Cancertope

In silico Platform for designing genome-based
Personalized immunotherapy or Vaccine against Cancer

Browse Results ...


The result page of search shows exclusive peptide/epitopes generated due to mutation [Neoepitope], the tissue of origin [Tissue], position of peptide in protein [Position], number of mismatches counted by aligning mutated and normal protein sequence [Num Mismatch, percentage of cell lines with this peptide over total number of cell lines [Promiscuity %]. The immune information include CTL epitopes (Yes/No), MHC I binders, MHC II binders (both given as number of alleles) and B cell epitopes (Yes/No). For more information, please click HERE


Result Reset Search:
ProteinNeoepitopesTissuePositionProt MutationcDNA MutationMutation TypeNum MismatchPromiscuity (%)Cell LineCTLMHC INHLApredMHC IIBcell
ABL1AGVSNGALRURINARY_TRACT685p.P688Sc.2062C>TMissense_Mutation10.11JMSU1N200N
ABL1DGLITTLHHURINARY_TRACT226p.Y234Hc.700T>CMissense_Mutation10.11639VN000N
ABL1GAGVSNGALURINARY_TRACT684p.P688Sc.2062C>TMissense_Mutation10.11JMSU1N900N
ABL1GLITTLHHPURINARY_TRACT227p.Y234Hc.700T>CMissense_Mutation10.11639VN000N
ABL1GVSNGALREURINARY_TRACT686p.P688Sc.2062C>TMissense_Mutation10.11JMSU1N000N
ABL1HHPAPKRNKURINARY_TRACT233p.Y234Hc.700T>CMissense_Mutation10.11639VN000Y
ABL1HPAPKRNKPURINARY_TRACT234p.Y234Hc.700T>CMissense_Mutation10.11639VN100Y
ABL1ITTLHHPAPURINARY_TRACT229p.Y234Hc.700T>CMissense_Mutation10.11639VN000N
ABL1KPSNGAGVSURINARY_TRACT680p.P688Sc.2062C>TMissense_Mutation10.11JMSU1N300N
ABL1LHHPAPKRNURINARY_TRACT232p.Y234Hc.700T>CMissense_Mutation10.11639VN100Y
ABL1LITTLHHPAURINARY_TRACT228p.Y234Hc.700T>CMissense_Mutation10.11639VN300N
ABL1NGAGVSNGAURINARY_TRACT683p.P688Sc.2062C>TMissense_Mutation10.11JMSU1N000N
ABL1PSNGAGVSNURINARY_TRACT681p.P688Sc.2062C>TMissense_Mutation10.11JMSU1N000N
ABL1SNGAGVSNGURINARY_TRACT682p.P688Sc.2062C>TMissense_Mutation10.11JMSU1N000N
ABL1SNGALRESGURINARY_TRACT688p.P688Sc.2062C>TMissense_Mutation10.11JMSU1N000N
ABL1TLHHPAPKRURINARY_TRACT231p.Y234Hc.700T>CMissense_Mutation10.11639VY5100Y
ABL1TTLHHPAPKURINARY_TRACT230p.Y234Hc.700T>CMissense_Mutation10.11639VN300N
ABL1VSNGALRESURINARY_TRACT687p.P688Sc.2062C>TMissense_Mutation10.11JMSU1N000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86253JN000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.865637N000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86647VN000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86ACCSN000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAL29N000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS172TN000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HT1376N000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86J82N000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JMSU1N000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KMBC2N000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KU1919N000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86RT11284N000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86RT112N000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86RT4N000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SCABERN000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SW1710N000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SW780N000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86UBLC1N000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86UMUC1N000N
AKAP12AIEEDLEPEURINARY_TRACT1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86VMCUB1N000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86253JN000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.865637N000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86647VN000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86ACCSN000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAL29N000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS172TN000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HT1376N000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86J82N000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JMSU1N000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KMBC2N000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KU1919N000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86RT11284N000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86RT112N000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86RT4N000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SCABERN000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SW1710N000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SW780N000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86UBLC1N000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86UMUC1N000N
AKAP12EEDLEPENGURINARY_TRACT1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86VMCUB1N000N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86253JN200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.865637N200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86647VN200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86ACCSN200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAL29N200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS172TN200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HT1376N200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86J82N200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JMSU1N200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KMBC2N200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KU1919N200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86RT11284N200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86RT112N200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86RT4N200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SCABERN200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SW1710N200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SW780N200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86UBLC1N200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86UMUC1N200N
AKAP12IEEDLEPENURINARY_TRACT1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86VMCUB1N200N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86253JN000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.865637N000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86647VN000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86ACCSN000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAL29N000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS172TN000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HT1376N000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86J82N000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JMSU1N000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KMBC2N000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KU1919N000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86RT11284N000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86RT112N000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86RT4N000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SCABERN000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SW1710N000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SW780N000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86UBLC1N000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86UMUC1N000N
AKAP12KVSVAIEEDURINARY_TRACT1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86VMCUB1N000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86253JN000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.865637N000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86647VN000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86ACCSN000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAL29N000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS172TN000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HT1376N000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86J82N000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JMSU1N000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KMBC2N000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KU1919N000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86RT11284N000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86RT112N000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86RT4N000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SCABERN000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SW1710N000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SW780N000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86UBLC1N000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86UMUC1N000N
AKAP12SVAIEEDLEURINARY_TRACT1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86VMCUB1N000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86253JN000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.865637N000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86647VN000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86ACCSN000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAL29N000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS172TN000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HT1376N000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86J82N000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JMSU1N000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KMBC2N000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KU1919N000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86RT11284N000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86RT112N000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86RT4N000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SCABERN000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SW1710N000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SW780N000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86UBLC1N000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86UMUC1N000N
AKAP12VAIEEDLEPURINARY_TRACT1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86VMCUB1N000N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86253JN002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.865637N002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86647VN002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86ACCSN002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAL29N002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS172TN002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HT1376N002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86J82N002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JMSU1N002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KMBC2N002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KU1919N002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86RT11284N002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86RT112N002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86RT4N002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SCABERN002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SW1710N002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SW780N002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86UBLC1N002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86UMUC1N002N
AKAP12VKVSVAIEEURINARY_TRACT1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86VMCUB1N002N
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86253JN1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.865637N1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86647VN1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86ACCSN1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAL29N1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS172TN1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HT1376N1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86J82N1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JMSU1N1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KMBC2N1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KU1919N1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86RT11284N1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86RT112N1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86RT4N1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SCABERN1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SW1710N1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SW780N1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86UBLC1N1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86UMUC1N1500Y
AKAP12VSVAIEEDLURINARY_TRACT1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86VMCUB1N1500Y
AKAP9DLEKTKQLEURINARY_TRACT1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27253JBVN000N
AKAP9DLEKTKQLEURINARY_TRACT1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27253JN000N
AKAP9DLEKTKQLEURINARY_TRACT1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS172TN000N
AKAP9DLEKTKQLEURINARY_TRACT1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HT1376N000N
AKAP9DLEKTKQLEURINARY_TRACT1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KU1919N000N
AKAP9DLEKTKQLEURINARY_TRACT1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27RT112N000N
AKAP9DLEKTKQLEURINARY_TRACT1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27RT4N000N
AKAP9DLEKTKQLEURINARY_TRACT1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SCABERN000N
AKAP9DLEKTKQLEURINARY_TRACT1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SW1710N000N
AKAP9DLEKTKQLEURINARY_TRACT1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27VMCUB1N000N
AKAP9EKTKQLEEQURINARY_TRACT1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27253JBVN000N
AKAP9EKTKQLEEQURINARY_TRACT1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27253JN000N
AKAP9EKTKQLEEQURINARY_TRACT1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS172TN000N
AKAP9EKTKQLEEQURINARY_TRACT1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HT1376N000N
AKAP9EKTKQLEEQURINARY_TRACT1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KU1919N000N
AKAP9EKTKQLEEQURINARY_TRACT1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27RT112N000N
AKAP9EKTKQLEEQURINARY_TRACT1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27RT4N000N
AKAP9EKTKQLEEQURINARY_TRACT1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SCABERN000N
AKAP9EKTKQLEEQURINARY_TRACT1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SW1710N000N
AKAP9EKTKQLEEQURINARY_TRACT1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27VMCUB1N000N
AKAP9KQLEEQVQEURINARY_TRACT1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27253JBVN000N
AKAP9KQLEEQVQEURINARY_TRACT1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27253JN000N
AKAP9KQLEEQVQEURINARY_TRACT1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS172TN000N
AKAP9KQLEEQVQEURINARY_TRACT1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HT1376N000N
AKAP9KQLEEQVQEURINARY_TRACT1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KU1919N000N
AKAP9KQLEEQVQEURINARY_TRACT1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27RT112N000N
AKAP9KQLEEQVQEURINARY_TRACT1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27RT4N000N
AKAP9KQLEEQVQEURINARY_TRACT1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SCABERN000N
AKAP9KQLEEQVQEURINARY_TRACT1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SW1710N000N
AKAP9KQLEEQVQEURINARY_TRACT1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27VMCUB1N000N
AKAP9KTKQLEEQVURINARY_TRACT1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27253JBVN200N
AKAP9KTKQLEEQVURINARY_TRACT1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27253JN200N
AKAP9KTKQLEEQVURINARY_TRACT1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HS172TN200N
AKAP9KTKQLEEQVURINARY_TRACT1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HT1376N200N
AKAP9KTKQLEEQVURINARY_TRACT1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27KU1919N200N
AKAP9KTKQLEEQVURINARY_TRACT1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27RT112N200N
AKAP9KTKQLEEQVURINARY_TRACT1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27RT4N200N
AKAP9KTKQLEEQVURINARY_TRACT1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SCABERN200N
AKAP9KTKQLEEQVURINARY_TRACT1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SW1710N200N
AKAP9KTKQLEEQVURINARY_TRACT1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27VMCUB1N200N
AKAP9LEKTKQLEEURINARY_TRACT1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27253JBVN000N
AKAP9LEKTKQLEEURINARY_TRACT1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27253JN000N
AKAP9LEKTKQLEEURINARY_TRACT1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS172TN000N
AKAP9LEKTKQLEEURINARY_TRACT1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HT1376N000N
AKAP9LEKTKQLEEURINARY_TRACT1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KU1919N000N
AKAP9LEKTKQLEEURINARY_TRACT1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27RT112N000N
AKAP9LEKTKQLEEURINARY_TRACT1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27RT4N000N
AKAP9LEKTKQLEEURINARY_TRACT1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SCABERN000N
AKAP9LEKTKQLEEURINARY_TRACT1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SW1710N000N
AKAP9LEKTKQLEEURINARY_TRACT1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27VMCUB1N000N
AKAP9LQDLEKTKQURINARY_TRACT1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27253JBVN000N
