1206delCFrame_Shift_Del30.11TOV21GY490Y
FGFR3PASRSSDRCOVARY417p.S402fsc.1206_1206delCFrame_Shift_Del50.11TOV21GN000N
FGFR3PCTRSPASROVARY412p.S402fsc.1206_1206delCFrame_Shift_Del60.11TOV21GN000N
FGFR3PPCTRSPASOVARY411p.S402fsc.1206_1206delCFrame_Shift_Del60.11TOV21GN000N
FGFR3PPPCTRSPAOVARY410p.S402fsc.1206_1206delCFrame_Shift_Del60.11TOV21GN400N
FGFR3PPRKAWAPPOVARY403p.S402fsc.1206_1206delCFrame_Shift_Del50.11TOV21GN100N
FGFR3PRKAWAPPPOVARY404p.S402fsc.1206_1206delCFrame_Shift_Del50.11TOV21GN000N
FGFR3RCPWSPTRPOVARY424p.S402fsc.1206_1206delCFrame_Shift_Del50.11TOV21GN000N
FGFR3RKAWAPPPCOVARY405p.S402fsc.1206_1206delCFrame_Shift_Del50.11TOV21GN100N
FGFR3RLRSPPRKAOVARY399p.S402fsc.1206_1206delCFrame_Shift_Del20.11TOV21GY2110Y
FGFR3RSPASRSSDOVARY415p.S402fsc.1206_1206delCFrame_Shift_Del40.11TOV21GN000N
FGFR3RSPPRKAWAOVARY401p.S402fsc.1206_1206delCFrame_Shift_Del40.11TOV21GY3100N
FGFR3RSSDRCPWSOVARY420p.S402fsc.1206_1206delCFrame_Shift_Del60.11TOV21GN200N
FGFR3SDRCPWSPTOVARY422p.S402fsc.1206_1206delCFrame_Shift_Del60.11TOV21GN100N
FGFR3SPASRSSDROVARY416p.S402fsc.1206_1206delCFrame_Shift_Del40.11TOV21GN300N
FGFR3SPPRKAWAPOVARY402p.S402fsc.1206_1206delCFrame_Shift_Del50.11TOV21GN000N
FGFR3SRSSDRCPWOVARY419p.S402fsc.1206_1206delCFrame_Shift_Del60.11TOV21GN400N
FGFR3SSDRCPWSPOVARY421p.S402fsc.1206_1206delCFrame_Shift_Del60.11TOV21GN000N
FGFR3TRSPASRSSOVARY414p.S402fsc.1206_1206delCFrame_Shift_Del40.11TOV21GN200N
FGFR3WAPPPCTRSOVARY408p.S402fsc.1206_1206delCFrame_Shift_Del50.11TOV21GN300N
FGFR3DDSMFAHDLOVARY787p.V790Mc.2368G>AMissense_Mutation10.11ES2Y6100N
FGFR3DSMFAHDLLOVARY788p.V790Mc.2368G>AMissense_Mutation10.11ES2N1000N
FGFR3GDDSMFAHDOVARY786p.V790Mc.2368G>AMissense_Mutation10.11ES2N000N
FGFR3MFAHDLLPPOVARY790p.V790Mc.2368G>AMissense_Mutation10.11ES2N003N
FGFR3SGDDSMFAHOVARY785p.V790Mc.2368G>AMissense_Mutation10.11ES2N100N
FGFR3SMFAHDLLPOVARY789p.V790Mc.2368G>AMissense_Mutation10.11ES2N000N
FGFR3SSGDDSMFAOVARY784p.V790Mc.2368G>AMissense_Mutation10.11ES2N100N
FGFR3SSSGDDSMFOVARY783p.V790Mc.2368G>AMissense_Mutation10.11ES2N500N
FGFR3SSSSGDDSMOVARY782p.V790Mc.2368G>AMissense_Mutation10.11ES2N400Y
FLT3AQFTKMFMLOVARY425p.T432Mc.1295C>TMissense_Mutation10.22RMUGSY2290N
FLT3DAQFTKMFMOVARY424p.T432Mc.1295C>TMissense_Mutation10.22RMUGSN400Y
FLT3FMLNIRRKPOVARY431p.T432Mc.1295C>TMissense_Mutation10.22RMUGSN2015N
FLT3FTKMFMLNIOVARY427p.T432Mc.1295C>TMissense_Mutation10.22RMUGSY7156N
FLT3KMFMLNIRROVARY429p.T432Mc.1295C>TMissense_Mutation10.22RMUGSY890N
FLT3MFMLNIRRKOVARY430p.T432Mc.1295C>TMissense_Mutation10.22RMUGSY01225N
FLT3MLNIRRKPQOVARY432p.T432Mc.1295C>TMissense_Mutation10.22RMUGSN0022N
FLT3QFTKMFMLNOVARY426p.T432Mc.1295C>TMissense_Mutation10.22RMUGSN000N
FLT3TKMFMLNIROVARY428p.T432Mc.1295C>TMissense_Mutation10.22RMUGSN100N
FMN2LPPLPGAAIOVARY934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.0359MN1401N
FMN2LPPLPGAAIOVARY934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03A2780N1401N
FMN2LPPLPGAAIOVARY934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03ES2N1401N
FMN2LPPLPGAAIOVARY934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03HEYA8N1401N
FMN2LPPLPGAAIOVARY934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03JHOS2N1401N
FMN2LPPLPGAAIOVARY934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03OVKATEN1401N
FMN2LPPLPGAAIOVARY934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03OVMANAN1401N
FMN2LPPLPGAAIOVARY934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03SNU119N1401N
FMN2PLPPLPGAAOVARY933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.0359MN000N
FMN2PLPPLPGAAOVARY933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03A2780N000N
FMN2PLPPLPGAAOVARY933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03ES2N000N
FMN2PLPPLPGAAOVARY933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03HEYA8N000N
FMN2PLPPLPGAAOVARY933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03JHOS2N000N
FMN2PLPPLPGAAOVARY933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03OVKATEN000N
FMN2PLPPLPGAAOVARY933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03OVMANAN000N
FMN2PLPPLPGAAOVARY933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03SNU119N000N
FMN2AMGLLPFSDOVARY567p.L572delc.1714_1716delCTTIn_Frame_Del30.11OC316N000N
FMN2GLLPFSDCFOVARY569p.L572delc.1714_1716delCTTIn_Frame_Del10.11OC316N700N
FMN2IAMGLLPFSOVARY566p.L572delc.1714_1716delCTTIn_Frame_Del30.11OC316N108N
FMN2IIAMGLLPFOVARY565p.L572delc.1714_1716delCTTIn_Frame_Del20.11OC316N7017N
FMN2MGLLPFSDCOVARY568p.L572delc.1714_1716delCTTIn_Frame_Del20.11OC316N102N
FMN2RIIAMGLLPOVARY564p.L572delc.1714_1716delCTTIn_Frame_Del10.11OC316N000N
FMN2CNLFQSTFSOVARY1453p.R1454Qc.4361G>AMissense_Mutation10.11SKOV3N000N
FMN2ERVFCNLFQOVARY1449p.R1454Qc.4361G>AMissense_Mutation10.11SKOV3N000N
FMN2FCNLFQSTFOVARY1452p.R1454Qc.4361G>AMissense_Mutation10.11SKOV3N600N
FMN2FSERVFCNLOVARY1447p.R1454Qc.4361G>AMissense_Mutation10.11SKOV3Y13100N
FMN2NFSERVFCNOVARY1446p.R1454Qc.4361G>AMissense_Mutation10.11SKOV3N000N
FMN2NLFQSTFSEOVARY1454p.R1454Qc.4361G>AMissense_Mutation10.11SKOV3N100N
FMN2RVFCNLFQSOVARY1450p.R1454Qc.4361G>AMissense_Mutation10.11SKOV3N100N
FMN2SERVFCNLFOVARY1448p.R1454Qc.4361G>AMissense_Mutation10.11SKOV3Y590N
FMN2VFCNLFQSTOVARY1451p.R1454Qc.4361G>AMissense_Mutation10.11SKOV3N100N