AKAP9LQDLEKTKQURINARY_TRACT1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27253JN000N
AKAP9LQDLEKTKQURINARY_TRACT1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS172TN000N
AKAP9LQDLEKTKQURINARY_TRACT1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HT1376N000N
AKAP9LQDLEKTKQURINARY_TRACT1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KU1919N000N
AKAP9LQDLEKTKQURINARY_TRACT1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27RT112N000N
AKAP9LQDLEKTKQURINARY_TRACT1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27RT4N000N
AKAP9LQDLEKTKQURINARY_TRACT1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SCABERN000N
AKAP9LQDLEKTKQURINARY_TRACT1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SW1710N000N
AKAP9LQDLEKTKQURINARY_TRACT1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27VMCUB1N000N
AKAP9QDLEKTKQLURINARY_TRACT1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27253JBVN900N
AKAP9QDLEKTKQLURINARY_TRACT1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27253JN900N
AKAP9QDLEKTKQLURINARY_TRACT1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS172TN900N
AKAP9QDLEKTKQLURINARY_TRACT1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HT1376N900N
AKAP9QDLEKTKQLURINARY_TRACT1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KU1919N900N
AKAP9QDLEKTKQLURINARY_TRACT1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27RT112N900N
AKAP9QDLEKTKQLURINARY_TRACT1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27RT4N900N
AKAP9QDLEKTKQLURINARY_TRACT1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SCABERN900N
AKAP9QDLEKTKQLURINARY_TRACT1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SW1710N900N
AKAP9QDLEKTKQLURINARY_TRACT1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27VMCUB1N900N
AKAP9QLEEQVQELURINARY_TRACT1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27253JBVN1200N
AKAP9QLEEQVQELURINARY_TRACT1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27253JN1200N
AKAP9QLEEQVQELURINARY_TRACT1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS172TN1200N
AKAP9QLEEQVQELURINARY_TRACT1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HT1376N1200N
AKAP9QLEEQVQELURINARY_TRACT1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KU1919N1200N
AKAP9QLEEQVQELURINARY_TRACT1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27RT112N1200N
AKAP9QLEEQVQELURINARY_TRACT1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27RT4N1200N
AKAP9QLEEQVQELURINARY_TRACT1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SCABERN1200N
AKAP9QLEEQVQELURINARY_TRACT1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SW1710N1200N
AKAP9QLEEQVQELURINARY_TRACT1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27VMCUB1N1200N
AKAP9TKQLEEQVQURINARY_TRACT1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27253JBVN000N
AKAP9TKQLEEQVQURINARY_TRACT1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27253JN000N
AKAP9TKQLEEQVQURINARY_TRACT1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS172TN000N
AKAP9TKQLEEQVQURINARY_TRACT1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HT1376N000N
AKAP9TKQLEEQVQURINARY_TRACT1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KU1919N000N
AKAP9TKQLEEQVQURINARY_TRACT1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27RT112N000N
AKAP9TKQLEEQVQURINARY_TRACT1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27RT4N000N
AKAP9TKQLEEQVQURINARY_TRACT1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SCABERN000N
AKAP9TKQLEEQVQURINARY_TRACT1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SW1710N000N
AKAP9TKQLEEQVQURINARY_TRACT1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27VMCUB1N000N
AKAP9EQLKETEQNURINARY_TRACT1352p.Q1352Ec.4054C>GMissense_Mutation10.11J82N000N
AKAP9ESLISSLQEURINARY_TRACT1344p.Q1352Ec.4054C>GMissense_Mutation10.11J82N000N
AKAP9ISSLQEQLKURINARY_TRACT1347p.Q1352Ec.4054C>GMissense_Mutation10.11J82N100N
AKAP9LISSLQEQLURINARY_TRACT1346p.Q1352Ec.4054C>GMissense_Mutation10.11J82N602N
AKAP9LQEQLKETEURINARY_TRACT1350p.Q1352Ec.4054C>GMissense_Mutation10.11J82N000N
AKAP9QEQLKETEQURINARY_TRACT1351p.Q1352Ec.4054C>GMissense_Mutation10.11J82N000N
AKAP9SLISSLQEQURINARY_TRACT1345p.Q1352Ec.4054C>GMissense_Mutation10.11J82N000N
AKAP9SLQEQLKETURINARY_TRACT1349p.Q1352Ec.4054C>GMissense_Mutation10.11J82N300N
AKAP9SSLQEQLKEURINARY_TRACT1348p.Q1352Ec.4054C>GMissense_Mutation10.11J82N000N
ALPK2AFKKFLTCPURINARY_TRACT1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27647VN000N
ALPK2AFKKFLTCPURINARY_TRACT1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HS172TN000N
ALPK2AFKKFLTCPURINARY_TRACT1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27VMCUB1N000N
ALPK2DHTAFKKFLURINARY_TRACT1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27647VN600N
ALPK2DHTAFKKFLURINARY_TRACT1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HS172TN600N
ALPK2DHTAFKKFLURINARY_TRACT1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27VMCUB1N600N
ALPK2HTAFKKFLTURINARY_TRACT1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27647VN100N
ALPK2HTAFKKFLTURINARY_TRACT1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HS172TN100N
ALPK2HTAFKKFLTURINARY_TRACT1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27VMCUB1N100N
ALPK2KMDHTAFKKURINARY_TRACT1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27647VN600N
ALPK2KMDHTAFKKURINARY_TRACT1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HS172TN600N
ALPK2KMDHTAFKKURINARY_TRACT1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27VMCUB1N600N
ALPK2LKMDHTAFKURINARY_TRACT1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27647VN1017N
ALPK2LKMDHTAFKURINARY_TRACT1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HS172TN1017N
ALPK2LKMDHTAFKURINARY_TRACT1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27VMCUB1N1017N
ALPK2MDHTAFKKFURINARY_TRACT1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27647VN600N
ALPK2MDHTAFKKFURINARY_TRACT1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HS172TN600N
ALPK2MDHTAFKKFURINARY_TRACT1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27VMCUB1N600N
ALPK2TAFKKFLTCURINARY_TRACT1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27647VN600N
ALPK2TAFKKFLTCURINARY_TRACT1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HS172TN600N
ALPK2TAFKKFLTCURINARY_TRACT1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27VMCUB1N600N
ALPK2ATRETVTIAURINARY_TRACT1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74ACCSY1140N
ALPK2ATRETVTIAURINARY_TRACT1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74JMSU1Y1140N
ALPK2ATRETVTIAURINARY_TRACT1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74RT11284Y1140N
ALPK2ATRETVTIAURINARY_TRACT1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74RT112Y1140N
ALPK2ATRETVTIAURINARY_TRACT1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74RT4Y1140N
ALPK2ATRETVTIAURINARY_TRACT1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SW1710Y1140N
ALPK2ATRETVTIAURINARY_TRACT1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74UMUC1Y1140N
ALPK2ATRETVTIAURINARY_TRACT1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74UMUC3Y1140N
ALPK2CFQATRETVURINARY_TRACT998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74ACCSY2110N
ALPK2CFQATRETVURINARY_TRACT998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74JMSU1Y2110N
ALPK2CFQATRETVURINARY_TRACT998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74RT11284Y2110N
ALPK2CFQATRETVURINARY_TRACT998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74RT112Y2110N
ALPK2CFQATRETVURINARY_TRACT998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74RT4Y2110N
ALPK2CFQATRETVURINARY_TRACT998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SW1710Y2110N
ALPK2CFQATRETVURINARY_TRACT998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74UMUC1Y2110N
ALPK2CFQATRETVURINARY_TRACT998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74UMUC3Y2110N
ALPK2ETVTIATEVURINARY_TRACT1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74ACCSN400N
ALPK2ETVTIATEVURINARY_TRACT1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74JMSU1N400N
ALPK2ETVTIATEVURINARY_TRACT1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74RT11284N400N
ALPK2ETVTIATEVURINARY_TRACT1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74RT112N400N
ALPK2ETVTIATEVURINARY_TRACT1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74RT4N400N
ALPK2ETVTIATEVURINARY_TRACT1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SW1710N400N
ALPK2ETVTIATEVURINARY_TRACT1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74UMUC1N400N
ALPK2ETVTIATEVURINARY_TRACT1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74UMUC3N400N
ALPK2FQATRETVTURINARY_TRACT999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74ACCSN600N
ALPK2FQATRETVTURINARY_TRACT999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74JMSU1N600N
ALPK2FQATRETVTURINARY_TRACT999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74RT11284N600N
ALPK2FQATRETVTURINARY_TRACT999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74RT112N600N
ALPK2FQATRETVTURINARY_TRACT999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74RT4N600N
ALPK2FQATRETVTURINARY_TRACT999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SW1710N600N
ALPK2FQATRETVTURINARY_TRACT999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74UMUC1N600N
ALPK2FQATRETVTURINARY_TRACT999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74UMUC3N600N
ALPK2QATRETVTIURINARY_TRACT1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74ACCSN600N
ALPK2QATRETVTIURINARY_TRACT1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74JMSU1N600N
ALPK2QATRETVTIURINARY_TRACT1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74RT11284N600N
ALPK2QATRETVTIURINARY_TRACT1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74RT112N600N
ALPK2QATRETVTIURINARY_TRACT1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74RT4N600N
ALPK2QATRETVTIURINARY_TRACT1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SW1710N600N
ALPK2QATRETVTIURINARY_TRACT1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74UMUC1N600N
ALPK2QATRETVTIURINARY_TRACT1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74UMUC3N600N
ALPK2RETVTIATEURINARY_TRACT1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74ACCSN100N
ALPK2RETVTIATEURINARY_TRACT1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74JMSU1N100N
ALPK2RETVTIATEURINARY_TRACT1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74RT11284N100N
ALPK2RETVTIATEURINARY_TRACT1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74RT112N100N
ALPK2RETVTIATEURINARY_TRACT1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74RT4N100N
ALPK2RETVTIATEURINARY_TRACT1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SW1710N100N
ALPK2RETVTIATEURINARY_TRACT1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74UMUC1N100N
ALPK2RETVTIATEURINARY_TRACT1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74UMUC3N100N
ALPK2TRETVTIATURINARY_TRACT1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74ACCSN200N
ALPK2TRETVTIATURINARY_TRACT1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74JMSU1N200N
ALPK2TRETVTIATURINARY_TRACT1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74RT11284N200N
ALPK2TRETVTIATURINARY_TRACT1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74RT112N200N
ALPK2TRETVTIATURINARY_TRACT1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74RT4N200N
ALPK2TRETVTIATURINARY_TRACT1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SW1710N200N
ALPK2TRETVTIATURINARY_TRACT1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74UMUC1N200N
ALPK2TRETVTIATURINARY_TRACT1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74UMUC3N200N
ALPK2AVWQRNLLEURINARY_TRACT342p.G350Ec.1049G>AMissense_Mutation10.11639VN000N
ALPK2ERGSETKQEURINARY_TRACT1128p.G1136Ec.3407G>AMissense_Mutation10.11VMCUB1N000N
ALPK2ETEHVFLLEURINARY_TRACT350p.G350Ec.1049G>AMissense_Mutation10.11639VN100N
ALPK2ETKQEVQQQURINARY_TRACT1132p.G1136Ec.3407G>AMissense_Mutation10.11VMCUB1N000N
ALPK2EVQQQSLSQURINARY_TRACT1136p.G1136Ec.3407G>AMissense_Mutation10.11VMCUB1N100N
ALPK2GSETKQEVQURINARY_TRACT1130p.G1136Ec.3407G>AMissense_Mutation10.11VMCUB1N100N
ALPK2KQEVQQQSLURINARY_TRACT1134p.G1136Ec.3407G>AMissense_Mutation10.11VMCUB1N800Y
ALPK2LETEHVFLLURINARY_TRACT349p.G350Ec.1049G>AMissense_Mutation10.11639VN1200N
ALPK2LLETEHVFLURINARY_TRACT348p.G350Ec.1049G>AMissense_Mutation10.11639VN1202N
ALPK2NLLETEHVFURINARY_TRACT347p.G350Ec.1049G>AMissense_Mutation10.11639VN700N
ALPK2QEVQQQSLSURINARY_TRACT1135p.G1136Ec.3407G>AMissense_Mutation10.11VMCUB1N500Y
ALPK2QRNLLETEHURINARY_TRACT345p.G350Ec.1049G>AMissense_Mutation10.11639VN200N
ALPK2RGSETKQEVURINARY_TRACT1129p.G1136Ec.3407G>AMissense_Mutation10.11VMCUB1N600N
ALPK2RNLLETEHVURINARY_TRACT346p.G350Ec.1049G>AMissense_Mutation10.11639VY3170N
ALPK2SETKQEVQQURINARY_TRACT1131p.G1136Ec.3407G>AMissense_Mutation10.11VMCUB1N000N
ALPK2TKQEVQQQSURINARY_TRACT1133p.G1136Ec.3407G>AMissense_Mutation10.11VMCUB1N100N
ALPK2VWQRNLLETURINARY_TRACT343p.G350Ec.1049G>AMissense_Mutation10.11639VN100N
ALPK2WQRNLLETEURINARY_TRACT344p.G350Ec.1049G>AMissense_Mutation10.11639VN300N
ATMALKEDRKCFURINARY_TRACT2454p.R2461Cc.7381C>TMissense_Mutation10.11639VN400N
ATMALTIFLKTWURINARY_TRACT235p.L243Wc.728T>GMissense_Mutation10.11VMCUB1Y4130N
ATMCFLCKAVENURINARY_TRACT2461p.R2461Cc.7381C>TMissense_Mutation10.11639VN000N
ATMDGMGIMGVEURINARY_TRACT2916p.T2921Mc.8762C>TMissense_Mutation10.11639VN000N
ATMDIVDGMGIMURINARY_TRACT2913p.T2921Mc.8762C>TMissense_Mutation10.11639VN400N
ATMDRKCFLCKAURINARY_TRACT2458p.R2461Cc.7381C>TMissense_Mutation10.11639VY290N
ATMEDRKCFLCKURINARY_TRACT2457p.R2461Cc.7381C>TMissense_Mutation10.11639VN000N
ATMFLKTWAVNFURINARY_TRACT239p.L243Wc.728T>GMissense_Mutation10.11VMCUB1Y9104Y
ATMGIMGVEGVFURINARY_TRACT2919p.T2921Mc.8762C>TMissense_Mutation10.11639VN500N
ATMGMGIMGVEGURINARY_TRACT2917p.T2921Mc.8762C>TMissense_Mutation10.11639VN000N
ATMIFLKTWAVNURINARY_TRACT238p.L243Wc.728T>GMissense_Mutation10.11VMCUB1N002N
ATMIMGVEGVFRURINARY_TRACT2920p.T2921Mc.8762C>TMissense_Mutation10.11639VN602N
ATMIVDGMGIMGURINARY_TRACT2914p.T2921Mc.8762C>TMissense_Mutation10.11639VN100N
ATMKCFLCKAVEURINARY_TRACT2460p.R2461Cc.7381C>TMissense_Mutation10.11639VN000N
ATMKEDRKCFLCURINARY_TRACT2456p.R2461Cc.7381C>TMissense_Mutation10.11639VN600N
ATMKTWAVNFRIURINARY_TRACT241p.L243Wc.728T>GMissense_Mutation10.11VMCUB1Y16110N
ATMLKEDRKCFLURINARY_TRACT2455p.R2461Cc.7381C>TMissense_Mutation10.11639VN607N
ATMLKTWAVNFRURINARY_TRACT240p.L243Wc.728T>GMissense_Mutation10.11VMCUB1N109Y
ATMLTIFLKTWAURINARY_TRACT236p.L243Wc.728T>GMissense_Mutation10.11VMCUB1N4012N
ATMMGIMGVEGVURINARY_TRACT2918p.T2921Mc.8762C>TMissense_Mutation10.11639VN8034N
ATMMGVEGVFRRURINARY_TRACT2921p.T2921Mc.8762C>TMissense_Mutation10.11639VN200N
ATMRALKEDRKCURINARY_TRACT2453p.R2461Cc.7381C>TMissense_Mutation10.11639VN300N
ATMRKCFLCKAVURINARY_TRACT2459p.R2461Cc.7381C>TMissense_Mutation10.11639VN200N
ATMTIFLKTWAVURINARY_TRACT237p.L243Wc.728T>GMissense_Mutation10.11VMCUB1Y890N
ATMTWAVNFRIRURINARY_TRACT242p.L243Wc.728T>GMissense_Mutation10.11VMCUB1Y1100N
ATMVDGMGIMGVURINARY_TRACT2915p.T2921Mc.8762C>TMissense_Mutation10.11639VN500N
ATMWAVNFRIRVURINARY_TRACT243p.L243Wc.728T>GMissense_Mutation10.11VMCUB1Y11104N
BRAFELITGQLPYURINARY_TRACT648p.M650Ic.1950G>TMissense_Mutation10.11KMBC2N600N
BRAFFGIVLYELIURINARY_TRACT642p.M650Ic.1950G>TMissense_Mutation10.11KMBC2N1504N
BRAFGIVLYELITURINARY_TRACT643p.M650Ic.1950G>TMissense_Mutation10.11KMBC2N000N
BRAFITGQLPYSNURINARY_TRACT650p.M650Ic.1950G>TMissense_Mutation10.11KMBC2N100N
BRAFIVLYELITGURINARY_TRACT644p.M650Ic.1950G>TMissense_Mutation10.11KMBC2N0026N
BRAFLITGQLPYSURINARY_TRACT649p.M650Ic.1950G>TMissense_Mutation10.11KMBC2N004N
BRAFLYELITGQLURINARY_TRACT646p.M650Ic.1950G>TMissense_Mutation10.11KMBC2N1000N
BRAFVLYELITGQURINARY_TRACT645p.M650Ic.1950G>TMissense_Mutation10.11KMBC2N002N
BRAFYELITGQLPURINARY_TRACT647p.M650Ic.1950G>TMissense_Mutation10.11KMBC2N201Y
CARD10AKDQYRKQVURINARY_TRACT415p.E415Ac.1244A>CMissense_Mutation10.11VMCUB1N200Y
CARD10IAKDQYRKQURINARY_TRACT414p.E415Ac.1244A>CMissense_Mutation10.11VMCUB1N000Y
CARD10LIAKDQYRKURINARY_TRACT413p.E415Ac.1244A>CMissense_Mutation10.11VMCUB1N301N
CARD10LQYSQSLIAURINARY_TRACT407p.E415Ac.1244A>CMissense_Mutation10.11VMCUB1N9023N
CARD10QSLIAKDQYURINARY_TRACT411p.E415Ac.1244A>CMissense_Mutation10.11VMCUB1N600N
CARD10QYSQSLIAKURINARY_TRACT408p.E415Ac.1244A>CMissense_Mutation10.11VMCUB1Y2120N
CARD10SLIAKDQYRURINARY_TRACT412p.E415Ac.1244A>CMissense_Mutation10.11VMCUB1N500N
CARD10SQSLIAKDQURINARY_TRACT410p.E415Ac.1244A>CMissense_Mutation10.11VMCUB1N000N
CARD10YSQSLIAKDURINARY_TRACT409p.E415Ac.1244A>CMissense_Mutation10.11VMCUB1N200N
CDH1AELHREDFEURINARY_TRACT546p.D549Hc.1645G>CMissense_Mutation10.11UMUC3N200N
CDH1AISTRAELHURINARY_TRACT541p.D549Hc.1645G>CMissense_Mutation10.11UMUC3N000N
CDH1ELHREDFEHURINARY_TRACT547p.D549Hc.1645G>CMissense_Mutation10.11UMUC3N000N
CDH1EVFKGSVMKURINARY_TRACT265p.E273Kc.817G>AMissense_Mutation10.11SW780N400N
CDH1FKGSVMKGAURINARY_TRACT267p.E273Kc.817G>AMissense_Mutation10.11SW780N400N
CDH1GSVMKGALPURINARY_TRACT269p.E273Kc.817G>AMissense_Mutation10.11SW780N000N
CDH1HREDFEHVKURINARY_TRACT549p.D549Hc.1645G>CMissense_Mutation10.11UMUC3N300N
CDH1ISTRAELHRURINARY_TRACT542p.D549Hc.1645G>CMissense_Mutation10.11UMUC3N300N