FMN2AENGPQTKFOVARY773p.P775Hc.2324C>AMissense_Mutation10.22COLO704Y6110N
FMN2CPPGAENGPOVARY769p.P775Hc.2324C>AMissense_Mutation10.22COLO704N000N
FMN2ENGPQTKFCOVARY774p.P775Hc.2324C>AMissense_Mutation10.22COLO704N000N
FMN2GAENGPQTKOVARY772p.P775Hc.2324C>AMissense_Mutation10.22COLO704N300N
FMN2NGPQTKFCSOVARY775p.P775Hc.2324C>AMissense_Mutation10.22COLO704N100N
FMN2PCPPGAENGOVARY768p.P775Hc.2324C>AMissense_Mutation10.22COLO704N000N
FMN2PGAENGPQTOVARY771p.P775Hc.2324C>AMissense_Mutation10.22COLO704N000N
FMN2PPCPPGAENOVARY767p.P775Hc.2324C>AMissense_Mutation10.22COLO704N000N
FMN2PPGAENGPQOVARY770p.P775Hc.2324C>AMissense_Mutation10.22COLO704N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.759MN000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7A2780N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7CAOV4N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7COLO704N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7COV318N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7COV434N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7EFO27N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7FUOV1N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HEYA8N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HS571TN000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7JHOC5N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7JHOM1N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7JHOM2BN000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7JHOS2N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7MCASN000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7OAW28N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7OC316N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7OV56N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7OV90N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7OVCAR4N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7OVCAR8N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7OVISEN000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7OVK18N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7OVMANAN000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7OVSAHON000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7OVTOKON000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7RMUGSN000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SKOV3N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU119N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU840N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU8N000N
GPR112ASISDMFIQOVARY2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TYKNUN000N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.759MY11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7A2780Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7CAOV4Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7COLO704Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7COV318Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7COV434Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7EFO27Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7FUOV1Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HEYA8Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS571TY11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7JHOC5Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7JHOM1Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7JHOM2BY11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7JHOS2Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7MCASY11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7OAW28Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7OC316Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7OV56Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7OV90Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7OVCAR4Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7OVCAR8Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7OVISEY11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7OVK18Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7OVMANAY11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7OVSAHOY11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7OVTOKOY11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7RMUGSY11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SKOV3Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU119Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU840Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU8Y11100N
GPR112ISDMFIQNLOVARY2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TYKNUY11100N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.759MN700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7A2780N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7CAOV4N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7COLO704N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7COV318N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7COV434N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7EFO27N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7FUOV1N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HEYA8N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS571TN700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7JHOC5N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7JHOM1N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7JHOM2BN700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7JHOS2N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7MCASN700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7OAW28N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7OC316N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7OV56N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7OV90N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7OVCAR4N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7OVCAR8N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7OVISEN700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7OVK18N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7OVMANAN700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7OVSAHON700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7OVTOKON700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7RMUGSN700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SKOV3N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU119N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU840N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU8N700N
GPR112SASISDMFIOVARY2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TYKNUN700N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.759MN400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7A2780N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7CAOV4N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7COLO704N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7COV318N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7COV434N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7EFO27N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7FUOV1N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HEYA8N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS571TN400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7JHOC5N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7JHOM1N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7JHOM2BN400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7JHOS2N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7MCASN400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7OAW28N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7OC316N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7OV56N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7OV90N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7OVCAR4N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7OVCAR8N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7OVISEN400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7OVK18N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7OVMANAN400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7OVSAHON400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7OVTOKON400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7RMUGSN400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SKOV3N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU119N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU840N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU8N400N
GPR112SDMFIQNLAOVARY2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TYKNUN400N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.759MN000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7A2780N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7CAOV4N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7COLO704N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7COV318N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7COV434N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7EFO27N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7FUOV1N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HEYA8N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS571TN000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7JHOC5N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7JHOM1N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7JHOM2BN000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7JHOS2N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7MCASN000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7OAW28N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7OC316N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7OV56N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7OV90N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7OVCAR4N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7OVCAR8N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7OVISEN000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7OVK18N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7OVMANAN000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7OVSAHON000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7OVTOKON000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7RMUGSN000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SKOV3N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU119N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU840N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU8N000N
GPR112SISDMFIQNOVARY2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TYKNUN000N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.759MN900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7A2780N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7CAOV4N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7COLO704N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7COV318N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7COV434N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7EFO27N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7FUOV1N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HEYA8N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS571TN900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7JHOC5N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7JHOM1N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7JHOM2BN900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7JHOS2N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7MCASN900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7OAW28N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7OC316N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7OV56N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7OV90N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7OVCAR4N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7OVCAR8N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7OVISEN900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7OVK18N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7OVMANAN900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7OVSAHON900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7OVTOKON900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7RMUGSN900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SKOV3N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU119N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU840N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU8N900N
GPR112VSASISDMFOVARY2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TYKNUN900N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.759MN5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7A2780N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7CAOV4N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7COLO704N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7COV318N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7COV434N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7EFO27N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7FUOV1N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HEYA8N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS571TN5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7JHOC5N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7JHOM1N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7JHOM2BN5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7JHOS2N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7MCASN5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7OAW28N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7OC316N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7OV56N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7OV90N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7OVCAR4N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7OVCAR8N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7OVISEN5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7OVK18N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7OVMANAN5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7OVSAHON5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7OVTOKON5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7RMUGSN5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SKOV3N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU119N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU840N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU8N5020N
GPR112VVSASISDMOVARY2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TYKNUN5020N
GPR112AGCLKSPCTOVARY1545p.P1545Ac.4633C>GMissense_Mutation10.22TOV21GN100N
GPR112HAGCLKSPCOVARY1544p.P1545Ac.4633C>GMissense_Mutation10.22TOV21GN400N
GPR112KSSKTMHAGOVARY1538p.P1545Ac.4633C>GMissense_Mutation10.22TOV21GN100N
GPR112KTMHAGCLKOVARY1541p.P1545Ac.4633C>GMissense_Mutation10.22TOV21GN500N
GPR112MHAGCLKSPOVARY1543p.P1545Ac.4633C>GMissense_Mutation10.22TOV21GN000N
GPR112SKTMHAGCLOVARY1540p.P1545Ac.4633C>GMissense_Mutation10.22TOV21GN300N
GPR112SSKTMHAGCOVARY1539p.P1545Ac.4633C>GMissense_Mutation10.22TOV21GN100N
GPR112TKSSKTMHAOVARY1537p.P1545Ac.4633C>GMissense_Mutation10.22TOV21GN200Y
GPR112TMHAGCLKSOVARY1542p.P1545Ac.4633C>GMissense_Mutation10.22TOV21GN000N
HSP90B1DEEETAKESOVARY787p.E791delc.2362_2364delGAAIn_Frame_Del121.79COV504N300N
HSP90B1DEEETAKESOVARY787p.E791delc.2362_2364delGAAIn_Frame_Del121.79JHOC5N300N
HSP90B1DEEETAKESOVARY787p.E791delc.2362_2364delGAAIn_Frame_Del121.79JHOM1N300N
HSP90B1DEEETAKESOVARY787p.E791delc.2362_2364delGAAIn_Frame_Del121.79JHOS4N300N
HSP90B1DEEETAKESOVARY787p.E791delc.2362_2364delGAAIn_Frame_Del121.79OV90N300N
HSP90B1DEEETAKESOVARY787p.E791delc.2362_2364delGAAIn_Frame_Del121.79OVISEN300N
HSP90B1DEEETAKESOVARY787p.E791delc.2362_2364delGAAIn_Frame_Del121.79OVK18N300N
HSP90B1DEEETAKESOVARY787p.E791delc.2362_2364delGAAIn_Frame_Del121.79OVKATEN300N
HSP90B1DEEETAKESOVARY787p.E791delc.2362_2364delGAAIn_Frame_Del121.79OVSAHON300N
HSP90B1DEEETAKESOVARY787p.E791delc.2362_2364delGAAIn_Frame_Del121.79OVTOKON300N