CDH1KGALPGTSVURINARY_TRACT273p.E273Kc.817G>AMissense_Mutation10.11SW780N600N
CDH1KGSVMKGALURINARY_TRACT268p.E273Kc.817G>AMissense_Mutation10.11SW780N1100N
CDH1LHREDFEHVURINARY_TRACT548p.D549Hc.1645G>CMissense_Mutation10.11UMUC3N300N
CDH1MKGALPGTSURINARY_TRACT272p.E273Kc.817G>AMissense_Mutation10.11SW780N109N
CDH1RAELHREDFURINARY_TRACT545p.D549Hc.1645G>CMissense_Mutation10.11UMUC3N500N
CDH1STRAELHREURINARY_TRACT543p.D549Hc.1645G>CMissense_Mutation10.11UMUC3N000N
CDH1SVMKGALPGURINARY_TRACT270p.E273Kc.817G>AMissense_Mutation10.11SW780N000N
CDH1TRAELHREDURINARY_TRACT544p.D549Hc.1645G>CMissense_Mutation10.11UMUC3N000N
CDH1VFKGSVMKGURINARY_TRACT266p.E273Kc.817G>AMissense_Mutation10.11SW780N007N
CDH1VMKGALPGTURINARY_TRACT271p.E273Kc.817G>AMissense_Mutation10.11SW780N000N
CHD1AKKRSSFWCURINARY_TRACT1318p.K1320fsc.3960_3961insAFrame_Shift_Ins50.11639VN100N
CHD1CGKFKEEKSURINARY_TRACT1326p.K1320fsc.3960_3961insAFrame_Shift_Ins50.11639VN100N
CHD1DLAKKRSSFURINARY_TRACT1316p.K1320fsc.3960_3961insAFrame_Shift_Ins40.11639VN300N
CHD1FWCGKFKEEURINARY_TRACT1324p.K1320fsc.3960_3961insAFrame_Shift_Ins50.11639VN100N
CHD1GKFKEEKSKURINARY_TRACT1327p.K1320fsc.3960_3961insAFrame_Shift_Ins50.11639VN100N
CHD1KFKEEKSKSURINARY_TRACT1328p.K1320fsc.3960_3961insAFrame_Shift_Ins50.11639VN000N
CHD1KKRSSFWCGURINARY_TRACT1319p.K1320fsc.3960_3961insAFrame_Shift_Ins50.11639VN100N
CHD1KRSSFWCGKURINARY_TRACT1320p.K1320fsc.3960_3961insAFrame_Shift_Ins40.11639VY290N
CHD1LAKKRSSFWURINARY_TRACT1317p.K1320fsc.3960_3961insAFrame_Shift_Ins50.11639VN500N
CHD1LSRDLAKKRURINARY_TRACT1313p.K1320fsc.3960_3961insAFrame_Shift_Ins10.11639VN300N
CHD1RDLAKKRSSURINARY_TRACT1315p.K1320fsc.3960_3961insAFrame_Shift_Ins30.11639VN200N
CHD1RSSFWCGKFURINARY_TRACT1321p.K1320fsc.3960_3961insAFrame_Shift_Ins40.11639VN600N
CHD1SFWCGKFKEURINARY_TRACT1323p.K1320fsc.3960_3961insAFrame_Shift_Ins50.11639VN000N
CHD1SRDLAKKRSURINARY_TRACT1314p.K1320fsc.3960_3961insAFrame_Shift_Ins20.11639VN200N
CHD1SSFWCGKFKURINARY_TRACT1322p.K1320fsc.3960_3961insAFrame_Shift_Ins40.11639VN100N
CHD1WCGKFKEEKURINARY_TRACT1325p.K1320fsc.3960_3961insAFrame_Shift_Ins50.11639VN402N
CHD1DQRSYGSRSURINARY_TRACT1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HT1376N100N
CHD1DQRSYGSRSURINARY_TRACT1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86J82N100N
CHD1DQRSYGSRSURINARY_TRACT1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86RT11284N100N
CHD1DQRSYGSRSURINARY_TRACT1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86RT112N100N
CHD1DQRSYGSRSURINARY_TRACT1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86RT4N100N
CHD1DQRSYGSRSURINARY_TRACT1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SW780N100N
CHD1DQRSYGSRSURINARY_TRACT1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86UBLC1N100N
CHD1DQRSYGSRSURINARY_TRACT1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86UMUC3N100N
CHD1DQRSYGSRSURINARY_TRACT1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86VMCUB1N100N
CHD1LDQRSYGSRURINARY_TRACT1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HT1376N000N
CHD1LDQRSYGSRURINARY_TRACT1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86J82N000N
CHD1LDQRSYGSRURINARY_TRACT1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86RT11284N000N
CHD1LDQRSYGSRURINARY_TRACT1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86RT112N000N
CHD1LDQRSYGSRURINARY_TRACT1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86RT4N000N
CHD1LDQRSYGSRURINARY_TRACT1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SW780N000N
CHD1LDQRSYGSRURINARY_TRACT1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86UBLC1N000N
CHD1LDQRSYGSRURINARY_TRACT1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86UMUC3N000N
CHD1LDQRSYGSRURINARY_TRACT1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86VMCUB1N000N
CHD1PLDQRSYGSURINARY_TRACT1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HT1376N000N
CHD1PLDQRSYGSURINARY_TRACT1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86J82N000N
CHD1PLDQRSYGSURINARY_TRACT1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86RT11284N000N
CHD1PLDQRSYGSURINARY_TRACT1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86RT112N000N
CHD1PLDQRSYGSURINARY_TRACT1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86RT4N000N
CHD1PLDQRSYGSURINARY_TRACT1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SW780N000N
CHD1PLDQRSYGSURINARY_TRACT1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86UBLC1N000N
CHD1PLDQRSYGSURINARY_TRACT1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86UMUC3N000N
CHD1PLDQRSYGSURINARY_TRACT1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86VMCUB1N000N
CHD1QRSYGSRSPURINARY_TRACT1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HT1376N000N
CHD1QRSYGSRSPURINARY_TRACT1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86J82N000N
CHD1QRSYGSRSPURINARY_TRACT1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86RT11284N000N
CHD1QRSYGSRSPURINARY_TRACT1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86RT112N000N
CHD1QRSYGSRSPURINARY_TRACT1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86RT4N000N
CHD1QRSYGSRSPURINARY_TRACT1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SW780N000N
CHD1QRSYGSRSPURINARY_TRACT1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86UBLC1N000N
CHD1QRSYGSRSPURINARY_TRACT1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86UMUC3N000N
CHD1QRSYGSRSPURINARY_TRACT1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86VMCUB1N000N
CHD1RSPLDQRSYURINARY_TRACT1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HT1376N600N
CHD1RSPLDQRSYURINARY_TRACT1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86J82N600N
CHD1RSPLDQRSYURINARY_TRACT1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86RT11284N600N
CHD1RSPLDQRSYURINARY_TRACT1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86RT112N600N
CHD1RSPLDQRSYURINARY_TRACT1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86RT4N600N
CHD1RSPLDQRSYURINARY_TRACT1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SW780N600N
CHD1RSPLDQRSYURINARY_TRACT1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86UBLC1N600N
CHD1RSPLDQRSYURINARY_TRACT1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86UMUC3N600N
CHD1RSPLDQRSYURINARY_TRACT1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86VMCUB1N600N
CHD1RSYGSRSPFURINARY_TRACT1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HT1376N900N
CHD1RSYGSRSPFURINARY_TRACT1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86J82N900N
CHD1RSYGSRSPFURINARY_TRACT1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86RT11284N900N
CHD1RSYGSRSPFURINARY_TRACT1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86RT112N900N
CHD1RSYGSRSPFURINARY_TRACT1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86RT4N900N
CHD1RSYGSRSPFURINARY_TRACT1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SW780N900N
CHD1RSYGSRSPFURINARY_TRACT1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86UBLC1N900N
CHD1RSYGSRSPFURINARY_TRACT1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86UMUC3N900N
CHD1RSYGSRSPFURINARY_TRACT1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86VMCUB1N900N
CHD1SPLDQRSYGURINARY_TRACT1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HT1376N000N
CHD1SPLDQRSYGURINARY_TRACT1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86J82N000N
CHD1SPLDQRSYGURINARY_TRACT1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86RT11284N000N
CHD1SPLDQRSYGURINARY_TRACT1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86RT112N000N
CHD1SPLDQRSYGURINARY_TRACT1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86RT4N000N
CHD1SPLDQRSYGURINARY_TRACT1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SW780N000N
CHD1SPLDQRSYGURINARY_TRACT1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86UBLC1N000N
CHD1SPLDQRSYGURINARY_TRACT1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86UMUC3N000N
CHD1SPLDQRSYGURINARY_TRACT1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86VMCUB1N000N
CHD1SYGSRSPFEURINARY_TRACT1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HT1376N000N
CHD1SYGSRSPFEURINARY_TRACT1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86J82N000N
CHD1SYGSRSPFEURINARY_TRACT1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86RT11284N000N
CHD1SYGSRSPFEURINARY_TRACT1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86RT112N000N
CHD1SYGSRSPFEURINARY_TRACT1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86RT4N000N
CHD1SYGSRSPFEURINARY_TRACT1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SW780N000N
CHD1SYGSRSPFEURINARY_TRACT1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86UBLC1N000N
CHD1SYGSRSPFEURINARY_TRACT1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86UMUC3N000N
CHD1SYGSRSPFEURINARY_TRACT1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86VMCUB1N000N
CHD1CSFSNGKDHURINARY_TRACT1577p.S1577Cc.4730C>GMissense_Mutation10.11KMBC2N100N
CHD1DSRKRPYCSURINARY_TRACT1570p.S1577Cc.4730C>GMissense_Mutation10.11KMBC2N200Y
CHD1KRPYCSFSNURINARY_TRACT1573p.S1577Cc.4730C>GMissense_Mutation10.11KMBC2N300Y
CHD1PYCSFSNGKURINARY_TRACT1575p.S1577Cc.4730C>GMissense_Mutation10.11KMBC2N000N
CHD1RKRPYCSFSURINARY_TRACT1572p.S1577Cc.4730C>GMissense_Mutation10.11KMBC2N100Y
CHD1RPYCSFSNGURINARY_TRACT1574p.S1577Cc.4730C>GMissense_Mutation10.11KMBC2N200Y
CHD1SDSRKRPYCURINARY_TRACT1569p.S1577Cc.4730C>GMissense_Mutation10.11KMBC2N200Y
CHD1SRKRPYCSFURINARY_TRACT1571p.S1577Cc.4730C>GMissense_Mutation10.11KMBC2Y490Y
CHD1YCSFSNGKDURINARY_TRACT1576p.S1577Cc.4730C>GMissense_Mutation10.11KMBC2N201N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.475637N801N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.47647VN801N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.47ACCSN801N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.47BFTC905N801N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.47HS172TN801N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.47HT1376N801N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.47JMSU1N801N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.47KMBC2N801N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.47KU1919N801N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.47RT11284N801N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.47RT112N801N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.47SCABERN801N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.47SW1710N801N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.47SW780N801N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.47UMUC1N801N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.47UMUC3N801N
CREB3L2FTHITSDSFURINARY_TRACT95p.T100delc.299_301delCCAIn_Frame_Del444.47VMCUB1N801N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.475637N000N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.47647VN000N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.47ACCSN000N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.47BFTC905N000N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.47HS172TN000N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.47HT1376N000N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.47JMSU1N000N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.47KMBC2N000N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.47KU1919N000N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.47RT11284N000N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.47RT112N000N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.47SCABERN000N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.47SW1710N000N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.47SW780N000N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.47UMUC1N000N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.47UMUC3N000N
CREB3L2HITSDSFNDURINARY_TRACT97p.T100delc.299_301delCCAIn_Frame_Del244.47VMCUB1N000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.475637N000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.47647VN000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.47ACCSN000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.47BFTC905N000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.47HS172TN000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.47HT1376N000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.47JMSU1N000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.47KMBC2N000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.47KU1919N000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.47RT11284N000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.47RT112N000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.47SCABERN000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.47SW1710N000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.47SW780N000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.47UMUC1N000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.47UMUC3N000N
CREB3L2ITSDSFNDDURINARY_TRACT98p.T100delc.299_301delCCAIn_Frame_Del144.47VMCUB1N000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.475637N000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.47647VN000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.47ACCSN000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.47BFTC905N000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.47HS172TN000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.47HT1376N000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.47JMSU1N000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.47KMBC2N000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.47KU1919N000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.47RT11284N000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.47RT112N000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.47SCABERN000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.47SW1710N000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.47SW780N000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.47UMUC1N000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.47UMUC3N000N
CREB3L2PFTHITSDSURINARY_TRACT94p.T100delc.299_301delCCAIn_Frame_Del344.47VMCUB1N000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.475637N000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.47647VN000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.47ACCSN000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.47BFTC905N000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.47HS172TN000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.47HT1376N000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.47JMSU1N000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.47KMBC2N000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.47KU1919N000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.47RT11284N000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.47RT112N000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.47SCABERN000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.47SW1710N000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.47SW780N000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.47UMUC1N000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.47UMUC3N000N
CREB3L2QSPFTHITSURINARY_TRACT92p.T100delc.299_301delCCAIn_Frame_Del144.47VMCUB1N000N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.475637N100N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.47647VN100N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.47ACCSN100N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.47BFTC905N100N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.47HS172TN100N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.47HT1376N100N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.47JMSU1N100N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.47KMBC2N100N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.47KU1919N100N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.47RT11284N100N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.47RT112N100N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.47SCABERN100N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.47SW1710N100N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.47SW780N100N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.47UMUC1N100N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.47UMUC3N100N
CREB3L2SPFTHITSDURINARY_TRACT93p.T100delc.299_301delCCAIn_Frame_Del244.47VMCUB1N100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.475637N100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.47647VN100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.47ACCSN100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.47BFTC905N100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.47HS172TN100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.47HT1376N100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.47JMSU1N100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.47KMBC2N100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.47KU1919N100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.47RT11284N100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.47RT112N100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.47SCABERN100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.47SW1710N100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.47SW780N100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.47UMUC1N100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.47UMUC3N100N
CREB3L2THITSDSFNURINARY_TRACT96p.T100delc.299_301delCCAIn_Frame_Del344.47VMCUB1N100N
CTBP2APSPNQPTNURINARY_TRACT966p.K974fsc.2922_2922delAFrame_Shift_Del124.345637N300N
CTBP2APSPNQPTNURINARY_TRACT966p.K974fsc.2922_2922delAFrame_Shift_Del124.34KMBC2N300N
CTBP2APSPNQPTNURINARY_TRACT966p.K974fsc.2922_2922delAFrame_Shift_Del124.34RT4N300N
CTBP2APSPNQPTNURINARY_TRACT966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SW780N300N
CTBP2APSPNQPTNURINARY_TRACT966p.K974fsc.2922_2922delAFrame_Shift_Del124.34UBLC1N300N
CTBP2GTIESTPTSURINARY_TRACT976p.K974fsc.2922_2922delAFrame_Shift_Del524.345637N100N
CTBP2GTIESTPTSURINARY_TRACT976p.K974fsc.2922_2922delAFrame_Shift_Del524.34KMBC2N100N
CTBP2GTIESTPTSURINARY_TRACT976p.K974fsc.2922_2922delAFrame_Shift_Del524.34RT4N100N
CTBP2GTIESTPTSURINARY_TRACT976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW780N100N
CTBP2GTIESTPTSURINARY_TRACT976p.K974fsc.2922_2922delAFrame_Shift_Del524.34UBLC1N100N
CTBP2NQPTNTGTIURINARY_TRACT970p.K974fsc.2922_2922delAFrame_Shift_Del424.345637N1000N
CTBP2NQPTNTGTIURINARY_TRACT970p.K974fsc.2922_2922delAFrame_Shift_Del424.34KMBC2N1000N
CTBP2NQPTNTGTIURINARY_TRACT970p.K974fsc.2922_2922delAFrame_Shift_Del424.34RT4N1000N
CTBP2NQPTNTGTIURINARY_TRACT970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SW780N1000N
CTBP2NQPTNTGTIURINARY_TRACT970p.K974fsc.2922_2922delAFrame_Shift_Del424.34UBLC1N1000N
CTBP2NTGTIESTPURINARY_TRACT974p.K974fsc.2922_2922delAFrame_Shift_Del524.345637N000N
CTBP2NTGTIESTPURINARY_TRACT974p.K974fsc.2922_2922delAFrame_Shift_Del524.34KMBC2N000N
CTBP2NTGTIESTPURINARY_TRACT974p.K974fsc.2922_2922delAFrame_Shift_Del524.34RT4N000N
CTBP2NTGTIESTPURINARY_TRACT974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW780N000N
CTBP2NTGTIESTPURINARY_TRACT974p.K974fsc.2922_2922delAFrame_Shift_Del524.34UBLC1N000N
CTBP2PNQPTNTGTURINARY_TRACT969p.K974fsc.2922_2922delAFrame_Shift_Del324.345637N000N
CTBP2PNQPTNTGTURINARY_TRACT969p.K974fsc.2922_2922delAFrame_Shift_Del324.34KMBC2N000N
CTBP2PNQPTNTGTURINARY_TRACT969p.K974fsc.2922_2922delAFrame_Shift_Del324.34RT4N000N
CTBP2PNQPTNTGTURINARY_TRACT969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SW780N000N
CTBP2PNQPTNTGTURINARY_TRACT969p.K974fsc.2922_2922delAFrame_Shift_Del324.34UBLC1N000N
CTBP2PSPNQPTNTURINARY_TRACT967p.K974fsc.2922_2922delAFrame_Shift_Del224.345637N000N
CTBP2PSPNQPTNTURINARY_TRACT967p.K974fsc.2922_2922delAFrame_Shift_Del224.34KMBC2N000N
CTBP2PSPNQPTNTURINARY_TRACT967p.K974fsc.2922_2922delAFrame_Shift_Del224.34RT4N000N
CTBP2PSPNQPTNTURINARY_TRACT967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SW780N000N
CTBP2PSPNQPTNTURINARY_TRACT967p.K974fsc.2922_2922delAFrame_Shift_Del224.34UBLC1N000N
CTBP2PTNTGTIESURINARY_TRACT972p.K974fsc.2922_2922delAFrame_Shift_Del524.345637N000N
CTBP2PTNTGTIESURINARY_TRACT972p.K974fsc.2922_2922delAFrame_Shift_Del524.34KMBC2N000N
CTBP2PTNTGTIESURINARY_TRACT972p.K974fsc.2922_2922delAFrame_Shift_Del524.34RT4N000N
CTBP2PTNTGTIESURINARY_TRACT972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW780N000N
CTBP2PTNTGTIESURINARY_TRACT972p.K974fsc.2922_2922delAFrame_Shift_Del524.34UBLC1N000N
CTBP2QPTNTGTIEURINARY_TRACT971p.K974fsc.2922_2922delAFrame_Shift_Del524.345637N000N
CTBP2QPTNTGTIEURINARY_TRACT971p.K974fsc.2922_2922delAFrame_Shift_Del524.34KMBC2N000N
CTBP2QPTNTGTIEURINARY_TRACT971p.K974fsc.2922_2922delAFrame_Shift_Del524.34RT4N000N
CTBP2QPTNTGTIEURINARY_TRACT971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW780N000N
CTBP2QPTNTGTIEURINARY_TRACT971p.K974fsc.2922_2922delAFrame_Shift_Del524.34UBLC1N000N
CTBP2SPNQPTNTGURINARY_TRACT968p.K974fsc.2922_2922delAFrame_Shift_Del224.345637N000N
CTBP2SPNQPTNTGURINARY_TRACT968p.K974fsc.2922_2922delAFrame_Shift_Del224.34KMBC2N000N
CTBP2SPNQPTNTGURINARY_TRACT968p.K974fsc.2922_2922delAFrame_Shift_Del224.34RT4N000N
CTBP2SPNQPTNTGURINARY_TRACT968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SW780N000N
CTBP2SPNQPTNTGURINARY_TRACT968p.K974fsc.2922_2922delAFrame_Shift_Del224.34UBLC1N000N
CTBP2TGTIESTPTURINARY_TRACT975p.K974fsc.2922_2922delAFrame_Shift_Del524.345637N000N
CTBP2TGTIESTPTURINARY_TRACT975p.K974fsc.2922_2922delAFrame_Shift_Del524.34KMBC2N000N
CTBP2TGTIESTPTURINARY_TRACT975p.K974fsc.2922_2922delAFrame_Shift_Del524.34RT4N000N
CTBP2TGTIESTPTURINARY_TRACT975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW780N000N
CTBP2TGTIESTPTURINARY_TRACT975p.K974fsc.2922_2922delAFrame_Shift_Del524.34UBLC1N000N
CTBP2TIESTPTSNURINARY_TRACT977p.K974fsc.2922_2922delAFrame_Shift_Del524.345637N100N
CTBP2TIESTPTSNURINARY_TRACT977p.K974fsc.2922_2922delAFrame_Shift_Del524.34KMBC2N100N
CTBP2TIESTPTSNURINARY_TRACT977p.K974fsc.2922_2922delAFrame_Shift_Del524.34RT4N100N
CTBP2TIESTPTSNURINARY_TRACT977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW780N100N
CTBP2TIESTPTSNURINARY_TRACT977p.K974fsc.2922_2922delAFrame_Shift_Del524.34UBLC1N100N
CTBP2TNTGTIESTURINARY_TRACT973p.K974fsc.2922_2922delAFrame_Shift_Del524.345637N000N
CTBP2TNTGTIESTURINARY_TRACT973p.K974fsc.2922_2922delAFrame_Shift_Del524.34KMBC2N000N
CTBP2TNTGTIESTURINARY_TRACT973p.K974fsc.2922_2922delAFrame_Shift_Del524.34RT4N000N
CTBP2TNTGTIESTURINARY_TRACT973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW780N000N
CTBP2TNTGTIESTURINARY_TRACT973p.K974fsc.2922_2922delAFrame_Shift_Del524.34UBLC1N000N
CTBP2ALLDAGHLYURINARY_TRACT157p.Q159Lc.476A>TMissense_Mutation10.11BFTC905Y6120N
CTBP2GRSPALLDAURINARY_TRACT153p.Q159Lc.476A>TMissense_Mutation10.11BFTC905Y290N
CTBP2LDAGHLYRDURINARY_TRACT159p.Q159Lc.476A>TMissense_Mutation10.11BFTC905N000N
CTBP2LLDAGHLYRURINARY_TRACT158p.Q159Lc.476A>TMissense_Mutation10.11BFTC905Y7120N
CTBP2MQGRSPALLURINARY_TRACT151p.Q159Lc.476A>TMissense_Mutation10.11BFTC905Y10106N
CTBP2PALLDAGHLURINARY_TRACT156p.Q159Lc.476A>TMissense_Mutation10.11BFTC905N100N
CTBP2QGRSPALLDURINARY_TRACT152p.Q159Lc.476A>TMissense_Mutation10.11BFTC905N000N
CTBP2RSPALLDAGURINARY_TRACT154p.Q159Lc.476A>TMissense_Mutation10.11BFTC905N100N
CTBP2SPALLDAGHURINARY_TRACT155p.Q159Lc.476A>TMissense_Mutation10.11BFTC905N000N
CTBP2ARESIPFKMURINARY_TRACT260p.S266Fc.797C>TMissense_Mutation10.22KMBC2Y3100N
CTBP2ESIPFKMAYURINARY_TRACT262p.S266Fc.797C>TMissense_Mutation10.22KMBC2N600N
CTBP2FKMAYETYEURINARY_TRACT266p.S266Fc.797C>TMissense_Mutation10.22KMBC2N200N
CTBP2GPARESIPFURINARY_TRACT258p.S266Fc.797C>TMissense_Mutation10.22KMBC2N1100N
CTBP2IPFKMAYETURINARY_TRACT264p.S266Fc.797C>TMissense_Mutation10.22KMBC2N900N
CTBP2PARESIPFKURINARY_TRACT259p.S266Fc.797C>TMissense_Mutation10.22KMBC2N000N
CTBP2PFKMAYETYURINARY_TRACT265p.S266Fc.797C>TMissense_Mutation10.22KMBC2N000N
CTBP2RESIPFKMAURINARY_TRACT261p.S266Fc.797C>TMissense_Mutation10.22KMBC2N700N
CTBP2SIPFKMAYEURINARY_TRACT263p.S266Fc.797C>TMissense_Mutation10.22KMBC2N000N
CTNNB1AAAVLFQMSURINARY_TRACT655p.R661Qc.1982G>AMissense_Mutation10.11639VN100N
CTNNB1AAVLFQMSEURINARY_TRACT656p.R661Qc.1982G>AMissense_Mutation10.11639VN000N
CTNNB1AVLFQMSEDURINARY_TRACT657p.R661Qc.1982G>AMissense_Mutation10.11639VN000N
CTNNB1FQMSEDKPQURINARY_TRACT660p.R661Qc.1982G>AMissense_Mutation10.11639VN202N
CTNNB1LFQMSEDKPURINARY_TRACT659p.R661Qc.1982G>AMissense_Mutation10.11639VN000N
CTNNB1QMSEDKPQDURINARY_TRACT661p.R661Qc.1982G>AMissense_Mutation10.11639VN000N
CTNNB1TYAAAVLFQURINARY_TRACT653p.R661Qc.1982G>AMissense_Mutation10.11639VN000N
CTNNB1VLFQMSEDKURINARY_TRACT658p.R661Qc.1982G>AMissense_Mutation10.11639VN605N
CTNNB1YAAAVLFQMURINARY_TRACT654p.R661Qc.1982G>AMissense_Mutation10.11639VN1000N
ERBB2ASPLTCIISURINARY_TRACT648p.S653Cc.1958C>GMissense_Mutation10.11VMCUB1N000N
ERBB2CIISAVVGIURINARY_TRACT653p.S653Cc.1958C>GMissense_Mutation10.11VMCUB1N600N
ERBB2DVGFCTLVCURINARY_TRACT307p.S310Fc.929C>TMissense_Mutation10.115637N100N
ERBB2EQRASPLTCURINARY_TRACT645p.S653Cc.1958C>GMissense_Mutation10.11VMCUB1N100Y
ERBB2FCTLVCPLHURINARY_TRACT310p.S310Fc.929C>TMissense_Mutation10.115637N202N
ERBB2GFCTLVCPLURINARY_TRACT309p.S310Fc.929C>TMissense_Mutation10.115637N600N
ERBB2LSTDVGFCTURINARY_TRACT304p.S310Fc.929C>TMissense_Mutation10.115637N100N
ERBB2LTCIISAVVURINARY_TRACT651p.S653Cc.1958C>GMissense_Mutation10.11VMCUB1N400N
ERBB2NYLSTDVGFURINARY_TRACT302p.S310Fc.929C>TMissense_Mutation10.115637N500N
ERBB2PLTCIISAVURINARY_TRACT650p.S653Cc.1958C>GMissense_Mutation10.11VMCUB1N300N
ERBB2QRASPLTCIURINARY_TRACT646p.S653Cc.1958C>GMissense_Mutation10.11VMCUB1N400N
ERBB2RASPLTCIIURINARY_TRACT647p.S653Cc.1958C>GMissense_Mutation10.11VMCUB1Y9110N
ERBB2SPLTCIISAURINARY_TRACT649p.S653Cc.1958C>GMissense_Mutation10.11VMCUB1N1000N
ERBB2STDVGFCTLURINARY_TRACT305p.S310Fc.929C>TMissense_Mutation10.115637Y9100N
ERBB2TCIISAVVGURINARY_TRACT652p.S653Cc.1958C>GMissense_Mutation10.11VMCUB1N000N
ERBB2TDVGFCTLVURINARY_TRACT306p.S310Fc.929C>TMissense_Mutation10.115637N700N
ERBB2VGFCTLVCPURINARY_TRACT308p.S310Fc.929C>TMissense_Mutation10.115637N000N
ERBB2YLSTDVGFCURINARY_TRACT303p.S310Fc.929C>TMissense_Mutation10.115637N603N
FGFR3APFEQYFPGURINARY_TRACT767p.S773Fc.2318C>TMissense_Mutation10.11SW780N100N
FGFR3CSPHRPILQURINARY_TRACT248p.R248Cc.742C>TMissense_Mutation10.11639VN000N
FGFR3DVLECSPHRURINARY_TRACT244p.R248Cc.742C>TMissense_Mutation10.11639VN500N
FGFR3ECSPHRPILURINARY_TRACT247p.R248Cc.742C>TMissense_Mutation10.11639VN600N
FGFR3EQYFPGGQDURINARY_TRACT770p.S773Fc.2318C>TMissense_Mutation10.11SW780N000N
FGFR3FEQYFPGGQURINARY_TRACT769p.S773Fc.2318C>TMissense_Mutation10.11SW780N206Y
FGFR3FPGGQDTPSURINARY_TRACT773p.S773Fc.2318C>TMissense_Mutation10.11SW780N700Y
FGFR3LDVLECSPHURINARY_TRACT243p.R248Cc.742C>TMissense_Mutation10.11639VN000N
FGFR3LECSPHRPIURINARY_TRACT246p.R248Cc.742C>TMissense_Mutation10.11639VN900N
FGFR3LSAPFEQYFURINARY_TRACT765p.S773Fc.2318C>TMissense_Mutation10.11SW780N800N
FGFR3PFEQYFPGGURINARY_TRACT768p.S773Fc.2318C>TMissense_Mutation10.11SW780N000Y
FGFR3QYFPGGQDTURINARY_TRACT771p.S773Fc.2318C>TMissense_Mutation10.11SW780N300N
FGFR3SAPFEQYFPURINARY_TRACT766p.S773Fc.2318C>TMissense_Mutation10.11SW780N000N
FGFR3TLDVLECSPURINARY_TRACT242p.R248Cc.742C>TMissense_Mutation10.11639VN000N
FGFR3TYTLDVLECURINARY_TRACT240p.R248Cc.742C>TMissense_Mutation10.11639VN100N
FGFR3VLECSPHRPURINARY_TRACT245p.R248Cc.742C>TMissense_Mutation10.11639VN000N
FGFR3YFPGGQDTPURINARY_TRACT772p.S773Fc.2318C>TMissense_Mutation10.11SW780N200Y
FGFR3YTLDVLECSURINARY_TRACT241p.R248Cc.742C>TMissense_Mutation10.11639VN2011N
FGFR3HNLDYYKETURINARY_TRACT645p.K652Ec.1954A>GMissense_Mutation10.22J82N100Y
FGFR3LDYYKETTNURINARY_TRACT647p.K652Ec.1954A>GMissense_Mutation10.22J82N100Y
FGFR3NLDYYKETTURINARY_TRACT646p.K652Ec.1954A>GMissense_Mutation10.22J82N000Y
FGFR3VHNLDYYKEURINARY_TRACT644p.K652Ec.1954A>GMissense_Mutation10.22J82N000N
FGFR3DYYKETTNGURINARY_TRACT648p.K652Ec.1954A>GMissense_Mutation10.33J82N000N
FGFR3ETTNGRLPVURINARY_TRACT652p.K652Ec.1954A>GMissense_Mutation10.33J82N200N
FGFR3KETTNGRLPURINARY_TRACT651p.K652Ec.1954A>GMissense_Mutation10.33J82N000N
FGFR3YKETTNGRLURINARY_TRACT650p.K652Ec.1954A>GMissense_Mutation10.33J82N702N
FGFR3YYKETTNGRURINARY_TRACT649p.K652Ec.1954A>GMissense_Mutation10.33J82N304N
FMN2LPPLPGAAIURINARY_TRACT934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03639VN1401N
FMN2LPPLPGAAIURINARY_TRACT934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03CAL29N1401N
FMN2LPPLPGAAIURINARY_TRACT934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03KU1919N1401N
FMN2LPPLPGAAIURINARY_TRACT934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03UMUC3N1401N
FMN2PLPPLPGAAURINARY_TRACT933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03639VN000N
FMN2PLPPLPGAAURINARY_TRACT933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03CAL29N000N
FMN2PLPPLPGAAURINARY_TRACT933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03KU1919N000N
FMN2PLPPLPGAAURINARY_TRACT933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03UMUC3N000N
FMN2AMGVLLPFSURINARY_TRACT567p.L570Vc.1708C>GMissense_Mutation10.11UBLC1N000N
FMN2CSRIIAMGVURINARY_TRACT562p.L570Vc.1708C>GMissense_Mutation10.11UBLC1N300N
FMN2GVLLPFSDCURINARY_TRACT569p.L570Vc.1708C>GMissense_Mutation10.11UBLC1N100N
FMN2IAMGVLLPFURINARY_TRACT566p.L570Vc.1708C>GMissense_Mutation10.11UBLC1N1202N
FMN2IIAMGVLLPURINARY_TRACT565p.L570Vc.1708C>GMissense_Mutation10.11UBLC1N0028N
FMN2IPPPPLLPIURINARY_TRACT1232p.P1240Tc.3718C>AMissense_Mutation10.11BFTC905N1500N
FMN2ISGPPLLPQURINARY_TRACT1240p.P1240Tc.3718C>AMissense_Mutation10.11BFTC905N100N
FMN2LLPISGPPLURINARY_TRACT1237p.P1240Tc.3718C>AMissense_Mutation10.11BFTC905N1104N
FMN2LLWYAGQGQURINARY_TRACT816p.S819Yc.2456C>AMissense_Mutation10.11UMUC3N002Y
FMN2LPISGPPLLURINARY_TRACT1238p.P1240Tc.3718C>AMissense_Mutation10.11BFTC905N2002N
FMN2LWYAGQGQPURINARY_TRACT817p.S819Yc.2456C>AMissense_Mutation10.11UMUC3N000N
FMN2MGVLLPFSDURINARY_TRACT568p.L570Vc.1708C>GMissense_Mutation10.11UBLC1N003N
FMN2PISGPPLLPURINARY_TRACT1239p.P1240Tc.3718C>AMissense_Mutation10.11BFTC905N000N
FMN2PLLPISGPPURINARY_TRACT1236p.P1240Tc.3718C>AMissense_Mutation10.11BFTC905N000N
FMN2PPLLPISGPURINARY_TRACT1235p.P1240Tc.3718C>AMissense_Mutation10.11BFTC905N000N
FMN2PPPLLPISGURINARY_TRACT1234p.P1240Tc.3718C>AMissense_Mutation10.11BFTC905N000N
FMN2PPPPLLPISURINARY_TRACT1233p.P1240Tc.3718C>AMissense_Mutation10.11BFTC905N000N
FMN2PPPPSLLWYURINARY_TRACT811p.S819Yc.2456C>AMissense_Mutation10.11UMUC3N800N
FMN2PPPSLLWYAURINARY_TRACT812p.S819Yc.2456C>AMissense_Mutation10.11UMUC3N300Y
FMN2PPSLLWYAGURINARY_TRACT813p.S819Yc.2456C>AMissense_Mutation10.11UMUC3N000N
FMN2PSLLWYAGQURINARY_TRACT814p.S819Yc.2456C>AMissense_Mutation10.11UMUC3N000N
FMN2RIIAMGVLLURINARY_TRACT564p.L570Vc.1708C>GMissense_Mutation10.11UBLC1Y12110N
FMN2SLLWYAGQGURINARY_TRACT815p.S819Yc.2456C>AMissense_Mutation10.11UMUC3N000N
FMN2SRIIAMGVLURINARY_TRACT563p.L570Vc.1708C>GMissense_Mutation10.11UBLC1Y790N
FMN2VLLPFSDCFURINARY_TRACT570p.L570Vc.1708C>GMissense_Mutation10.11UBLC1N900N
FMN2WYAGQGQPGURINARY_TRACT818p.S819Yc.2456C>AMissense_Mutation10.11UMUC3N100Y
FMN2YAGQGQPGSURINARY_TRACT819p.S819Yc.2456C>AMissense_Mutation10.11UMUC3N300Y
GATA1ESEVFFPSGURINARY_TRACT29p.G31Ec.92G>AMissense_Mutation10.11CAL29N100Y
GATA1EVFFPSGPEURINARY_TRACT31p.G31Ec.92G>AMissense_Mutation10.11CAL29N000N
GATA1LVSSTPESEURINARY_TRACT23p.G31Ec.92G>AMissense_Mutation10.11CAL29N001N
GATA1PESEVFFPSURINARY_TRACT28p.G31Ec.92G>AMissense_Mutation10.11CAL29N000N
GATA1SEVFFPSGPURINARY_TRACT30p.G31Ec.92G>AMissense_Mutation10.11CAL29N200Y
GATA1SSTPESEVFURINARY_TRACT25p.G31Ec.92G>AMissense_Mutation10.11CAL29N600Y
GATA1STPESEVFFURINARY_TRACT26p.G31Ec.92G>AMissense_Mutation10.11CAL29N600N
GATA1TPESEVFFPURINARY_TRACT27p.G31Ec.92G>AMissense_Mutation10.11CAL29N000Y
GATA1VSSTPESEVURINARY_TRACT24p.G31Ec.92G>AMissense_Mutation10.11CAL29N500Y
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.75637N000N
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7639VN000N
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7647VN000N
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7BFTC905N000N
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7CAL29N000N
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HS172TN000N
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7J82N000N
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7JMSU1N000N
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KMBC2N000N
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7RT11284N000N
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7RT112N000N
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SCABERN000N
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SW1710N000N
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SW780N000N
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7UBLC1N000N
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7UMUC3N000N
GPR112ASISDMFIQURINARY_TRACT2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7VMCUB1N000N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.75637Y11100N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7639VY11100N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7647VY11100N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7BFTC905Y11100N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7CAL29Y11100N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS172TY11100N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7J82Y11100N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7JMSU1Y11100N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KMBC2Y11100N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7RT11284Y11100N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7RT112Y11100N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SCABERY11100N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SW1710Y11100N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SW780Y11100N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7UBLC1Y11100N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7UMUC3Y11100N