HSP90B1DEEETAKESOVARY787p.E791delc.2362_2364delGAAIn_Frame_Del121.79TYKNUN300N
HSP90B1DVGTDEEETOVARY783p.E791delc.2362_2364delGAAIn_Frame_Del121.79COV504N200N
HSP90B1DVGTDEEETOVARY783p.E791delc.2362_2364delGAAIn_Frame_Del121.79JHOC5N200N
HSP90B1DVGTDEEETOVARY783p.E791delc.2362_2364delGAAIn_Frame_Del121.79JHOM1N200N
HSP90B1DVGTDEEETOVARY783p.E791delc.2362_2364delGAAIn_Frame_Del121.79JHOS4N200N
HSP90B1DVGTDEEETOVARY783p.E791delc.2362_2364delGAAIn_Frame_Del121.79OV90N200N
HSP90B1DVGTDEEETOVARY783p.E791delc.2362_2364delGAAIn_Frame_Del121.79OVISEN200N
HSP90B1DVGTDEEETOVARY783p.E791delc.2362_2364delGAAIn_Frame_Del121.79OVK18N200N
HSP90B1DVGTDEEETOVARY783p.E791delc.2362_2364delGAAIn_Frame_Del121.79OVKATEN200N
HSP90B1DVGTDEEETOVARY783p.E791delc.2362_2364delGAAIn_Frame_Del121.79OVSAHON200N
HSP90B1DVGTDEEETOVARY783p.E791delc.2362_2364delGAAIn_Frame_Del121.79OVTOKON200N
HSP90B1DVGTDEEETOVARY783p.E791delc.2362_2364delGAAIn_Frame_Del121.79TYKNUN200N
HSP90B1GTDEEETAKOVARY785p.E791delc.2362_2364delGAAIn_Frame_Del321.79COV504N400N
HSP90B1GTDEEETAKOVARY785p.E791delc.2362_2364delGAAIn_Frame_Del321.79JHOC5N400N
HSP90B1GTDEEETAKOVARY785p.E791delc.2362_2364delGAAIn_Frame_Del321.79JHOM1N400N
HSP90B1GTDEEETAKOVARY785p.E791delc.2362_2364delGAAIn_Frame_Del321.79JHOS4N400N
HSP90B1GTDEEETAKOVARY785p.E791delc.2362_2364delGAAIn_Frame_Del321.79OV90N400N
HSP90B1GTDEEETAKOVARY785p.E791delc.2362_2364delGAAIn_Frame_Del321.79OVISEN400N
HSP90B1GTDEEETAKOVARY785p.E791delc.2362_2364delGAAIn_Frame_Del321.79OVK18N400N
HSP90B1GTDEEETAKOVARY785p.E791delc.2362_2364delGAAIn_Frame_Del321.79OVKATEN400N
HSP90B1GTDEEETAKOVARY785p.E791delc.2362_2364delGAAIn_Frame_Del321.79OVSAHON400N
HSP90B1GTDEEETAKOVARY785p.E791delc.2362_2364delGAAIn_Frame_Del321.79OVTOKON400N
HSP90B1GTDEEETAKOVARY785p.E791delc.2362_2364delGAAIn_Frame_Del321.79TYKNUN400N
HSP90B1TDEEETAKEOVARY786p.E791delc.2362_2364delGAAIn_Frame_Del221.79COV504N000N
HSP90B1TDEEETAKEOVARY786p.E791delc.2362_2364delGAAIn_Frame_Del221.79JHOC5N000N
HSP90B1TDEEETAKEOVARY786p.E791delc.2362_2364delGAAIn_Frame_Del221.79JHOM1N000N
HSP90B1TDEEETAKEOVARY786p.E791delc.2362_2364delGAAIn_Frame_Del221.79JHOS4N000N
HSP90B1TDEEETAKEOVARY786p.E791delc.2362_2364delGAAIn_Frame_Del221.79OV90N000N
HSP90B1TDEEETAKEOVARY786p.E791delc.2362_2364delGAAIn_Frame_Del221.79OVISEN000N
HSP90B1TDEEETAKEOVARY786p.E791delc.2362_2364delGAAIn_Frame_Del221.79OVK18N000N
HSP90B1TDEEETAKEOVARY786p.E791delc.2362_2364delGAAIn_Frame_Del221.79OVKATEN000N
HSP90B1TDEEETAKEOVARY786p.E791delc.2362_2364delGAAIn_Frame_Del221.79OVSAHON000N
HSP90B1TDEEETAKEOVARY786p.E791delc.2362_2364delGAAIn_Frame_Del221.79OVTOKON000N
HSP90B1TDEEETAKEOVARY786p.E791delc.2362_2364delGAAIn_Frame_Del221.79TYKNUN000N
HSP90B1VGTDEEETAOVARY784p.E791delc.2362_2364delGAAIn_Frame_Del221.79COV504N100N
HSP90B1VGTDEEETAOVARY784p.E791delc.2362_2364delGAAIn_Frame_Del221.79JHOC5N100N
HSP90B1VGTDEEETAOVARY784p.E791delc.2362_2364delGAAIn_Frame_Del221.79JHOM1N100N
HSP90B1VGTDEEETAOVARY784p.E791delc.2362_2364delGAAIn_Frame_Del221.79JHOS4N100N
HSP90B1VGTDEEETAOVARY784p.E791delc.2362_2364delGAAIn_Frame_Del221.79OV90N100N
HSP90B1VGTDEEETAOVARY784p.E791delc.2362_2364delGAAIn_Frame_Del221.79OVISEN100N
HSP90B1VGTDEEETAOVARY784p.E791delc.2362_2364delGAAIn_Frame_Del221.79OVK18N100N
HSP90B1VGTDEEETAOVARY784p.E791delc.2362_2364delGAAIn_Frame_Del221.79OVKATEN100N
HSP90B1VGTDEEETAOVARY784p.E791delc.2362_2364delGAAIn_Frame_Del221.79OVSAHON100N
HSP90B1VGTDEEETAOVARY784p.E791delc.2362_2364delGAAIn_Frame_Del221.79OVTOKON100N
HSP90B1VGTDEEETAOVARY784p.E791delc.2362_2364delGAAIn_Frame_Del221.79TYKNUN100N
JAK2DPVLQVHLYOVARY36p.Y42Hc.124T>CMissense_Mutation10.11OVK18Y12120N
JAK2HLYHSLGKSOVARY42p.Y42Hc.124T>CMissense_Mutation10.11OVK18N000N
JAK2IDPVLQVHLOVARY35p.Y42Hc.124T>CMissense_Mutation10.11OVK18Y11100N
JAK2LQVHLYHSLOVARY39p.Y42Hc.124T>CMissense_Mutation10.11OVK18N1705N
JAK2PVLQVHLYHOVARY37p.Y42Hc.124T>CMissense_Mutation10.11OVK18N000N
JAK2QIDPVLQVHOVARY34p.Y42Hc.124T>CMissense_Mutation10.11OVK18N100N
JAK2QVHLYHSLGOVARY40p.Y42Hc.124T>CMissense_Mutation10.11OVK18N000N
JAK2VHLYHSLGKOVARY41p.Y42Hc.124T>CMissense_Mutation10.11OVK18N0021N
JAK2VLQVHLYHSOVARY38p.Y42Hc.124T>CMissense_Mutation10.11OVK18N000N
KITEPPPPSIHPOVARY33p.S35Pc.103T>CMissense_Mutation10.11SNU119N000N
KITGEPPPPSIHOVARY32p.S35Pc.103T>CMissense_Mutation10.11SNU119N100N
KITPGEPPPPSIOVARY31p.S35Pc.103T>CMissense_Mutation10.11SNU119N200N
KITPPPPSIHPGOVARY34p.S35Pc.103T>CMissense_Mutation10.11SNU119N000N
KITPPPSIHPGKOVARY35p.S35Pc.103T>CMissense_Mutation10.11SNU119N000Y
KITPSVSPGEPPOVARY27p.S35Pc.103T>CMissense_Mutation10.11SNU119N000N
KITSPGEPPPPSOVARY30p.S35Pc.103T>CMissense_Mutation10.11SNU119N300N
KITSVSPGEPPPOVARY28p.S35Pc.103T>CMissense_Mutation10.11SNU119N000Y
KITVSPGEPPPPOVARY29p.S35Pc.103T>CMissense_Mutation10.11SNU119N000Y
MAML2GGGSVTLRVOVARY24p.P30Lc.89C>TMissense_Mutation10.11TOV21GN600N
MAML2GGSVTLRVHOVARY25p.P30Lc.89C>TMissense_Mutation10.11TOV21GN000N
MAML2GSVTLRVHSOVARY26p.P30Lc.89C>TMissense_Mutation10.11TOV21GN000N
MAML2LGGGSVTLROVARY23p.P30Lc.89C>TMissense_Mutation10.11TOV21GN100N
MAML2LLGGGSVTLOVARY22p.P30Lc.89C>TMissense_Mutation10.11TOV21GN1103N
MAML2LRVHSAIVEOVARY30p.P30Lc.89C>TMissense_Mutation10.11TOV21GN1018N
MAML2LSTQMLPNLOVARY1054p.I1058Mc.3174T>GMissense_Mutation10.11EFO21N1000N