GPR112ISDMFIQNLURINARY_TRACT2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7VMCUB1Y11100N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.75637N700N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7639VN700N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7647VN700N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7BFTC905N700N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7CAL29N700N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS172TN700N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7J82N700N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7JMSU1N700N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KMBC2N700N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7RT11284N700N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7RT112N700N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SCABERN700N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SW1710N700N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SW780N700N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7UBLC1N700N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7UMUC3N700N
GPR112SASISDMFIURINARY_TRACT2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7VMCUB1N700N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.75637N400N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7639VN400N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7647VN400N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7BFTC905N400N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7CAL29N400N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS172TN400N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7J82N400N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7JMSU1N400N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KMBC2N400N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7RT11284N400N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7RT112N400N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SCABERN400N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SW1710N400N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SW780N400N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7UBLC1N400N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7UMUC3N400N
GPR112SDMFIQNLAURINARY_TRACT2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7VMCUB1N400N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.75637N000N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7639VN000N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7647VN000N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7BFTC905N000N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7CAL29N000N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS172TN000N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7J82N000N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7JMSU1N000N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KMBC2N000N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7RT11284N000N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7RT112N000N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SCABERN000N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SW1710N000N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SW780N000N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7UBLC1N000N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7UMUC3N000N
GPR112SISDMFIQNURINARY_TRACT2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7VMCUB1N000N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.75637N900N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7639VN900N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7647VN900N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7BFTC905N900N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7CAL29N900N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS172TN900N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7J82N900N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7JMSU1N900N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KMBC2N900N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7RT11284N900N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7RT112N900N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SCABERN900N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SW1710N900N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SW780N900N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7UBLC1N900N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7UMUC3N900N
GPR112VSASISDMFURINARY_TRACT2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7VMCUB1N900N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.75637N5020N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7639VN5020N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7647VN5020N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7BFTC905N5020N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7CAL29N5020N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS172TN5020N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7J82N5020N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7JMSU1N5020N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KMBC2N5020N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7RT11284N5020N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7RT112N5020N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SCABERN5020N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SW1710N5020N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SW780N5020N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7UBLC1N5020N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7UMUC3N5020N
GPR112VVSASISDMURINARY_TRACT2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7VMCUB1N5020N
GPR112ALKKIFEHKURINARY_TRACT3028p.G3028Ac.9083G>CMissense_Mutation10.11VMCUB1N500N
GPR112ALLGREDIYURINARY_TRACT81p.D89Yc.265G>TMissense_Mutation10.11SW780Y5140N
GPR112DIYLGLAGDURINARY_TRACT87p.D89Yc.265G>TMissense_Mutation10.11SW780N000N
GPR112EALKKIFEHURINARY_TRACT3027p.G3028Ac.9083G>CMissense_Mutation10.11VMCUB1N000N
GPR112EDIYLGLAGURINARY_TRACT86p.D89Yc.265G>TMissense_Mutation10.11SW780N000N
GPR112GREDIYLGLURINARY_TRACT84p.D89Yc.265G>TMissense_Mutation10.11SW780Y9120N
GPR112GYKQEALKKURINARY_TRACT3023p.G3028Ac.9083G>CMissense_Mutation10.11VMCUB1N100N
GPR112IKVGYKQEAURINARY_TRACT3020p.G3028Ac.9083G>CMissense_Mutation10.11VMCUB1N307N
GPR112IYLGLAGDHURINARY_TRACT88p.D89Yc.265G>TMissense_Mutation10.11SW780N001N
GPR112KQEALKKIFURINARY_TRACT3025p.G3028Ac.9083G>CMissense_Mutation10.11VMCUB1N1000N
GPR112KVGYKQEALURINARY_TRACT3021p.G3028Ac.9083G>CMissense_Mutation10.11VMCUB1Y11120N
GPR112LGREDIYLGURINARY_TRACT83p.D89Yc.265G>TMissense_Mutation10.11SW780N000N
GPR112LLGREDIYLURINARY_TRACT82p.D89Yc.265G>TMissense_Mutation10.11SW780N1000N
GPR112QEALKKIFEURINARY_TRACT3026p.G3028Ac.9083G>CMissense_Mutation10.11VMCUB1N000N
GPR112REDIYLGLAURINARY_TRACT85p.D89Yc.265G>TMissense_Mutation10.11SW780N700N
GPR112VGYKQEALKURINARY_TRACT3022p.G3028Ac.9083G>CMissense_Mutation10.11VMCUB1N101N
GPR112YKQEALKKIURINARY_TRACT3024p.G3028Ac.9083G>CMissense_Mutation10.11VMCUB1N400N
GPR112YLGLAGDHQURINARY_TRACT89p.D89Yc.265G>TMissense_Mutation10.11SW780N100N
HSP90B1DEEETAKESURINARY_TRACT787p.E791delc.2362_2364delGAAIn_Frame_Del121.79ACCSN300N
HSP90B1DEEETAKESURINARY_TRACT787p.E791delc.2362_2364delGAAIn_Frame_Del121.79JMSU1N300N
HSP90B1DEEETAKESURINARY_TRACT787p.E791delc.2362_2364delGAAIn_Frame_Del121.79KMBC2N300N
HSP90B1DEEETAKESURINARY_TRACT787p.E791delc.2362_2364delGAAIn_Frame_Del121.79KU1919N300N
HSP90B1DEEETAKESURINARY_TRACT787p.E791delc.2362_2364delGAAIn_Frame_Del121.79RT11284N300N
HSP90B1DEEETAKESURINARY_TRACT787p.E791delc.2362_2364delGAAIn_Frame_Del121.79RT112N300N
HSP90B1DVGTDEEETURINARY_TRACT783p.E791delc.2362_2364delGAAIn_Frame_Del121.79ACCSN200N
HSP90B1DVGTDEEETURINARY_TRACT783p.E791delc.2362_2364delGAAIn_Frame_Del121.79JMSU1N200N
HSP90B1DVGTDEEETURINARY_TRACT783p.E791delc.2362_2364delGAAIn_Frame_Del121.79KMBC2N200N
HSP90B1DVGTDEEETURINARY_TRACT783p.E791delc.2362_2364delGAAIn_Frame_Del121.79KU1919N200N
HSP90B1DVGTDEEETURINARY_TRACT783p.E791delc.2362_2364delGAAIn_Frame_Del121.79RT11284N200N
HSP90B1DVGTDEEETURINARY_TRACT783p.E791delc.2362_2364delGAAIn_Frame_Del121.79RT112N200N
HSP90B1GTDEEETAKURINARY_TRACT785p.E791delc.2362_2364delGAAIn_Frame_Del321.79ACCSN400N
HSP90B1GTDEEETAKURINARY_TRACT785p.E791delc.2362_2364delGAAIn_Frame_Del321.79JMSU1N400N
HSP90B1GTDEEETAKURINARY_TRACT785p.E791delc.2362_2364delGAAIn_Frame_Del321.79KMBC2N400N
HSP90B1GTDEEETAKURINARY_TRACT785p.E791delc.2362_2364delGAAIn_Frame_Del321.79KU1919N400N
HSP90B1GTDEEETAKURINARY_TRACT785p.E791delc.2362_2364delGAAIn_Frame_Del321.79RT11284N400N
HSP90B1GTDEEETAKURINARY_TRACT785p.E791delc.2362_2364delGAAIn_Frame_Del321.79RT112N400N
HSP90B1TDEEETAKEURINARY_TRACT786p.E791delc.2362_2364delGAAIn_Frame_Del221.79ACCSN000N
HSP90B1TDEEETAKEURINARY_TRACT786p.E791delc.2362_2364delGAAIn_Frame_Del221.79JMSU1N000N
HSP90B1TDEEETAKEURINARY_TRACT786p.E791delc.2362_2364delGAAIn_Frame_Del221.79KMBC2N000N
HSP90B1TDEEETAKEURINARY_TRACT786p.E791delc.2362_2364delGAAIn_Frame_Del221.79KU1919N000N
HSP90B1TDEEETAKEURINARY_TRACT786p.E791delc.2362_2364delGAAIn_Frame_Del221.79RT11284N000N
HSP90B1TDEEETAKEURINARY_TRACT786p.E791delc.2362_2364delGAAIn_Frame_Del221.79RT112N000N
HSP90B1VGTDEEETAURINARY_TRACT784p.E791delc.2362_2364delGAAIn_Frame_Del221.79ACCSN100N
HSP90B1VGTDEEETAURINARY_TRACT784p.E791delc.2362_2364delGAAIn_Frame_Del221.79JMSU1N100N
HSP90B1VGTDEEETAURINARY_TRACT784p.E791delc.2362_2364delGAAIn_Frame_Del221.79KMBC2N100N
HSP90B1VGTDEEETAURINARY_TRACT784p.E791delc.2362_2364delGAAIn_Frame_Del221.79KU1919N100N
HSP90B1VGTDEEETAURINARY_TRACT784p.E791delc.2362_2364delGAAIn_Frame_Del221.79RT11284N100N
HSP90B1VGTDEEETAURINARY_TRACT784p.E791delc.2362_2364delGAAIn_Frame_Del221.79RT112N100N
HSP90B1AQEDGQSISURINARY_TRACT181p.T188Ic.563C>TMissense_Mutation10.11ACCSN000N
HSP90B1DGQSISELIURINARY_TRACT184p.T188Ic.563C>TMissense_Mutation10.11ACCSN700N
HSP90B1EAQEDGQSIURINARY_TRACT180p.T188Ic.563C>TMissense_Mutation10.11ACCSN500N
HSP90B1EDGQSISELURINARY_TRACT183p.T188Ic.563C>TMissense_Mutation10.11ACCSN600N
HSP90B1GQSISELIGURINARY_TRACT185p.T188Ic.563C>TMissense_Mutation10.11ACCSN000N
HSP90B1ISELIGQFGURINARY_TRACT188p.T188Ic.563C>TMissense_Mutation10.11ACCSN100N
HSP90B1QEDGQSISEURINARY_TRACT182p.T188Ic.563C>TMissense_Mutation10.11ACCSN000N
HSP90B1QSISELIGQURINARY_TRACT186p.T188Ic.563C>TMissense_Mutation10.11ACCSN000N
HSP90B1SISELIGQFURINARY_TRACT187p.T188Ic.563C>TMissense_Mutation10.11ACCSN600N
JAK2AGRCNLKLIURINARY_TRACT920p.R923Cc.2767C>TMissense_Mutation10.11UMUC1Y990N
JAK2CNLKLIMEYURINARY_TRACT923p.R923Cc.2767C>TMissense_Mutation10.11UMUC1N600N
JAK2CYSAGRCNLURINARY_TRACT917p.R923Cc.2767C>TMissense_Mutation10.11UMUC1Y690N
JAK2GRCNLKLIMURINARY_TRACT921p.R923Cc.2767C>TMissense_Mutation10.11UMUC1N300N
JAK2GVCYSAGRCURINARY_TRACT915p.R923Cc.2767C>TMissense_Mutation10.11UMUC1N000N
JAK2RCNLKLIMEURINARY_TRACT922p.R923Cc.2767C>TMissense_Mutation10.11UMUC1N000N
JAK2SAGRCNLKLURINARY_TRACT919p.R923Cc.2767C>TMissense_Mutation10.11UMUC1N1000N
JAK2VCYSAGRCNURINARY_TRACT916p.R923Cc.2767C>TMissense_Mutation10.11UMUC1N000N
JAK2YSAGRCNLKURINARY_TRACT918p.R923Cc.2767C>TMissense_Mutation10.11UMUC1Y3100N
MAML2DQRRNVGIMURINARY_TRACT803p.N810Ic.2429A>TMissense_Mutation10.11639VY8100Y
MAML2GIMQPTAQYURINARY_TRACT809p.N810Ic.2429A>TMissense_Mutation10.11639VN400N
MAML2IMQPTAQYSURINARY_TRACT810p.N810Ic.2429A>TMissense_Mutation10.11639VN000N
MAML2KDQRRNVGIURINARY_TRACT802p.N810Ic.2429A>TMissense_Mutation10.11639VN400N
MAML2NVGIMQPTAURINARY_TRACT807p.N810Ic.2429A>TMissense_Mutation10.11639VN100N
MAML2QRRNVGIMQURINARY_TRACT804p.N810Ic.2429A>TMissense_Mutation10.11639VN100N
MAML2RNVGIMQPTURINARY_TRACT806p.N810Ic.2429A>TMissense_Mutation10.11639VN000N
MAML2RRNVGIMQPURINARY_TRACT805p.N810Ic.2429A>TMissense_Mutation10.11639VN200N
MAML2VGIMQPTAQURINARY_TRACT808p.N810Ic.2429A>TMissense_Mutation10.11639VN0035N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44253JBVN000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44253JN000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.445637N000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44639VN000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44647VN000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44ACCSN000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44BFTC905N000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44CAL29N000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HS172TN000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HT1376N000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44J82N000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KU1919N000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44RT11284N000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44RT112N000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44RT4N000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SCABERN000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SW1710N000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SW780N000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44UBLC1N000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44UMUC1N000N
MAP3K1STTTTTTTEURINARY_TRACT941p.T949delc.2822_2824delCAAIn_Frame_Del176.44UMUC3N000N
MAP3K4GGSLPKKSVURINARY_TRACT171p.I179Vc.535A>GMissense_Mutation10.115637N500N
MAP3K4GSLPKKSVPURINARY_TRACT172p.I179Vc.535A>GMissense_Mutation10.115637N000N
MAP3K4KKSVPDVDLURINARY_TRACT176p.I179Vc.535A>GMissense_Mutation10.115637N400N
MAP3K4KSVPDVDLNURINARY_TRACT177p.I179Vc.535A>GMissense_Mutation10.115637N100N
MAP3K4LPKKSVPDVURINARY_TRACT174p.I179Vc.535A>GMissense_Mutation10.115637N1300N
MAP3K4PKKSVPDVDURINARY_TRACT175p.I179Vc.535A>GMissense_Mutation10.115637N000N
MAP3K4SLPKKSVPDURINARY_TRACT173p.I179Vc.535A>GMissense_Mutation10.115637N000N
MAP3K4SVPDVDLNKURINARY_TRACT178p.I179Vc.535A>GMissense_Mutation10.115637Y4120N
MAP3K4VPDVDLNKPURINARY_TRACT179p.I179Vc.535A>GMissense_Mutation10.115637N100N
METEECKEALAKURINARY_TRACT24p.G24Ec.71G>AMissense_Mutation10.22UMUC1N000N
METFTLVQRSNEURINARY_TRACT16p.G24Ec.71G>AMissense_Mutation10.22UMUC1N202N
METLVQRSNEECURINARY_TRACT18p.G24Ec.71G>AMissense_Mutation10.22UMUC1N002N
METNEECKEALAURINARY_TRACT23p.G24Ec.71G>AMissense_Mutation10.22UMUC1N600N
METQRSNEECKEURINARY_TRACT20p.G24Ec.71G>AMissense_Mutation10.22UMUC1N100N
METRSNEECKEAURINARY_TRACT21p.G24Ec.71G>AMissense_Mutation10.22UMUC1N300N
METSNEECKEALURINARY_TRACT22p.G24Ec.71G>AMissense_Mutation10.22UMUC1N500N
METTLVQRSNEEURINARY_TRACT17p.G24Ec.71G>AMissense_Mutation10.22UMUC1N000N
METVQRSNEECKURINARY_TRACT19p.G24Ec.71G>AMissense_Mutation10.22UMUC1N300N
MLH1DGRKEGLAEURINARY_TRACT601p.P603Rc.1808C>GMissense_Mutation10.11HT1376N000N
MLH1EDGRKEGLAURINARY_TRACT600p.P603Rc.1808C>GMissense_Mutation10.11HT1376N400N
MLH1EEDGRKEGLURINARY_TRACT599p.P603Rc.1808C>GMissense_Mutation10.11HT1376N600N
MLH1GRKEGLAEYURINARY_TRACT602p.P603Rc.1808C>GMissense_Mutation10.11HT1376Y3100N
MLH1GWTEEDGRKURINARY_TRACT596p.P603Rc.1808C>GMissense_Mutation10.11HT1376N000N
MLH1RKEGLAEYIURINARY_TRACT603p.P603Rc.1808C>GMissense_Mutation10.11HT1376Y1170N
MLH1SGWTEEDGRURINARY_TRACT595p.P603Rc.1808C>GMissense_Mutation10.11HT1376N100N
MLH1TEEDGRKEGURINARY_TRACT598p.P603Rc.1808C>GMissense_Mutation10.11HT1376N000N
MLH1WTEEDGRKEURINARY_TRACT597p.P603Rc.1808C>GMissense_Mutation10.11HT1376N100N
MLL3CVSVEPKKRURINARY_TRACT2789p.K2797fsc.8390_8390delAFrame_Shift_Del12.1639VN400N
MLL3EPKKRNKKTURINARY_TRACT2793p.K2797fsc.8390_8390delAFrame_Shift_Del52.1639VN600N
MLL3FSLINIHHRURINARY_TRACT2805p.K2797fsc.8390_8390delAFrame_Shift_Del52.1639VY695N
MLL3HHRKNPLLPURINARY_TRACT2811p.K2797fsc.8390_8390delAFrame_Shift_Del42.1639VN000Y
MLL3HRKNPLLPMURINARY_TRACT2812p.K2797fsc.8390_8390delAFrame_Shift_Del42.1639VY490N
MLL3IHHRKNPLLURINARY_TRACT2810p.K2797fsc.8390_8390delAFrame_Shift_Del42.1639VN700Y
MLL3INIHHRKNPURINARY_TRACT2808p.K2797fsc.8390_8390delAFrame_Shift_Del52.1639VN0011Y
MLL3KKRNKKTKLURINARY_TRACT2795p.K2797fsc.8390_8390delAFrame_Shift_Del42.1639VN500N
MLL3KKTKLWFSLURINARY_TRACT2799p.K2797fsc.8390_8390delAFrame_Shift_Del52.1639VN500N
MLL3KLWFSLINIURINARY_TRACT2802p.K2797fsc.8390_8390delAFrame_Shift_Del52.1639VY12120N
MLL3KRNKKTKLWURINARY_TRACT2796p.K2797fsc.8390_8390delAFrame_Shift_Del52.1639VY490N
MLL3KTKLWFSLIURINARY_TRACT2800p.K2797fsc.8390_8390delAFrame_Shift_Del52.1639VY7120N
MLL3LINIHHRKNURINARY_TRACT2807p.K2797fsc.8390_8390delAFrame_Shift_Del62.1639VN001N
MLL3LWFSLINIHURINARY_TRACT2803p.K2797fsc.8390_8390delAFrame_Shift_Del52.1639VN004N
MLL3NIHHRKNPLURINARY_TRACT2809p.K2797fsc.8390_8390delAFrame_Shift_Del52.1639VN800N
MLL3NKKTKLWFSURINARY_TRACT2798p.K2797fsc.8390_8390delAFrame_Shift_Del42.1639VN100N
MLL3PKKRNKKTKURINARY_TRACT2794p.K2797fsc.8390_8390delAFrame_Shift_Del42.1639VN100N
MLL3RKNPLLPMRURINARY_TRACT2813p.K2797fsc.8390_8390delAFrame_Shift_Del42.1639VN100N
MLL3RNKKTKLWFURINARY_TRACT2797p.K2797fsc.8390_8390delAFrame_Shift_Del52.1639VY5110N
MLL3SLINIHHRKURINARY_TRACT2806p.K2797fsc.8390_8390delAFrame_Shift_Del62.1639VY6130N
MLL3SVEPKKRNKURINARY_TRACT2791p.K2797fsc.8390_8390delAFrame_Shift_Del32.1639VN300N
MLL3TKLWFSLINURINARY_TRACT2801p.K2797fsc.8390_8390delAFrame_Shift_Del52.1639VN100N
MLL3VEPKKRNKKURINARY_TRACT2792p.K2797fsc.8390_8390delAFrame_Shift_Del42.1639VN106N
MLL3VSVEPKKRNURINARY_TRACT2790p.K2797fsc.8390_8390delAFrame_Shift_Del22.1639VN100N
MLL3WFSLINIHHURINARY_TRACT2804p.K2797fsc.8390_8390delAFrame_Shift_Del52.1639VN2015N
MLL3DGILSPELHURINARY_TRACT1489p.D1497Hc.4489G>CMissense_Mutation10.11CAL29N000N
MLL3ELGRKDVEDURINARY_TRACT1514p.G1517Rc.4549G>AMissense_Mutation10.11J82N000Y
MLL3ELHKMVTDGURINARY_TRACT1495p.D1497Hc.4489G>CMissense_Mutation10.11CAL29N000N
MLL3GILSPELHKURINARY_TRACT1490p.D1497Hc.4489G>CMissense_Mutation10.11CAL29Y4110N
MLL3GRKDVEDLFURINARY_TRACT1516p.G1517Rc.4549G>AMissense_Mutation10.11J82N400N