MAML2MLPNLNQSGOVARY1058p.I1058Mc.3174T>GMissense_Mutation10.11EFO21N003N
MAML2NQLSTQMLPOVARY1052p.I1058Mc.3174T>GMissense_Mutation10.11EFO21N000N
MAML2PNQLSTQMLOVARY1051p.I1058Mc.3174T>GMissense_Mutation10.11EFO21N000Y
MAML2QLSTQMLPNOVARY1053p.I1058Mc.3174T>GMissense_Mutation10.11EFO21N000N
MAML2QMLPNLNQSOVARY1057p.I1058Mc.3174T>GMissense_Mutation10.11EFO21N200N
MAML2RPNQLSTQMOVARY1050p.I1058Mc.3174T>GMissense_Mutation10.11EFO21N1100Y
MAML2STQMLPNLNOVARY1055p.I1058Mc.3174T>GMissense_Mutation10.11EFO21N000N
MAML2SVTLRVHSAOVARY27p.P30Lc.89C>TMissense_Mutation10.11TOV21GY190N
MAML2TLRVHSAIVOVARY29p.P30Lc.89C>TMissense_Mutation10.11TOV21GY4100N
MAML2TQMLPNLNQOVARY1056p.I1058Mc.3174T>GMissense_Mutation10.11EFO21N000N
MAML2VTLRVHSAIOVARY28p.P30Lc.89C>TMissense_Mutation10.11TOV21GN1102N
MAML2QQQQQQRQQOVARY613p.Q619Rc.1856A>GMissense_Mutation10.22OVMANAN000Y
MAML2QQQQQQRQQOVARY613p.Q619Rc.1856A>GMissense_Mutation10.22OVSAHON000Y
MAML2QQQQQRQQSOVARY614p.Q619Rc.1856A>GMissense_Mutation10.22OVMANAN000Y
MAML2QQQQQRQQSOVARY614p.Q619Rc.1856A>GMissense_Mutation10.22OVSAHON000Y
MAML2QQQQRQQSSOVARY615p.Q619Rc.1856A>GMissense_Mutation10.22OVMANAN000Y
MAML2QQQQRQQSSOVARY615p.Q619Rc.1856A>GMissense_Mutation10.22OVSAHON000Y
MAML2QQQRQQSSIOVARY616p.Q619Rc.1856A>GMissense_Mutation10.22OVMANAN600Y
MAML2QQQRQQSSIOVARY616p.Q619Rc.1856A>GMissense_Mutation10.22OVSAHON600Y
MAML2QQRQQSSISOVARY617p.Q619Rc.1856A>GMissense_Mutation10.22OVMANAN100Y
MAML2QQRQQSSISOVARY617p.Q619Rc.1856A>GMissense_Mutation10.22OVSAHON100Y
MAML2QRQQSSISAOVARY618p.Q619Rc.1856A>GMissense_Mutation10.22OVMANAN200N
MAML2QRQQSSISAOVARY618p.Q619Rc.1856A>GMissense_Mutation10.22OVSAHON200N
MAML2RQQSSISAQOVARY619p.Q619Rc.1856A>GMissense_Mutation10.22OVMANAN000N
MAML2RQQSSISAQOVARY619p.Q619Rc.1856A>GMissense_Mutation10.22OVSAHON000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.4459MN000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44A2780N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44CAOV3N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44CAOV4N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44COV318N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44COV362N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44COV434N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44COV504N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44COV644N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44EFO21N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44EFO27N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44ES2N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44FUOV1N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HEYA8N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HS571TN000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44IGROV1N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44JHOC5N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44JHOM1N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44JHOM2BN000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KURAMOCHIN000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44NIHOVCAR3N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44OAW28N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44OAW42N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44OC316N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44ONCODG1N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44OV56N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44OV90N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44OVCAR4N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44OVCAR8N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44OVISEN000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44RMGIN000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SKOV3N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SNU840N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SNU8N000N
MAP3K1STTTTTTTEOVARY941p.T949delc.2822_2824delCAAIn_Frame_Del176.44TOV21GN000N
MAP3K1DVSKHRLHGOVARY1000p.Q1007Hc.3021G>TMissense_Mutation10.11OC316N000N
MAP3K1EMENKETLQOVARY163p.K171Qc.511A>CMissense_Mutation10.11MCASN100Y
MAP3K1ENKETLQGLOVARY165p.K171Qc.511A>CMissense_Mutation10.11MCASY6180N
MAP3K1ETLQGLHKMOVARY168p.K171Qc.511A>CMissense_Mutation10.11MCASN400N
MAP3K1HGFIPCRIPOVARY1007p.Q1007Hc.3021G>TMissense_Mutation10.11OC316N000N
MAP3K1HRLHGFIPCOVARY1004p.Q1007Hc.3021G>TMissense_Mutation10.11OC316N500N
MAP3K1KETLQGLHKOVARY167p.K171Qc.511A>CMissense_Mutation10.11MCASN200N
MAP3K1KHRLHGFIPOVARY1003p.Q1007Hc.3021G>TMissense_Mutation10.11OC316N100N
MAP3K1LHGFIPCRIOVARY1006p.Q1007Hc.3021G>TMissense_Mutation10.11OC316N5013N
MAP3K1LQGLHKMDDOVARY170p.K171Qc.511A>CMissense_Mutation10.11MCASN0014Y
MAP3K1MENKETLQGOVARY164p.K171Qc.511A>CMissense_Mutation10.11MCASN0011N
MAP3K1NKETLQGLHOVARY166p.K171Qc.511A>CMissense_Mutation10.11MCASN100N
MAP3K1QGLHKMDDROVARY171p.K171Qc.511A>CMissense_Mutation10.11MCASN100Y
MAP3K1RLHGFIPCROVARY1005p.Q1007Hc.3021G>TMissense_Mutation10.11OC316Y890N
MAP3K1SKHRLHGFIOVARY1002p.Q1007Hc.3021G>TMissense_Mutation10.11OC316N300N
MAP3K1TDVSKHRLHOVARY999p.Q1007Hc.3021G>TMissense_Mutation10.11OC316N100N
MAP3K1TLQGLHKMDOVARY169p.K171Qc.511A>CMissense_Mutation10.11MCASN000N
MAP3K1VSKHRLHGFOVARY1001p.Q1007Hc.3021G>TMissense_Mutation10.11OC316Y893N