MLL3HKMVTDGAIURINARY_TRACT1497p.D1497Hc.4489G>CMissense_Mutation10.11CAL29N200N
MLL3IKKRYRKMKURINARY_TRACT1344p.R1351Mc.4052G>TMissense_Mutation10.11CAL29N106N
MLL3ILSPELHKMURINARY_TRACT1491p.D1497Hc.4489G>CMissense_Mutation10.11CAL29N800N
MLL3IPELGRKDVURINARY_TRACT1512p.G1517Rc.4549G>AMissense_Mutation10.11J82N1000N
MLL3KIKKRYRKMURINARY_TRACT1343p.R1351Mc.4052G>TMissense_Mutation10.11CAL29Y490N
MLL3KIPELGRKDURINARY_TRACT1511p.G1517Rc.4549G>AMissense_Mutation10.11J82N000N
MLL3KKRYRKMKNURINARY_TRACT1345p.R1351Mc.4052G>TMissense_Mutation10.11CAL29N200N
MLL3KMKNKLEETURINARY_TRACT1350p.R1351Mc.4052G>TMissense_Mutation10.11CAL29N300N
MLL3KRYRKMKNKURINARY_TRACT1346p.R1351Mc.4052G>TMissense_Mutation10.11CAL29Y2120N
MLL3LGRKDVEDLURINARY_TRACT1515p.G1517Rc.4549G>AMissense_Mutation10.11J82N901Y
MLL3LHKMVTDGAURINARY_TRACT1496p.D1497Hc.4489G>CMissense_Mutation10.11CAL29N108N
MLL3LSPELHKMVURINARY_TRACT1492p.D1497Hc.4489G>CMissense_Mutation10.11CAL29N700N
MLL3LYKIPELGRURINARY_TRACT1509p.G1517Rc.4549G>AMissense_Mutation10.11J82N302N
MLL3MKNKLEETFURINARY_TRACT1351p.R1351Mc.4052G>TMissense_Mutation10.11CAL29N500N
MLL3PELGRKDVEURINARY_TRACT1513p.G1517Rc.4549G>AMissense_Mutation10.11J82N000N
MLL3PELHKMVTDURINARY_TRACT1494p.D1497Hc.4489G>CMissense_Mutation10.11CAL29N000N
MLL3RKDVEDLFTURINARY_TRACT1517p.G1517Rc.4549G>AMissense_Mutation10.11J82N100N
MLL3RKMKNKLEEURINARY_TRACT1349p.R1351Mc.4052G>TMissense_Mutation10.11CAL29N000N
MLL3RYRKMKNKLURINARY_TRACT1347p.R1351Mc.4052G>TMissense_Mutation10.11CAL29Y7100N
MLL3SPELHKMVTURINARY_TRACT1493p.D1497Hc.4489G>CMissense_Mutation10.11CAL29N400N
MLL3YKIPELGRKURINARY_TRACT1510p.G1517Rc.4549G>AMissense_Mutation10.11J82N303N
MLL3YRKMKNKLEURINARY_TRACT1348p.R1351Mc.4052G>TMissense_Mutation10.11CAL29N2015N
MLL3ASSQERTPYURINARY_TRACT1685p.A1691Tc.5071G>AMissense_Mutation10.22RT11284N600N
MLL3ASSQERTPYURINARY_TRACT1685p.A1691Tc.5071G>AMissense_Mutation10.22RT112N600N
MLL3ERTPYVQKAURINARY_TRACT1689p.A1691Tc.5071G>AMissense_Mutation10.22RT11284Y1110N
MLL3ERTPYVQKAURINARY_TRACT1689p.A1691Tc.5071G>AMissense_Mutation10.22RT112Y1110N
MLL3KASSQERTPURINARY_TRACT1684p.A1691Tc.5071G>AMissense_Mutation10.22RT11284N000N
MLL3KASSQERTPURINARY_TRACT1684p.A1691Tc.5071G>AMissense_Mutation10.22RT112N000N
MLL3QERTPYVQKURINARY_TRACT1688p.A1691Tc.5071G>AMissense_Mutation10.22RT11284Y1130N
MLL3QERTPYVQKURINARY_TRACT1688p.A1691Tc.5071G>AMissense_Mutation10.22RT112Y1130N
MLL3RKASSQERTURINARY_TRACT1683p.A1691Tc.5071G>AMissense_Mutation10.22RT11284N100N
MLL3RKASSQERTURINARY_TRACT1683p.A1691Tc.5071G>AMissense_Mutation10.22RT112N100N
MLL3RTPYVQKARURINARY_TRACT1690p.A1691Tc.5071G>AMissense_Mutation10.22RT11284N500N
MLL3RTPYVQKARURINARY_TRACT1690p.A1691Tc.5071G>AMissense_Mutation10.22RT112N500N
MLL3SQERTPYVQURINARY_TRACT1687p.A1691Tc.5071G>AMissense_Mutation10.22RT11284N000N
MLL3SQERTPYVQURINARY_TRACT1687p.A1691Tc.5071G>AMissense_Mutation10.22RT112N000N
MLL3SSQERTPYVURINARY_TRACT1686p.A1691Tc.5071G>AMissense_Mutation10.22RT11284N700N
MLL3SSQERTPYVURINARY_TRACT1686p.A1691Tc.5071G>AMissense_Mutation10.22RT112N700N
MLL3TPYVQKARDURINARY_TRACT1691p.A1691Tc.5071G>AMissense_Mutation10.22RT11284N200N
MLL3TPYVQKARDURINARY_TRACT1691p.A1691Tc.5071G>AMissense_Mutation10.22RT112N200N
MSH3GAAAAAAPPURINARY_TRACT50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94ACCSN000N
MSH3GAAAAAAPPURINARY_TRACT50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94CAL29N000N
MSH3PGAAAAAAPURINARY_TRACT49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94ACCSN000N
MSH3PGAAAAAAPURINARY_TRACT49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94CAL29N000N
MSH3AAAAPPAPAURINARY_TRACT59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23253JN200N
MSH3AAAAPPAPAURINARY_TRACT53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23ACCSN200N
MSH3AAAAPPAPAURINARY_TRACT53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23CAL29N200N
MSH3AAAAPPAPAURINARY_TRACT59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23CAL29N200N
MSH3AAAAPPAPAURINARY_TRACT59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23SW780N200N
MSH3AAAPPAPAFURINARY_TRACT60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23253JY8100N
MSH3AAAPPAPAFURINARY_TRACT54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23ACCSY8100N
MSH3AAAPPAPAFURINARY_TRACT54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23CAL29Y8100N
MSH3AAAPPAPAFURINARY_TRACT60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23CAL29Y8100N
MSH3AAAPPAPAFURINARY_TRACT60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23SW780Y8100N
MSH3AAPPAPAFPURINARY_TRACT61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23253JN000N
MSH3AAPPAPAFPURINARY_TRACT55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23ACCSN000N
MSH3AAPPAPAFPURINARY_TRACT55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23CAL29N000N
MSH3AAPPAPAFPURINARY_TRACT61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23CAL29N000N
MSH3AAPPAPAFPURINARY_TRACT61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23SW780N000N
MSH6LLPEDTPPSURINARY_TRACT1080p.T1085fsc.3254_3254delCFrame_Shift_Del11.44639VN106Y
MSH6AVECIAVLMURINARY_TRACT1050p.L1057fsc.3171_3171delGFrame_Shift_Del10.11639VN300N
MSH6AVLMFYCAWURINARY_TRACT1055p.L1057fsc.3171_3171delGFrame_Shift_Del60.11639VY190N
MSH6AWLTIVEGVURINARY_TRACT1062p.L1057fsc.3171_3171delGFrame_Shift_Del60.11639VN400N
MSH6CAWLTIVEGURINARY_TRACT1061p.L1057fsc.3171_3171delGFrame_Shift_Del60.11639VN000N
MSH6CIAVLMFYCURINARY_TRACT1053p.L1057fsc.3171_3171delGFrame_Shift_Del40.11639VY190N
MSH6ECIAVLMFYURINARY_TRACT1052p.L1057fsc.3171_3171delGFrame_Shift_Del30.11639VN700N
MSH6EGVMVLCVAURINARY_TRACT1068p.L1057fsc.3171_3171delGFrame_Shift_Del50.11639VN200N
MSH6FYCAWLTIVURINARY_TRACT1059p.L1057fsc.3171_3171delGFrame_Shift_Del50.11639VY790N
MSH6GVMVLCVAQURINARY_TRACT1069p.L1057fsc.3171_3171delGFrame_Shift_Del50.11639VN000N
MSH6IAVLMFYCAURINARY_TRACT1054p.L1057fsc.3171_3171delGFrame_Shift_Del50.11639VN900N
MSH6IVEGVMVLCURINARY_TRACT1066p.L1057fsc.3171_3171delGFrame_Shift_Del50.11639VN100N
MSH6LMFYCAWLTURINARY_TRACT1057p.L1057fsc.3171_3171delGFrame_Shift_Del60.11639VN705N
MSH6LTIVEGVMVURINARY_TRACT1064p.L1057fsc.3171_3171delGFrame_Shift_Del50.11639VN604N
MSH6MFYCAWLTIURINARY_TRACT1058p.L1057fsc.3171_3171delGFrame_Shift_Del50.11639VY12104N
MSH6TIVEGVMVLURINARY_TRACT1065p.L1057fsc.3171_3171delGFrame_Shift_Del50.11639VY16100N
MSH6VECIAVLMFURINARY_TRACT1051p.L1057fsc.3171_3171delGFrame_Shift_Del20.11639VY81110N
MSH6VEGVMVLCVURINARY_TRACT1067p.L1057fsc.3171_3171delGFrame_Shift_Del40.11639VN1008N
MSH6VLMFYCAWLURINARY_TRACT1056p.L1057fsc.3171_3171delGFrame_Shift_Del60.11639VN13025N
MSH6WLTIVEGVMURINARY_TRACT1063p.L1057fsc.3171_3171delGFrame_Shift_Del50.11639VN600N
MSH6YCAWLTIVEURINARY_TRACT1060p.L1057fsc.3171_3171delGFrame_Shift_Del50.11639VN203N
MYLKASKELKKDVURINARY_TRACT1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02BFTC905N400N
MYLKASKELKKDVURINARY_TRACT1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KU1919N400N
MYLKKELKKDVKNURINARY_TRACT1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02BFTC905N500N
MYLKKELKKDVKNURINARY_TRACT1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KU1919N500N
MYLKKSASKELKKURINARY_TRACT1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02BFTC905N400N
MYLKKSASKELKKURINARY_TRACT1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KU1919N400N
MYLKLKSASKELKURINARY_TRACT1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02BFTC905N105N
MYLKLKSASKELKURINARY_TRACT1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KU1919N105N
MYLKNLKSASKELURINARY_TRACT1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02BFTC905Y5100N
MYLKNLKSASKELURINARY_TRACT1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KU1919Y5100N
MYLKSASKELKKDURINARY_TRACT1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02BFTC905N000N
MYLKSASKELKKDURINARY_TRACT1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KU1919N000N
MYLKSKELKKDVKURINARY_TRACT1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02BFTC905N200N
MYLKSKELKKDVKURINARY_TRACT1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KU1919N200N
MYST4ANSASLFTPURINARY_TRACT1844p.S1850Fc.5549C>TMissense_Mutation10.11CAL29N000N
MYST4ASLFTPLSNURINARY_TRACT1847p.S1850Fc.5549C>TMissense_Mutation10.11CAL29N000N
MYST4FTPLSNTGLURINARY_TRACT1850p.S1850Fc.5549C>TMissense_Mutation10.11CAL29N1103N
MYST4LFTPLSNTGURINARY_TRACT1849p.S1850Fc.5549C>TMissense_Mutation10.11CAL29N000N
MYST4NSASLFTPLURINARY_TRACT1845p.S1850Fc.5549C>TMissense_Mutation10.11CAL29N1100N
MYST4SASLFTPLSURINARY_TRACT1846p.S1850Fc.5549C>TMissense_Mutation10.11CAL29N100Y
MYST4SLFTPLSNTURINARY_TRACT1848p.S1850Fc.5549C>TMissense_Mutation10.11CAL29N600N
MYST4SYANSASLFURINARY_TRACT1842p.S1850Fc.5549C>TMissense_Mutation10.11CAL29Y6110N
MYST4YANSASLFTURINARY_TRACT1843p.S1850Fc.5549C>TMissense_Mutation10.11CAL29N705N
MYST4HSQRLQTQVURINARY_TRACT1909p.I1917Vc.5749A>GMissense_Mutation10.22253JBVN300N
MYST4HSQRLQTQVURINARY_TRACT1909p.I1917Vc.5749A>GMissense_Mutation10.22253JN300N
MYST4LQTQVASKGURINARY_TRACT1913p.I1917Vc.5749A>GMissense_Mutation10.22253JBVN000N
MYST4LQTQVASKGURINARY_TRACT1913p.I1917Vc.5749A>GMissense_Mutation10.22253JN000N
MYST4QRLQTQVASURINARY_TRACT1911p.I1917Vc.5749A>GMissense_Mutation10.22253JBVN300N
MYST4QRLQTQVASURINARY_TRACT1911p.I1917Vc.5749A>GMissense_Mutation10.22253JN300N
MYST4QTQVASKGHURINARY_TRACT1914p.I1917Vc.5749A>GMissense_Mutation10.22253JBVN000N
MYST4QTQVASKGHURINARY_TRACT1914p.I1917Vc.5749A>GMissense_Mutation10.22253JN000N
MYST4QVASKGHISURINARY_TRACT1916p.I1917Vc.5749A>GMissense_Mutation10.22253JBVN000N
MYST4QVASKGHISURINARY_TRACT1916p.I1917Vc.5749A>GMissense_Mutation10.22253JN000N
MYST4RLQTQVASKURINARY_TRACT1912p.I1917Vc.5749A>GMissense_Mutation10.22253JBVY6160N
MYST4RLQTQVASKURINARY_TRACT1912p.I1917Vc.5749A>GMissense_Mutation10.22253JY6160N
MYST4SQRLQTQVAURINARY_TRACT1910p.I1917Vc.5749A>GMissense_Mutation10.22253JBVN200N
MYST4SQRLQTQVAURINARY_TRACT1910p.I1917Vc.5749A>GMissense_Mutation10.22253JN200N
MYST4TQVASKGHIURINARY_TRACT1915p.I1917Vc.5749A>GMissense_Mutation10.22253JBVN900N
MYST4TQVASKGHIURINARY_TRACT1915p.I1917Vc.5749A>GMissense_Mutation10.22253JN900N
MYST4VASKGHISMURINARY_TRACT1917p.I1917Vc.5749A>GMissense_Mutation10.22253JBVN701N
MYST4VASKGHISMURINARY_TRACT1917p.I1917Vc.5749A>GMissense_Mutation10.22253JN701N
MYST4DDSGNLKEGURINARY_TRACT1226p.S1229Gc.3685A>GMissense_Mutation10.33BFTC905N000N
MYST4DSGNLKEGSURINARY_TRACT1227p.S1229Gc.3685A>GMissense_Mutation10.33BFTC905N100N
MYST4GNLKEGSKDURINARY_TRACT1229p.S1229Gc.3685A>GMissense_Mutation10.33BFTC905N000N
MYST4MNDDSGNLKURINARY_TRACT1224p.S1229Gc.3685A>GMissense_Mutation10.33BFTC905N100N
MYST4NDDSGNLKEURINARY_TRACT1225p.S1229Gc.3685A>GMissense_Mutation10.33BFTC905N000N
MYST4NMNDDSGNLURINARY_TRACT1223p.S1229Gc.3685A>GMissense_Mutation10.33BFTC905N1100N
MYST4NNMNDDSGNURINARY_TRACT1222p.S1229Gc.3685A>GMissense_Mutation10.33BFTC905N000N
MYST4RNNMNDDSGURINARY_TRACT1221p.S1229Gc.3685A>GMissense_Mutation10.33BFTC905N000N
MYST4SGNLKEGSKURINARY_TRACT1228p.S1229Gc.3685A>GMissense_Mutation10.33BFTC905N000N
NF1AKWEQATKPURINARY_TRACT782p.L790Pc.2369T>CMissense_Mutation10.22RT11284N000N
NF1AKWEQATKPURINARY_TRACT782p.L790Pc.2369T>CMissense_Mutation10.22RT112N000N
NF1ATKPILNYPURINARY_TRACT787p.L790Pc.2369T>CMissense_Mutation10.22RT11284N000N
NF1ATKPILNYPURINARY_TRACT787p.L790Pc.2369T>CMissense_Mutation10.22RT112N000N
NF1DSIPQHTNIURINARY_TRACT1837p.K1844Nc.5532G>TMissense_Mutation10.22RT11284N1000N
NF1DSIPQHTNIURINARY_TRACT1837p.K1844Nc.5532G>TMissense_Mutation10.22RT112N1000N
NF1EQATKPILNURINARY_TRACT785p.L790Pc.2369T>CMissense_Mutation10.22RT11284N000N
NF1EQATKPILNURINARY_TRACT785p.L790Pc.2369T>CMissense_Mutation10.22RT112N000N
NF1HTNIRPKDVURINARY_TRACT1842p.K1844Nc.5532G>TMissense_Mutation10.22RT11284N300N
NF1HTNIRPKDVURINARY_TRACT1842p.K1844Nc.5532G>TMissense_Mutation10.22RT112N300N
NF1IPQHTNIRPURINARY_TRACT1839p.K1844Nc.5532G>TMissense_Mutation10.22RT11284N200N
NF1IPQHTNIRPURINARY_TRACT1839p.K1844Nc.5532G>TMissense_Mutation10.22RT112N200N
NF1KPILNYPKAURINARY_TRACT789p.L790Pc.2369T>CMissense_Mutation10.22RT11284N1000N
NF1KPILNYPKAURINARY_TRACT789p.L790Pc.2369T>CMissense_Mutation10.22RT112N1000N
NF1KWEQATKPIURINARY_TRACT783p.L790Pc.2369T>CMissense_Mutation10.22RT11284N500N
NF1KWEQATKPIURINARY_TRACT783p.L790Pc.2369T>CMissense_Mutation10.22RT112N500N
NF1NIRPKDVPGURINARY_TRACT1844p.K1844Nc.5532G>TMissense_Mutation10.22RT11284N000N
NF1NIRPKDVPGURINARY_TRACT1844p.K1844Nc.5532G>TMissense_Mutation10.22RT112N000N
NF1PDSIPQHTNURINARY_TRACT1836p.K1844Nc.5532G>TMissense_Mutation10.22RT11284N000N
NF1PDSIPQHTNURINARY_TRACT1836p.K1844Nc.5532G>TMissense_Mutation10.22RT112N000N
NF1PILNYPKAKURINARY_TRACT790p.L790Pc.2369T>CMissense_Mutation10.22RT11284N100N
NF1PILNYPKAKURINARY_TRACT790p.L790Pc.2369T>CMissense_Mutation10.22RT112N100N
NF1PQHTNIRPKURINARY_TRACT1840p.K1844Nc.5532G>TMissense_Mutation10.22RT11284N000N
NF1PQHTNIRPKURINARY_TRACT1840p.K1844Nc.5532G>TMissense_Mutation10.22RT112N000N
NF1QATKPILNYURINARY_TRACT786p.L790Pc.2369T>CMissense_Mutation10.22RT11284N500N
NF1QATKPILNYURINARY_TRACT786p.L790Pc.2369T>CMissense_Mutation10.22RT112N500N
NF1QHTNIRPKDURINARY_TRACT1841p.K1844Nc.5532G>TMissense_Mutation10.22RT11284N000N
NF1QHTNIRPKDURINARY_TRACT1841p.K1844Nc.5532G>TMissense_Mutation10.22RT112N000N
NF1SIPQHTNIRURINARY_TRACT1838p.K1844Nc.5532G>TMissense_Mutation10.22RT11284N400N
NF1SIPQHTNIRURINARY_TRACT1838p.K1844Nc.5532G>TMissense_Mutation10.22RT112N400N
NF1TKPILNYPKURINARY_TRACT788p.L790Pc.2369T>CMissense_Mutation10.22RT11284N100N
NF1TKPILNYPKURINARY_TRACT788p.L790Pc.2369T>CMissense_Mutation10.22RT112N100N
NF1TNIRPKDVPURINARY_TRACT1843p.K1844Nc.5532G>TMissense_Mutation10.22RT11284N000N
NF1TNIRPKDVPURINARY_TRACT1843p.K1844Nc.5532G>TMissense_Mutation10.22RT112N000N
NF1WEQATKPILURINARY_TRACT784p.L790Pc.2369T>CMissense_Mutation10.22RT11284Y1190N
NF1WEQATKPILURINARY_TRACT784p.L790Pc.2369T>CMissense_Mutation10.22RT112Y1190N
NF2EMREERITAURINARY_TRACT182p.W184Rc.550T>AMissense_Mutation10.115637N200N
NF2LYQMTPEMRURINARY_TRACT176p.W184Rc.550T>AMissense_Mutation10.115637N202N
NF2MREERITAWURINARY_TRACT183p.W184Rc.550T>AMissense_Mutation10.115637N500N
NF2MTPEMREERURINARY_TRACT179p.W184Rc.550T>AMissense_Mutation10.115637N400N
NF2PEMREERITURINARY_TRACT181p.W184Rc.550T>AMissense_Mutation10.115637N000N
NF2QMTPEMREEURINARY_TRACT178p.W184Rc.550T>AMissense_Mutation10.115637N000N
NF2REERITAWYURINARY_TRACT184p.W184Rc.550T>AMissense_Mutation10.115637Y7160N
NF2TPEMREERIURINARY_TRACT180p.W184Rc.550T>AMissense_Mutation10.115637N1200N
NF2YQMTPEMREURINARY_TRACT177p.W184Rc.550T>AMissense_Mutation10.115637N202N
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13253JBVN101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13253JBVN101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13253JN101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.516_517insCAGIn_Frame_Ins296.135637N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13639VN101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13ACCSN101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13BFTC905N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13CAL29N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13HS172TN101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HS172TN101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13HT1376N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13J82N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13JMSU1N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KMBC2N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KU1919N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13RT11284N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13RT112N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SCABERN101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SW1710N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SW1710N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SW780N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13UBLC1N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13UMUC1N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13UMUC3N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13UMUC3N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.514_515insAACIn_Frame_Ins296.13VMCUB1N101Y
NR1H2IRKQQQQQEURINARY_TRACT170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13VMCUB1N101Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13253JBVN000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13253JBVN000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13253JN000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.516_517insCAGIn_Frame_Ins196.135637N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13639VN000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13ACCSN000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13BFTC905N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13CAL29N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13HS172TN000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HS172TN000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13HT1376N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13J82N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13JMSU1N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KMBC2N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KU1919N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13RT11284N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13RT112N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SCABERN000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SW1710N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SW1710N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SW780N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13UBLC1N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13UMUC1N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13UMUC3N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13UMUC3N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.514_515insAACIn_Frame_Ins196.13VMCUB1N000Y