MAP3K4FVYKALKQMOVARY529p.D531Yc.1591G>TMissense_Mutation10.11RMGIN10022N
MAP3K4IYRPFVYKAOVARY525p.D531Yc.1591G>TMissense_Mutation10.11RMGIY5101N
MAP3K4PFVYKALKQOVARY528p.D531Yc.1591G>TMissense_Mutation10.11RMGIN000N
MAP3K4RPFVYKALKOVARY527p.D531Yc.1591G>TMissense_Mutation10.11RMGIN700N
MAP3K4SIYRPFVYKOVARY524p.D531Yc.1591G>TMissense_Mutation10.11RMGIY4110N
MAP3K4TSIYRPFVYOVARY523p.D531Yc.1591G>TMissense_Mutation10.11RMGIN500N
MAP3K4VYKALKQMGOVARY530p.D531Yc.1591G>TMissense_Mutation10.11RMGIN000N
MAP3K4YKALKQMGLOVARY531p.D531Yc.1591G>TMissense_Mutation10.11RMGIN709N
MAP3K4YRPFVYKALOVARY526p.D531Yc.1591G>TMissense_Mutation10.11RMGIY13108N
MEN1DVHLTLSEDOVARY177p.A181Tc.541G>AMissense_Mutation10.22COLO704N000N
MEN1GLRDVHLTLOVARY174p.A181Tc.541G>AMissense_Mutation10.22COLO704Y12120N
MEN1HLTLSEDHAOVARY179p.A181Tc.541G>AMissense_Mutation10.22COLO704N100N
MEN1LGLRDVHLTOVARY173p.A181Tc.541G>AMissense_Mutation10.22COLO704N1014N
MEN1LRDVHLTLSOVARY175p.A181Tc.541G>AMissense_Mutation10.22COLO704N300N
MEN1LTLSEDHAWOVARY180p.A181Tc.541G>AMissense_Mutation10.22COLO704N300N
MEN1RDVHLTLSEOVARY176p.A181Tc.541G>AMissense_Mutation10.22COLO704N000N
MEN1TLSEDHAWVOVARY181p.A181Tc.541G>AMissense_Mutation10.22COLO704Y5100N
MEN1VHLTLSEDHOVARY178p.A181Tc.541G>AMissense_Mutation10.22COLO704N002N
METDHPWHSISVOVARY208p.L211Wc.632T>GMissense_Mutation10.33JHOC5N400N
METFPDHPWHSIOVARY206p.L211Wc.632T>GMissense_Mutation10.33JHOC5Y13110N
METHPWHSISVROVARY209p.L211Wc.632T>GMissense_Mutation10.33JHOC5N700N
METPDHPWHSISOVARY207p.L211Wc.632T>GMissense_Mutation10.33JHOC5N000N
METPWHSISVRROVARY210p.L211Wc.632T>GMissense_Mutation10.33JHOC5N000N
METSSYFPDHPWOVARY203p.L211Wc.632T>GMissense_Mutation10.33JHOC5N700N
METSYFPDHPWHOVARY204p.L211Wc.632T>GMissense_Mutation10.33JHOC5N000N
METWHSISVRRLOVARY211p.L211Wc.632T>GMissense_Mutation10.33JHOC5Y61016N
METYFPDHPWHSOVARY205p.L211Wc.632T>GMissense_Mutation10.33JHOC5N2012N
MLH1RRIINLTVFOVARY498p.S505fsc.1513_1513delAFrame_Shift_Del20.11IGROV1N800N
MLH1RRRIINLTVOVARY497p.S505fsc.1513_1513delAFrame_Shift_Del10.11IGROV1N300N
MLH1AVSREMIEIOVARY223p.L228Mc.682C>AMissense_Mutation10.11HEYA8Y4120N
MLH1EMIEIGCEDOVARY227p.L228Mc.682C>AMissense_Mutation10.11HEYA8N000N
MLH1FGNAVSREMOVARY220p.L228Mc.682C>AMissense_Mutation10.11HEYA8N8010N
MLH1GNAVSREMIOVARY221p.L228Mc.682C>AMissense_Mutation10.11HEYA8Y3150N
MLH1MIEIGCEDKOVARY228p.L228Mc.682C>AMissense_Mutation10.11HEYA8N300N
MLH1NAVSREMIEOVARY222p.L228Mc.682C>AMissense_Mutation10.11HEYA8N000N
MLH1REMIEIGCEOVARY226p.L228Mc.682C>AMissense_Mutation10.11HEYA8N100N
MLH1SREMIEIGCOVARY225p.L228Mc.682C>AMissense_Mutation10.11HEYA8N200N
MLH1VSREMIEIGOVARY224p.L228Mc.682C>AMissense_Mutation10.11HEYA8N000N
MLL3GTRKQNSGSOVARY2797p.K2797fsc.8389_8390delAAFrame_Shift_Del41.11IGROV1N000Y
MLL3KGTRKQNSGOVARY2796p.K2797fsc.8389_8390delAAFrame_Shift_Del51.11IGROV1N000N
MLL3KKGTRKQNSOVARY2795p.K2797fsc.8389_8390delAAFrame_Shift_Del41.11IGROV1N100N
MLL3TRKQNSGSLOVARY2798p.K2797fsc.8389_8390delAAFrame_Shift_Del41.11IGROV1N500Y
MLL3CVSVEPKKGOVARY2789p.K2797fsc.8389_8390delAAFrame_Shift_Del10.33IGROV1N000N
MLL3EPKKGTRKQOVARY2793p.K2797fsc.8389_8390delAAFrame_Shift_Del40.33IGROV1N000Y
MLL3PKKGTRKQNOVARY2794p.K2797fsc.8389_8390delAAFrame_Shift_Del40.33IGROV1N000Y
MLL3SVEPKKGTROVARY2791p.K2797fsc.8389_8390delAAFrame_Shift_Del30.33IGROV1N600N
MLL3VEPKKGTRKOVARY2792p.K2797fsc.8389_8390delAAFrame_Shift_Del40.33IGROV1N100Y
MLL3VSVEPKKGTOVARY2790p.K2797fsc.8389_8390delAAFrame_Shift_Del20.33IGROV1N100N
MLL3AIKAQCMFLOVARY4488p.F4496fsc.13488_13488delTFrame_Shift_Del10.55OVK18Y4100N
MLL3APCTNQREFOVARY4503p.F4496fsc.13488_13488delTFrame_Shift_Del40.55OVK18Y12100N
MLL3AQCMFLRTKOVARY4491p.F4496fsc.13488_13488delTFrame_Shift_Del30.55OVK18Y1130N
MLL3CFAPCTNQROVARY4501p.F4496fsc.13488_13488delTFrame_Shift_Del40.55OVK18Y290N
MLL3CMFLRTKLCOVARY4493p.F4496fsc.13488_13488delTFrame_Shift_Del50.55OVK18N200N
MLL3CTNQREFMSOVARY4505p.F4496fsc.13488_13488delTFrame_Shift_Del50.55OVK18N000Y
MLL3FAPCTNQREOVARY4502p.F4496fsc.13488_13488delTFrame_Shift_Del40.55OVK18N201N
MLL3FLRTKLCFAOVARY4495p.F4496fsc.13488_13488delTFrame_Shift_Del50.55OVK18N802N
MLL3IKAQCMFLROVARY4489p.F4496fsc.13488_13488delTFrame_Shift_Del20.55OVK18N100N
MLL3KAQCMFLRTOVARY4490p.F4496fsc.13488_13488delTFrame_Shift_Del30.55OVK18N400N
MLL3KLCFAPCTNOVARY4499p.F4496fsc.13488_13488delTFrame_Shift_Del50.55OVK18N000N
MLL3LCFAPCTNQOVARY4500p.F4496fsc.13488_13488delTFrame_Shift_Del40.55OVK18N001N
MLL3LRTKLCFAPOVARY4496p.F4496fsc.13488_13488delTFrame_Shift_Del50.55OVK18N1015N
MLL3MFLRTKLCFOVARY4494p.F4496fsc.13488_13488delTFrame_Shift_Del60.55OVK18N6026N
MLL3NQREFMSKNOVARY4507p.F4496fsc.13488_13488delTFrame_Shift_Del50.55OVK18N100N
MLL3PCTNQREFMOVARY4504p.F4496fsc.13488_13488delTFrame_Shift_Del40.55OVK18N000N
MLL3QCMFLRTKLOVARY4492p.F4496fsc.13488_13488delTFrame_Shift_Del40.55OVK18N900N
MLL3RTKLCFAPCOVARY4497p.F4496fsc.13488_13488delTFrame_Shift_Del50.55OVK18Y290N
MLL3TKLCFAPCTOVARY4498p.F4496fsc.13488_13488delTFrame_Shift_Del50.55OVK18N100N
MLL3TNQREFMSKOVARY4506p.F4496fsc.13488_13488delTFrame_Shift_Del50.55OVK18N000N
MLL3ACENYTFQYOVARY4683p.R4690Qc.14069G>AMissense_Mutation10.11OC316N300N
MLL3AESATLRPQOVARY4188p.A4192Tc.12574G>AMissense_Mutation10.11OC316N000N
MLL3AFFPVGYEAOVARY4574p.L4575Fc.13723C>TMissense_Mutation10.11TYKNUY290N
MLL3AFHSPKAFFOVARY4568p.L4575Fc.13723C>TMissense_Mutation10.11TYKNUY590N
MLL3ASDDQDGKLOVARY216p.A221Dc.662C>AMissense_Mutation10.11RMGIN800N
MLL3ATLRPQWCCOVARY4191p.A4192Tc.12574G>AMissense_Mutation10.11OC316Y1100N
MLL3CENYTFQYGOVARY4684p.R4690Qc.14069G>AMissense_Mutation10.11OC316N000Y
MLL3DDQDGKLWDOVARY218p.A221Dc.662C>AMissense_Mutation10.11RMGIN000N
MLL3DGKLWDELSOVARY221p.A221Dc.662C>AMissense_Mutation10.11RMGIN000N
MLL3DLWVHLNYAOVARY4425p.C4432Yc.13295G>AMissense_Mutation10.11OC316N500N
MLL3DQDGKLWDEOVARY219p.A221Dc.662C>AMissense_Mutation10.11RMGIN000N
MLL3EACENYTFQOVARY4682p.R4690Qc.14069G>AMissense_Mutation10.11OC316N000N
MLL3ENYTFQYGROVARY4685p.R4690Qc.14069G>AMissense_Mutation10.11OC316N200N
MLL3ESATLRPQWOVARY4189p.A4192Tc.12574G>AMissense_Mutation10.11OC316N300N
MLL3FFPVGYEASOVARY4575p.L4575Fc.13723C>TMissense_Mutation10.11TYKNUN400N
MLL3FHSPKAFFPOVARY4569p.L4575Fc.13723C>TMissense_Mutation10.11TYKNUN200N
MLL3FQYGRNPLMOVARY4689p.R4690Qc.14069G>AMissense_Mutation10.11OC316N1403N
MLL3FRRVYVQHDOVARY4522p.R4529Hc.13586G>AMissense_Mutation10.11OC316N3019N
MLL3GIAESATLROVARY4186p.A4192Tc.12574G>AMissense_Mutation10.11OC316Y6100N
MLL3HDEVRQIASOVARY4529p.R4529Hc.13586G>AMissense_Mutation10.11OC316N100N
MLL3HGIAESATLOVARY4185p.A4192Tc.12574G>AMissense_Mutation10.11OC316N1300N
MLL3HLNYALWSTOVARY4429p.C4432Yc.13295G>AMissense_Mutation10.11OC316N400N
MLL3HSPKAFFPVOVARY4570p.L4575Fc.13723C>TMissense_Mutation10.11TYKNUY590N
MLL3IAESATLRPOVARY4187p.A4192Tc.12574G>AMissense_Mutation10.11OC316N000N
MLL3ISVTPKTGMOVARY817p.I823Tc.2468T>CMissense_Mutation10.11OVK18N800N
MLL3KAFFPVGYEOVARY4573p.L4575Fc.13723C>TMissense_Mutation10.11TYKNUN000N
MLL3KTGMGKPAIOVARY822p.I823Tc.2468T>CMissense_Mutation10.11OVK18Y3140N
MLL3LDLWVHLNYOVARY4424p.C4432Yc.13295G>AMissense_Mutation10.11OC316N500N
MLL3LNYALWSTEOVARY4430p.C4432Yc.13295G>AMissense_Mutation10.11OC316N000N
MLL3LWVHLNYALOVARY4426p.C4432Yc.13295G>AMissense_Mutation10.11OC316N904N
MLL3NYALWSTEVOVARY4431p.C4432Yc.13295G>AMissense_Mutation10.11OC316Y2110N
MLL3NYTFQYGRNOVARY4686p.R4690Qc.14069G>AMissense_Mutation10.11OC316N000N
MLL3PKAFFPVGYOVARY4572p.L4575Fc.13723C>TMissense_Mutation10.11TYKNUN100Y
MLL3PKTGMGKPAOVARY821p.I823Tc.2468T>CMissense_Mutation10.11OVK18N000N
MLL3QAFHSPKAFOVARY4567p.L4575Fc.13723C>TMissense_Mutation10.11TYKNUN800N
MLL3QDGKLWDELOVARY220p.A221Dc.662C>AMissense_Mutation10.11RMGIN600N
MLL3QHDEVRQIAOVARY4528p.R4529Hc.13586G>AMissense_Mutation10.11OC316N200N
MLL3QTASDDQDGOVARY214p.A221Dc.662C>AMissense_Mutation10.11RMGIN000N
MLL3QYGRNPLMEOVARY4690p.R4690Qc.14069G>AMissense_Mutation10.11OC316N000N
MLL3RRVYVQHDEOVARY4523p.R4529Hc.13586G>AMissense_Mutation10.11OC316N200N
MLL3RVYVQHDEVOVARY4524p.R4529Hc.13586G>AMissense_Mutation10.11OC316Y8130N
MLL3SATLRPQWCOVARY4190p.A4192Tc.12574G>AMissense_Mutation10.11OC316N300N
MLL3SDDQDGKLWOVARY217p.A221Dc.662C>AMissense_Mutation10.11RMGIN400N
MLL3SHGIAESATOVARY4184p.A4192Tc.12574G>AMissense_Mutation10.11OC316N100N
MLL3SPKAFFPVGOVARY4571p.L4575Fc.13723C>TMissense_Mutation10.11TYKNUN000N
MLL3SVTPKTGMGOVARY818p.I823Tc.2468T>CMissense_Mutation10.11OVK18N000N
MLL3TASDDQDGKOVARY215p.A221Dc.662C>AMissense_Mutation10.11RMGIN100N
MLL3TFQYGRNPLOVARY4688p.R4690Qc.14069G>AMissense_Mutation10.11OC316N700N
MLL3TGMGKPAITOVARY823p.I823Tc.2468T>CMissense_Mutation10.11OVK18N100N
MLL3TLRPQWCCHOVARY4192p.A4192Tc.12574G>AMissense_Mutation10.11OC316N000N
MLL3TPKTGMGKPOVARY820p.I823Tc.2468T>CMissense_Mutation10.11OVK18N000N
MLL3TQTASDDQDOVARY213p.A221Dc.662C>AMissense_Mutation10.11RMGIN000N
MLL3TYISVTPKTOVARY815p.I823Tc.2468T>CMissense_Mutation10.11OVK18N300N
MLL3VFRRVYVQHOVARY4521p.R4529Hc.13586G>AMissense_Mutation10.11OC316N001N
MLL3VHLNYALWSOVARY4428p.C4432Yc.13295G>AMissense_Mutation10.11OC316N1038N
MLL3VQHDEVRQIOVARY4527p.R4529Hc.13586G>AMissense_Mutation10.11OC316N7014N
MLL3VTPKTGMGKOVARY819p.I823Tc.2468T>CMissense_Mutation10.11OVK18N300N
MLL3VYVQHDEVROVARY4525p.R4529Hc.13586G>AMissense_Mutation10.11OC316N200N
MLL3WVHLNYALWOVARY4427p.C4432Yc.13295G>AMissense_Mutation10.11OC316Y5101N
MLL3YALWSTEVYOVARY4432p.C4432Yc.13295G>AMissense_Mutation10.11OC316N901N
MLL3YISVTPKTGOVARY816p.I823Tc.2468T>CMissense_Mutation10.11OVK18N205N
MLL3YTFQYGRNPOVARY4687p.R4690Qc.14069G>AMissense_Mutation10.11OC316N200N
MLL3YVQHDEVRQOVARY4526p.R4529Hc.13586G>AMissense_Mutation10.11OC316N102N
MSH2KASPGNLSVOVARY122p.N127fsc.381_382delTCFrame_Shift_Del10.11EFO27N600N
MSH2ALIQIGPKEOVARY189p.L191delc.568_570delCTCIn_Frame_Del10.11OC316N000N
MSH2EALIQIGPKOVARY188p.L191delc.568_570delCTCIn_Frame_Del20.11OC316N100N
MSH2FSNLEALIQOVARY184p.L191delc.568_570delCTCIn_Frame_Del20.11OC316N2017N
MSH2LEALIQIGPOVARY187p.L191delc.568_570delCTCIn_Frame_Del30.11OC316N000N
MSH2NLEALIQIGOVARY186p.L191delc.568_570delCTCIn_Frame_Del40.11OC316N100N
MSH2QFSNLEALIOVARY183p.L191delc.568_570delCTCIn_Frame_Del10.11OC316N400N
MSH2SNLEALIQIOVARY185p.L191delc.568_570delCTCIn_Frame_Del30.11OC316Y7100N
MSH2AQFGYYFPVOVARY517p.R524Pc.1571G>CMissense_Mutation10.22OC316Y13110Y
MSH2FGYYFPVTCOVARY519p.R524Pc.1571G>CMissense_Mutation10.22OC316N7012N
MSH2FPVTCKEEKOVARY523p.R524Pc.1571G>CMissense_Mutation10.22OC316N500N
MSH2GYYFPVTCKOVARY520p.R524Pc.1571G>CMissense_Mutation10.22OC316Y3110N
MSH2PVTCKEEKVOVARY524p.R524Pc.1571G>CMissense_Mutation10.22OC316N