NR1H2KIRKQQQQQURINARY_TRACT169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13VMCUB1N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13253JBVN000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13253JBVN000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13253JN000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.516_517insCAGIn_Frame_Ins296.135637N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13639VN000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13ACCSN000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13BFTC905N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13CAL29N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13HS172TN000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HS172TN000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13HT1376N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13J82N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13JMSU1N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KMBC2N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KU1919N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13RT11284N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13RT112N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SCABERN000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SW1710N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SW1710N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SW780N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13UBLC1N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13UMUC1N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13UMUC3N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13UMUC3N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.514_515insAACIn_Frame_Ins296.13VMCUB1N000Y
NR1H2KQQQQQESQURINARY_TRACT172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13VMCUB1N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13253JBVN000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13253JBVN000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13253JN000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.516_517insCAGIn_Frame_Ins196.135637N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13639VN000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13ACCSN000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13BFTC905N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13CAL29N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13HS172TN000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HS172TN000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13HT1376N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13J82N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13JMSU1N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KMBC2N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KU1919N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13RT11284N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13RT112N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SCABERN000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SW1710N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SW1710N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SW780N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13UBLC1N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13UMUC1N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13UMUC3N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13UMUC3N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.514_515insAACIn_Frame_Ins196.13VMCUB1N000Y
NR1H2QQQQQESQSURINARY_TRACT173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13VMCUB1N000Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13253JBVN100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13253JBVN100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13253JN100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.516_517insCAGIn_Frame_Ins396.135637N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13639VN100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13ACCSN100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13BFTC905N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13CAL29N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13HS172TN100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13HS172TN100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13HT1376N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13J82N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13JMSU1N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KMBC2N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KU1919N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13RT11284N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13RT112N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SCABERN100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SW1710N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13SW1710N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13SW780N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13UBLC1N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13UMUC1N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13UMUC3N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13UMUC3N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.514_515insAACIn_Frame_Ins396.13VMCUB1N100Y
NR1H2RKQQQQQESURINARY_TRACT171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13VMCUB1N100Y
NRASAGLEEYSAMURINARY_TRACT59p.Q61Lc.182A>TMissense_Mutation11.11BFTC905Y1090N
NRASDILDTAGLEURINARY_TRACT54p.Q61Lc.182A>TMissense_Mutation11.11BFTC905N000N
NRASDTAGLEEYSURINARY_TRACT57p.Q61Lc.182A>TMissense_Mutation11.11BFTC905N000N
NRASGLEEYSAMRURINARY_TRACT60p.Q61Lc.182A>TMissense_Mutation11.11BFTC905N800N
NRASILDTAGLEEURINARY_TRACT55p.Q61Lc.182A>TMissense_Mutation11.11BFTC905N000N
NRASLDILDTAGLURINARY_TRACT53p.Q61Lc.182A>TMissense_Mutation11.11BFTC905N804N
NRASLDTAGLEEYURINARY_TRACT56p.Q61Lc.182A>TMissense_Mutation11.11BFTC905N400N
NRASLEEYSAMRDURINARY_TRACT61p.Q61Lc.182A>TMissense_Mutation11.11BFTC905N000N
NRASTAGLEEYSAURINARY_TRACT58p.Q61Lc.182A>TMissense_Mutation11.11BFTC905N200N
NRASARELAKSYGURINARY_TRACT130p.H131Rc.392A>GMissense_Mutation10.11639VN100N
NRASDTKQARELAURINARY_TRACT126p.H131Rc.392A>GMissense_Mutation10.11639VN000N
NRASKQARELAKSURINARY_TRACT128p.H131Rc.392A>GMissense_Mutation10.11639VN200N
NRASQARELAKSYURINARY_TRACT129p.H131Rc.392A>GMissense_Mutation10.11639VN600N
NRASRELAKSYGIURINARY_TRACT131p.H131Rc.392A>GMissense_Mutation10.11639VN1000N
NRASRTVDTKQARURINARY_TRACT123p.H131Rc.392A>GMissense_Mutation10.11639VY490N
NRASTKQARELAKURINARY_TRACT127p.H131Rc.392A>GMissense_Mutation10.11639VN100N
NRASTVDTKQAREURINARY_TRACT124p.H131Rc.392A>GMissense_Mutation10.11639VN000N
NRASVDTKQARELURINARY_TRACT125p.H131Rc.392A>GMissense_Mutation10.11639VN600N
NRASAGREEYSAMURINARY_TRACT59p.Q61Rc.182A>GMissense_Mutation10.77KU1919Y7100N
NRASDILDTAGREURINARY_TRACT54p.Q61Rc.182A>GMissense_Mutation10.77KU1919N000N
NRASDTAGREEYSURINARY_TRACT57p.Q61Rc.182A>GMissense_Mutation10.77KU1919N000N
NRASGREEYSAMRURINARY_TRACT60p.Q61Rc.182A>GMissense_Mutation10.77KU1919N400N
NRASILDTAGREEURINARY_TRACT55p.Q61Rc.182A>GMissense_Mutation10.77KU1919N000N
NRASLDILDTAGRURINARY_TRACT53p.Q61Rc.182A>GMissense_Mutation10.77KU1919N003N
NRASLDTAGREEYURINARY_TRACT56p.Q61Rc.182A>GMissense_Mutation10.77KU1919N400N
NRASREEYSAMRDURINARY_TRACT61p.Q61Rc.182A>GMissense_Mutation10.77KU1919N000N
NRASTAGREEYSAURINARY_TRACT58p.Q61Rc.182A>GMissense_Mutation10.77KU1919N200N
PDE4DIPANLDQGRVRURINARY_TRACT603p.L601fsc.1801_1801delCFrame_Shift_Del615.49ACCSY2110N
PDE4DIPANLDQGRVRURINARY_TRACT603p.L601fsc.1801_1801delCFrame_Shift_Del615.49BFTC905Y2110N
PDE4DIPANLDQGRVRURINARY_TRACT603p.L601fsc.1801_1801delCFrame_Shift_Del615.49KMBC2Y2110N
PDE4DIPANLDQGRVRURINARY_TRACT603p.L601fsc.1801_1801delCFrame_Shift_Del615.49UMUC3Y2110N
PDE4DIPATCSANLDQURINARY_TRACT599p.L601fsc.1801_1801delCFrame_Shift_Del615.49ACCSN000N
PDE4DIPATCSANLDQURINARY_TRACT599p.L601fsc.1801_1801delCFrame_Shift_Del615.49BFTC905N000N
PDE4DIPATCSANLDQURINARY_TRACT599p.L601fsc.1801_1801delCFrame_Shift_Del615.49KMBC2N000N
PDE4DIPATCSANLDQURINARY_TRACT599p.L601fsc.1801_1801delCFrame_Shift_Del615.49UMUC3N000N
PDE4DIPCSANLDQGRURINARY_TRACT601p.L601fsc.1801_1801delCFrame_Shift_Del515.49ACCSN300N
PDE4DIPCSANLDQGRURINARY_TRACT601p.L601fsc.1801_1801delCFrame_Shift_Del515.49BFTC905N300N
PDE4DIPCSANLDQGRURINARY_TRACT601p.L601fsc.1801_1801delCFrame_Shift_Del515.49KMBC2N300N
PDE4DIPCSANLDQGRURINARY_TRACT601p.L601fsc.1801_1801delCFrame_Shift_Del515.49UMUC3N300N
PDE4DIPDLSATCSANURINARY_TRACT596p.L601fsc.1801_1801delCFrame_Shift_Del415.49ACCSN000N
PDE4DIPDLSATCSANURINARY_TRACT596p.L601fsc.1801_1801delCFrame_Shift_Del415.49BFTC905N000N
PDE4DIPDLSATCSANURINARY_TRACT596p.L601fsc.1801_1801delCFrame_Shift_Del415.49KMBC2N000N
PDE4DIPDLSATCSANURINARY_TRACT596p.L601fsc.1801_1801delCFrame_Shift_Del415.49UMUC3N000N
PDE4DIPEDLSATCSAURINARY_TRACT595p.L601fsc.1801_1801delCFrame_Shift_Del315.49ACCSN400N
PDE4DIPEDLSATCSAURINARY_TRACT595p.L601fsc.1801_1801delCFrame_Shift_Del315.49BFTC905N400N
PDE4DIPEDLSATCSAURINARY_TRACT595p.L601fsc.1801_1801delCFrame_Shift_Del315.49KMBC2N400N
PDE4DIPEDLSATCSAURINARY_TRACT595p.L601fsc.1801_1801delCFrame_Shift_Del315.49UMUC3N400N
PDE4DIPEVEDLSATCURINARY_TRACT593p.L601fsc.1801_1801delCFrame_Shift_Del115.49ACCSN200N
PDE4DIPEVEDLSATCURINARY_TRACT593p.L601fsc.1801_1801delCFrame_Shift_Del115.49BFTC905N200N
PDE4DIPEVEDLSATCURINARY_TRACT593p.L601fsc.1801_1801delCFrame_Shift_Del115.49KMBC2N200N
PDE4DIPEVEDLSATCURINARY_TRACT593p.L601fsc.1801_1801delCFrame_Shift_Del115.49UMUC3N200N
PDE4DIPLSATCSANLURINARY_TRACT597p.L601fsc.1801_1801delCFrame_Shift_Del415.49ACCSN1102N
PDE4DIPLSATCSANLURINARY_TRACT597p.L601fsc.1801_1801delCFrame_Shift_Del415.49BFTC905N1102N
PDE4DIPLSATCSANLURINARY_TRACT597p.L601fsc.1801_1801delCFrame_Shift_Del415.49KMBC2N1102N
PDE4DIPLSATCSANLURINARY_TRACT597p.L601fsc.1801_1801delCFrame_Shift_Del415.49UMUC3N1102N
PDE4DIPSANLDQGRVURINARY_TRACT602p.L601fsc.1801_1801delCFrame_Shift_Del515.49ACCSN400N
PDE4DIPSANLDQGRVURINARY_TRACT602p.L601fsc.1801_1801delCFrame_Shift_Del515.49BFTC905N400N
PDE4DIPSANLDQGRVURINARY_TRACT602p.L601fsc.1801_1801delCFrame_Shift_Del515.49KMBC2N400N
PDE4DIPSANLDQGRVURINARY_TRACT602p.L601fsc.1801_1801delCFrame_Shift_Del515.49UMUC3N400N
PDE4DIPSATCSANLDURINARY_TRACT598p.L601fsc.1801_1801delCFrame_Shift_Del515.49ACCSN000N
PDE4DIPSATCSANLDURINARY_TRACT598p.L601fsc.1801_1801delCFrame_Shift_Del515.49BFTC905N000N
PDE4DIPSATCSANLDURINARY_TRACT598p.L601fsc.1801_1801delCFrame_Shift_Del515.49KMBC2N000N
PDE4DIPSATCSANLDURINARY_TRACT598p.L601fsc.1801_1801delCFrame_Shift_Del515.49UMUC3N000N
PDE4DIPTCSANLDQGURINARY_TRACT600p.L601fsc.1801_1801delCFrame_Shift_Del615.49ACCSN100N
PDE4DIPTCSANLDQGURINARY_TRACT600p.L601fsc.1801_1801delCFrame_Shift_Del615.49BFTC905N100N
PDE4DIPTCSANLDQGURINARY_TRACT600p.L601fsc.1801_1801delCFrame_Shift_Del615.49KMBC2N100N
PDE4DIPTCSANLDQGURINARY_TRACT600p.L601fsc.1801_1801delCFrame_Shift_Del615.49UMUC3N100N
PDE4DIPVEDLSATCSURINARY_TRACT594p.L601fsc.1801_1801delCFrame_Shift_Del215.49ACCSN300N
PDE4DIPVEDLSATCSURINARY_TRACT594p.L601fsc.1801_1801delCFrame_Shift_Del215.49BFTC905N300N
PDE4DIPVEDLSATCSURINARY_TRACT594p.L601fsc.1801_1801delCFrame_Shift_Del215.49KMBC2N300N
PDE4DIPVEDLSATCSURINARY_TRACT594p.L601fsc.1801_1801delCFrame_Shift_Del215.49UMUC3N300N
PDE4DIPADSRKKSSKURINARY_TRACT242p.E243fsc.729_729delAFrame_Shift_Del517.59BFTC905N000Y
PDE4DIPADSRKKSSKURINARY_TRACT242p.E243fsc.729_729delAFrame_Shift_Del517.59JMSU1N000Y
PDE4DIPADSRKKSSKURINARY_TRACT242p.E243fsc.729_729delAFrame_Shift_Del517.59KMBC2N000Y
PDE4DIPADSRKKSSKURINARY_TRACT242p.E243fsc.729_729delAFrame_Shift_Del517.59UMUC3N000Y
PDE4DIPDSHLADSRKURINARY_TRACT238p.E243fsc.729_729delAFrame_Shift_Del417.59BFTC905N200N
PDE4DIPDSHLADSRKURINARY_TRACT238p.E243fsc.729_729delAFrame_Shift_Del417.59JMSU1N200N
PDE4DIPDSHLADSRKURINARY_TRACT238p.E243fsc.729_729delAFrame_Shift_Del417.59KMBC2N200N
PDE4DIPDSHLADSRKURINARY_TRACT238p.E243fsc.729_729delAFrame_Shift_Del417.59UMUC3N200N
PDE4DIPDSRKKSSKQURINARY_TRACT243p.E243fsc.729_729delAFrame_Shift_Del417.59BFTC905N200Y
PDE4DIPDSRKKSSKQURINARY_TRACT243p.E243fsc.729_729delAFrame_Shift_Del417.59JMSU1N200Y
PDE4DIPDSRKKSSKQURINARY_TRACT243p.E243fsc.729_729delAFrame_Shift_Del417.59KMBC2N200Y
PDE4DIPDSRKKSSKQURINARY_TRACT243p.E243fsc.729_729delAFrame_Shift_Del417.59UMUC3N200Y
PDE4DIPHLADSRKKSURINARY_TRACT240p.E243fsc.729_729delAFrame_Shift_Del517.59BFTC905N000N
PDE4DIPHLADSRKKSURINARY_TRACT240p.E243fsc.729_729delAFrame_Shift_Del517.59JMSU1N000N
PDE4DIPHLADSRKKSURINARY_TRACT240p.E243fsc.729_729delAFrame_Shift_Del517.59KMBC2N000N
PDE4DIPHLADSRKKSURINARY_TRACT240p.E243fsc.729_729delAFrame_Shift_Del517.59UMUC3N000N
PDE4DIPKKSSKQRPPURINARY_TRACT246p.E243fsc.729_729delAFrame_Shift_Del517.59BFTC905N100Y
PDE4DIPKKSSKQRPPURINARY_TRACT246p.E243fsc.729_729delAFrame_Shift_Del517.59JMSU1N100Y
PDE4DIPKKSSKQRPPURINARY_TRACT246p.E243fsc.729_729delAFrame_Shift_Del517.59KMBC2N100Y
PDE4DIPKKSSKQRPPURINARY_TRACT246p.E243fsc.729_729delAFrame_Shift_Del517.59UMUC3N100Y
PDE4DIPKQRPPTRFFURINARY_TRACT250p.E243fsc.729_729delAFrame_Shift_Del617.59BFTC905Y7100Y
PDE4DIPKQRPPTRFFURINARY_TRACT250p.E243fsc.729_729delAFrame_Shift_Del617.59JMSU1Y7100Y
PDE4DIPKQRPPTRFFURINARY_TRACT250p.E243fsc.729_729delAFrame_Shift_Del617.59KMBC2Y7100Y
PDE4DIPKQRPPTRFFURINARY_TRACT250p.E243fsc.729_729delAFrame_Shift_Del617.59UMUC3Y7100Y
PDE4DIPKSSKQRPPTURINARY_TRACT247p.E243fsc.729_729delAFrame_Shift_Del517.59BFTC905N200Y
PDE4DIPKSSKQRPPTURINARY_TRACT247p.E243fsc.729_729delAFrame_Shift_Del517.59JMSU1N200Y
PDE4DIPKSSKQRPPTURINARY_TRACT247p.E243fsc.729_729delAFrame_Shift_Del517.59KMBC2N200Y
PDE4DIPKSSKQRPPTURINARY_TRACT247p.E243fsc.729_729delAFrame_Shift_Del517.59UMUC3N200Y
PDE4DIPLADSRKKSSURINARY_TRACT241p.E243fsc.729_729delAFrame_Shift_Del517.59BFTC905N100N
PDE4DIPLADSRKKSSURINARY_TRACT241p.E243fsc.729_729delAFrame_Shift_Del517.59JMSU1N100N
PDE4DIPLADSRKKSSURINARY_TRACT241p.E243fsc.729_729delAFrame_Shift_Del517.59KMBC2N100N
PDE4DIPLADSRKKSSURINARY_TRACT241p.E243fsc.729_729delAFrame_Shift_Del517.59UMUC3N100N
PDE4DIPPPTRFFKRNURINARY_TRACT253p.E243fsc.729_729delAFrame_Shift_Del517.59BFTC905N000Y
PDE4DIPPPTRFFKRNURINARY_TRACT253p.E243fsc.729_729delAFrame_Shift_Del517.59JMSU1N000Y
PDE4DIPPPTRFFKRNURINARY_TRACT253p.E243fsc.729_729delAFrame_Shift_Del517.59KMBC2N000Y
PDE4DIPPPTRFFKRNURINARY_TRACT253p.E243fsc.729_729delAFrame_Shift_Del517.59UMUC3N000Y
PDE4DIPPTRFFKRNLURINARY_TRACT254p.E243fsc.729_729delAFrame_Shift_Del617.59BFTC905Y2110Y
PDE4DIPPTRFFKRNLURINARY_TRACT254p.E243fsc.729_729delAFrame_Shift_Del617.59JMSU1Y2110Y
PDE4DIPPTRFFKRNLURINARY_TRACT254p.E243fsc.729_729delAFrame_Shift_Del617.59KMBC2Y2110Y
PDE4DIPPTRFFKRNLURINARY_TRACT254p.E243fsc.729_729delAFrame_Shift_Del617.59UMUC3Y2110Y
PDE4DIPQRPPTRFFKURINARY_TRACT251p.E243fsc.729_729delAFrame_Shift_Del617.59BFTC905Y2100Y
PDE4DIPQRPPTRFFKURINARY_TRACT251p.E243fsc.729_729delAFrame_Shift_Del617.59JMSU1Y2100Y
PDE4DIPQRPPTRFFKURINARY_TRACT251p.E243fsc.729_729delAFrame_Shift_Del617.59KMBC2Y2100Y
PDE4DIPQRPPTRFFKURINARY_TRACT251p.E243fsc.729_729delAFrame_Shift_Del617.59UMUC3Y2100Y
PDE4DIPRFFKRNLMKURINARY_TRACT256p.E243fsc.729_729delAFrame_Shift_Del617.59BFTC905Y2130N
PDE4DIPRFFKRNLMKURINARY_TRACT256p.E243fsc.729_729delAFrame_Shift_Del617.59JMSU1Y2130N
PDE4DIPRFFKRNLMKURINARY_TRACT256p.E243fsc.729_729delAFrame_Shift_Del617.59KMBC2Y2130N
PDE4DIPRFFKRNLMKURINARY_TRACT256p.E243fsc.729_729delAFrame_Shift_Del617.59UMUC3Y2130N
PDE4DIPRKKSSKQRPURINARY_TRACT245p.E243fsc.729_729delAFrame_Shift_Del417.59BFTC905N100Y
PDE4DIPRKKSSKQRPURINARY_TRACT245p.E243fsc.729_729delAFrame_Shift_Del417.59JMSU1N100Y
PDE4DIPRKKSSKQRPURINARY_TRACT245p.E243fsc.729_729delAFrame_Shift_Del417.59KMBC2N100Y
PDE4DIPRKKSSKQRPURINARY_TRACT245p.E243fsc.729_729delAFrame_Shift_Del417.59UMUC3N100Y
PDE4DIPRPPTRFFKRURINARY_TRACT252p.E243fsc.729_729delAFrame_Shift_Del617.59BFTC905Y590Y
PDE4DIPRPPTRFFKRURINARY_TRACT252p.E243fsc.729_729delAFrame_Shift_Del617.59JMSU1Y590Y
PDE4DIPRPPTRFFKRURINARY_TRACT252p.E243fsc.729_729delAFrame_Shift_Del617.59KMBC2Y590Y
PDE4DIPRPPTRFFKRURINARY_TRACT252p.E243fsc.729_729delAFrame_Shift_Del617.59UMUC3Y590Y
PDE4DIPSDSHLADSRURINARY_TRACT237p.E243fsc.729_729delAFrame_Shift_Del317.59BFTC905N000N
PDE4DIPSDSHLADSRURINARY_TRACT237p.E243fsc.729_729delAFrame_Shift_Del317.59JMSU1N000N
PDE4DIPSDSHLADSRURINARY_TRACT237p.E243fsc.729_729delAFrame_Shift_Del317.59KMBC2N000N
PDE4DIPSDSHLADSRURINARY_TRACT237p.E243fsc.729_729delAFrame_Shift_Del317.59UMUC3N000N
PDE4DIPSHLADSRKKURINARY_TRACT239p.E243fsc.729_729delAFrame_Shift_Del417.59BFTC905N000N
PDE4DIPSHLADSRKKURINARY_TRACT239p.E243fsc.729_729delAFrame_Shift_Del417.59JMSU1N000N
PDE4DIPSHLADSRKKURINARY_TRACT239p.E243fsc.729_729delAFrame_Shift_Del417.59KMBC2N000N
PDE4DIPSHLADSRKKURINARY_TRACT239p.E243fsc.729_729delAFrame_Shift_Del417.59UMUC3N000N
PDE4DIPSKQRPPTRFURINARY_TRACT249p.E243fsc.729_729delAFrame_Shift_Del517.59BFTC905N200Y
PDE4DIPSKQRPPTRFURINARY_TRACT249p.E243fsc.729_729delAFrame_Shift_Del517.59JMSU1N200Y
PDE4DIPSKQRPPTRFURINARY_TRACT249p.E243fsc.729_729delAFrame_Shift_Del517.59KMBC2N200Y
PDE4DIPSKQRPPTRFURINARY_TRACT249p.E243fsc.729_729delAFrame_Shift_Del517.59UMUC3N200Y
PDE4DIPSRKKSSKQRURINARY_TRACT244p.E243fsc.729_729delAFrame_Shift_Del417.59BFTC905Y390Y
PDE4DIPSRKKSSKQRURINARY_TRACT244p.E243fsc.729_729delAFrame_Shift_Del417.59JMSU1Y390Y
PDE4DIPSRKKSSKQRURINARY_TRACT244p.E243fsc.729_729delAFrame_Shift_Del417.59KMBC2Y390Y
PDE4DIPSRKKSSKQRURINARY_TRACT244p.E243fsc.729_729delAFrame_Shift_Del417.59UMUC3Y390Y
PDE4DIPSSKQRPPTRURINARY_TRACT248p.E243fsc.729_729delAFrame_Shift_Del517.59BFTC905Y390Y
PDE4DIPSSKQRPPTRURINARY_TRACT248p.E243fsc.729_729delAFrame_Shift_Del517.59JMSU1Y390Y
PDE4DIPSSKQRPPTRURINARY_TRACT248p.E243fsc.729_729delAFrame_Shift_Del517.59KMBC2Y390Y
PDE4DIPSSKQRPPTRURINARY_TRACT248p.E243fsc.729_729delAFrame_Shift_Del517.59UMUC3Y390Y
PDE4DIPSVSDSHLADURINARY_TRACT235p.E243fsc.729_729delAFrame_Shift_Del117.59BFTC905N000N
PDE4DIPSVSDSHLADURINARY_TRACT235p.E243fsc.729_729delAFrame_Shift_Del117.59JMSU1N000N
PDE4DIPSVSDSHLADURINARY_TRACT235p.E243fsc.729_729delAFrame_Shift_Del117.59KMBC2N000N
PDE4DIPSVSDSHLADURINARY_TRACT235p.E243fsc.729_729delAFrame_Shift_Del117.59UMUC3N000N
PDE4DIPTRFFKRNLMURINARY_TRACT255p.E243fsc.729_729delAFrame_Shift_Del617.59BFTC905Y390Y
PDE4DIPTRFFKRNLMURINARY_TRACT255p.E243fsc.729_729delAFrame_Shift_Del617.59JMSU1Y390Y
PDE4DIPTRFFKRNLMURINARY_TRACT255p.E243fsc.729_729delAFrame_Shift_Del617.59KMBC2Y390Y
PDE4DIPTRFFKRNLMURINARY_TRACT255p.E243fsc.729_729delAFrame_Shift_Del617.59UMUC3Y390Y
PDE4DIPVSDSHLADSURINARY_TRACT236p.E243fsc.729_729delAFrame_Shift_Del217.59BFTC905N100N
PDE4DIPVSDSHLADSURINARY_TRACT236p.E243fsc.729_729delAFrame_Shift_Del217.59JMSU1N100N
PDE4DIPVSDSHLADSURINARY_TRACT236p.E243fsc.729_729delAFrame_Shift_Del217.59KMBC2N100N
PDE4DIPVSDSHLADSURINARY_TRACT236p.E243fsc.729_729delAFrame_Shift_Del217.59UMUC3N100N
PDE4DIPDKAVLWSGLURINARY_TRACT483p.V486fsc.1458_1458delTFrame_Shift_Del518.58639VN400N
PDE4DIPDKAVLWSGLURINARY_TRACT483p.V486fsc.1458_1458delTFrame_Shift_Del518.58SW780N400N
PDE4DIPDKAVLWSGLURINARY_TRACT483p.V486fsc.1458_1458delTFrame_Shift_Del518.58UMUC1N400N
PDE4DIPHDKAVLWSGURINARY_TRACT482p.V486fsc.1458_1458delTFrame_Shift_Del418.58639VN000N
PDE4DIPHDKAVLWSGURINARY_TRACT482p.V486fsc.1458_1458delTFrame_Shift_Del418.58SW780N000N
PDE4DIPHDKAVLWSGURINARY_TRACT482p.V486fsc.1458_1458delTFrame_Shift_Del418.58UMUC1N000N
PDE4DIPIHDKAVLWSURINARY_TRACT481p.V486fsc.1458_1458delTFrame_Shift_Del318.58639VN2020N
PDE4DIPIHDKAVLWSURINARY_TRACT481p.V486fsc.1458_1458delTFrame_Shift_Del318.58SW780N2020N
PDE4DIPIHDKAVLWSURINARY_TRACT481p.V486fsc.1458_1458delTFrame_Shift_Del318.58UMUC1N2020N
PDE4DIPQRIHDKAVLURINARY_TRACT479p.V486fsc.1458_1458delTFrame_Shift_Del118.58639VN600N
PDE4DIPQRIHDKAVLURINARY_TRACT479p.V486fsc.1458_1458delTFrame_Shift_Del118.58SW780N600N
PDE4DIPQRIHDKAVLURINARY_TRACT479p.V486fsc.1458_1458delTFrame_Shift_Del118.58UMUC1N600N
PDE4DIPRIHDKAVLWURINARY_TRACT480p.V486fsc.1458_1458delTFrame_Shift_Del218.58639VN400N
PDE4DIPRIHDKAVLWURINARY_TRACT480p.V486fsc.1458_1458delTFrame_Shift_Del218.58SW780N400N
PDE4DIPRIHDKAVLWURINARY_TRACT480p.V486fsc.1458_1458delTFrame_Shift_Del218.58UMUC1N400N
PDE4DIPAAVRHQWSPURINARY_TRACT1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376N000N
PDE4DIPAAVRHQWSPURINARY_TRACT1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERN000N
PDE4DIPAAVRHQWSPURINARY_TRACT1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780N000N
PDE4DIPAAVRHQWSPURINARY_TRACT1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1N000N
PDE4DIPACQLPRIPPURINARY_TRACT1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376N000N
PDE4DIPACQLPRIPPURINARY_TRACT1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERN000N
PDE4DIPACQLPRIPPURINARY_TRACT1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780N000N
PDE4DIPACQLPRIPPURINARY_TRACT1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1N000N
PDE4DIPAFIFTPYPSURINARY_TRACT1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPAFIFTPYPSURINARY_TRACT1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPAFIFTPYPSURINARY_TRACT1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPAFIFTPYPSURINARY_TRACT1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPAFLRHHCPQURINARY_TRACT1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPAFLRHHCPQURINARY_TRACT1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPAFLRHHCPQURINARY_TRACT1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPAFLRHHCPQURINARY_TRACT1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPALFLLLPQLURINARY_TRACT1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376Y16110N
PDE4DIPALFLLLPQLURINARY_TRACT1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERY16110N
PDE4DIPALFLLLPQLURINARY_TRACT1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780Y16110N
PDE4DIPALFLLLPQLURINARY_TRACT1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1Y16110N
PDE4DIPALSSLAAVRURINARY_TRACT1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376Y6100N
PDE4DIPALSSLAAVRURINARY_TRACT1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERY6100N
PDE4DIPALSSLAAVRURINARY_TRACT1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780Y6100N
PDE4DIPALSSLAAVRURINARY_TRACT1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1Y6100N
PDE4DIPAPLALSSLAURINARY_TRACT1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N1000N
PDE4DIPAPLALSSLAURINARY_TRACT1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN1000N
PDE4DIPAPLALSSLAURINARY_TRACT1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N1000N
PDE4DIPAPLALSSLAURINARY_TRACT1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N1000N
PDE4DIPASCLSAPLAURINARY_TRACT1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376N100N
PDE4DIPASCLSAPLAURINARY_TRACT1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERN100N
PDE4DIPASCLSAPLAURINARY_TRACT1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780N100N
PDE4DIPASCLSAPLAURINARY_TRACT1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1N100N
PDE4DIPASRGLRPNPURINARY_TRACT1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000Y
PDE4DIPASRGLRPNPURINARY_TRACT1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000Y
PDE4DIPASRGLRPNPURINARY_TRACT1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000Y
PDE4DIPASRGLRPNPURINARY_TRACT1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000Y
PDE4DIPATPSACQLPURINARY_TRACT1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPATPSACQLPURINARY_TRACT1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPATPSACQLPURINARY_TRACT1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPATPSACQLPURINARY_TRACT1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPAVRHQWSPWURINARY_TRACT1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376N100N
PDE4DIPAVRHQWSPWURINARY_TRACT1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERN100N
PDE4DIPAVRHQWSPWURINARY_TRACT1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780N100N
PDE4DIPAVRHQWSPWURINARY_TRACT1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1N100N
PDE4DIPCCRSSWEKVURINARY_TRACT1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N100N
PDE4DIPCCRSSWEKVURINARY_TRACT1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN100N
PDE4DIPCCRSSWEKVURINARY_TRACT1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N100N
PDE4DIPCCRSSWEKVURINARY_TRACT1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N100N
PDE4DIPCLSAPLALSURINARY_TRACT1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPCLSAPLALSURINARY_TRACT1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPCLSAPLALSURINARY_TRACT1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPCLSAPLALSURINARY_TRACT1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPCPQLHPASCURINARY_TRACT1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N400N
PDE4DIPCPQLHPASCURINARY_TRACT1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN400N
PDE4DIPCPQLHPASCURINARY_TRACT1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N400N
PDE4DIPCPQLHPASCURINARY_TRACT1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N400N
PDE4DIPCQLPRIPPRURINARY_TRACT1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N600Y
PDE4DIPCQLPRIPPRURINARY_TRACT1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN600Y
PDE4DIPCQLPRIPPRURINARY_TRACT1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N600Y
PDE4DIPCQLPRIPPRURINARY_TRACT1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N600Y
PDE4DIPCRSSWEKVPURINARY_TRACT1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPCRSSWEKVPURINARY_TRACT1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPCRSSWEKVPURINARY_TRACT1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPCRSSWEKVPURINARY_TRACT1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPEKVPALFLLURINARY_TRACT1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376N800N
PDE4DIPEKVPALFLLURINARY_TRACT1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERN800N
PDE4DIPEKVPALFLLURINARY_TRACT1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780N800N
PDE4DIPEKVPALFLLURINARY_TRACT1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1N800N
PDE4DIPFIFTPYPSWURINARY_TRACT1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376N500N
PDE4DIPFIFTPYPSWURINARY_TRACT1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERN500N
PDE4DIPFIFTPYPSWURINARY_TRACT1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780N500N
PDE4DIPFIFTPYPSWURINARY_TRACT1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1N500N
PDE4DIPFLLLPQLHCURINARY_TRACT1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N7023N
PDE4DIPFLLLPQLHCURINARY_TRACT1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN7023N
PDE4DIPFLLLPQLHCURINARY_TRACT1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N7023N
PDE4DIPFLLLPQLHCURINARY_TRACT1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N7023N
PDE4DIPFLRHHCPQLURINARY_TRACT1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376Y1399N
PDE4DIPFLRHHCPQLURINARY_TRACT1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERY1399N
PDE4DIPFLRHHCPQLURINARY_TRACT1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780Y1399N
PDE4DIPFLRHHCPQLURINARY_TRACT1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1Y1399N
PDE4DIPFTPYPSWLAURINARY_TRACT1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376N602N
PDE4DIPFTPYPSWLAURINARY_TRACT1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERN602N
PDE4DIPFTPYPSWLAURINARY_TRACT1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780N602N
PDE4DIPFTPYPSWLAURINARY_TRACT1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1N602N
PDE4DIPGLRPNPTATURINARY_TRACT1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N200N
PDE4DIPGLRPNPTATURINARY_TRACT1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN200N
PDE4DIPGLRPNPTATURINARY_TRACT1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N200N
PDE4DIPGLRPNPTATURINARY_TRACT1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N200N
PDE4DIPHCPQLHPASURINARY_TRACT1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N100N
PDE4DIPHCPQLHPASURINARY_TRACT1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN100N
PDE4DIPHCPQLHPASURINARY_TRACT1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N100N
PDE4DIPHCPQLHPASURINARY_TRACT1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N100N
PDE4DIPHHCPQLHPAURINARY_TRACT1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376N200N
PDE4DIPHHCPQLHPAURINARY_TRACT1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERN200N
PDE4DIPHHCPQLHPAURINARY_TRACT1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780N200N
PDE4DIPHHCPQLHPAURINARY_TRACT1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1N200N
PDE4DIPHPASCLSAPURINARY_TRACT1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N100N
PDE4DIPHPASCLSAPURINARY_TRACT1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN100N
PDE4DIPHPASCLSAPURINARY_TRACT1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N100N
PDE4DIPHPASCLSAPURINARY_TRACT1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N100N
PDE4DIPHQWSPWLRLURINARY_TRACT1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376Y14120Y
PDE4DIPHQWSPWLRLURINARY_TRACT1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERY14120Y
PDE4DIPHQWSPWLRLURINARY_TRACT1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780Y14120Y
PDE4DIPHQWSPWLRLURINARY_TRACT1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1Y14120Y
PDE4DIPIFTPYPSWLURINARY_TRACT1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376N900N
PDE4DIPIFTPYPSWLURINARY_TRACT1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERN900N
PDE4DIPIFTPYPSWLURINARY_TRACT1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780N900N
PDE4DIPIFTPYPSWLURINARY_TRACT1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1N900N
PDE4DIPIPPRRPTRPURINARY_TRACT1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N100N
PDE4DIPIPPRRPTRPURINARY_TRACT1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN100N
PDE4DIPIPPRRPTRPURINARY_TRACT1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N100N
PDE4DIPIPPRRPTRPURINARY_TRACT1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N100N
PDE4DIPIQAFIFTPYURINARY_TRACT1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376N900N
PDE4DIPIQAFIFTPYURINARY_TRACT1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERN900N
PDE4DIPIQAFIFTPYURINARY_TRACT1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780N900N
PDE4DIPIQAFIFTPYURINARY_TRACT1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1N900N
PDE4DIPKPSSTSASRURINARY_TRACT1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35HT1376Y490N
PDE4DIPKPSSTSASRURINARY_TRACT1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35SCABERY490N
PDE4DIPKPSSTSASRURINARY_TRACT1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35SW780Y490N
PDE4DIPKPSSTSASRURINARY_TRACT1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35UMUC1Y490N
PDE4DIPKVPALFLLLURINARY_TRACT1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376Y1890N
PDE4DIPKVPALFLLLURINARY_TRACT1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERY1890N
PDE4DIPKVPALFLLLURINARY_TRACT1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780Y1890N
PDE4DIPKVPALFLLLURINARY_TRACT1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1Y1890N
PDE4DIPLAAVRHQWSURINARY_TRACT1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N100N
PDE4DIPLAAVRHQWSURINARY_TRACT1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN100N
PDE4DIPLAAVRHQWSURINARY_TRACT1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N100N
PDE4DIPLAAVRHQWSURINARY_TRACT1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N100N
PDE4DIPLAFLRHHCPURINARY_TRACT1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376N000N
PDE4DIPLAFLRHHCPURINARY_TRACT1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERN000N
PDE4DIPLAFLRHHCPURINARY_TRACT1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780N000N
PDE4DIPLAFLRHHCPURINARY_TRACT1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1N000N
PDE4DIPLALSSLAAVURINARY_TRACT1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376N1000N
PDE4DIPLALSSLAAVURINARY_TRACT1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERN1000N
PDE4DIPLALSSLAAVURINARY_TRACT1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780N1000N
PDE4DIPLALSSLAAVURINARY_TRACT1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1N1000N
PDE4DIPLFLLLPQLHURINARY_TRACT1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N0032N
PDE4DIPLFLLLPQLHURINARY_TRACT1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN0032N
PDE4DIPLFLLLPQLHURINARY_TRACT1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N0032N
PDE4DIPLFLLLPQLHURINARY_TRACT1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N0032N
PDE4DIPLHPASCLSAURINARY_TRACT1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376N307N
PDE4DIPLHPASCLSAURINARY_TRACT1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERN307N
PDE4DIPLHPASCLSAURINARY_TRACT1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780N307N
PDE4DIPLHPASCLSAURINARY_TRACT1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1N307N
PDE4DIPLPRIPPRRPURINARY_TRACT1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N100N
PDE4DIPLPRIPPRRPURINARY_TRACT1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN100N
PDE4DIPLPRIPPRRPURINARY_TRACT1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N100N
PDE4DIPLPRIPPRRPURINARY_TRACT1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N100N
PDE4DIPLRHHCPQLHURINARY_TRACT1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N2020N
PDE4DIPLRHHCPQLHURINARY_TRACT1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN2020N
PDE4DIPLRHHCPQLHURINARY_TRACT1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N2020N
PDE4DIPLRHHCPQLHURINARY_TRACT1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N2020N
PDE4DIPLRLSRSYRCURINARY_TRACT1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376N3033N
PDE4DIPLRLSRSYRCURINARY_TRACT1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERN3033N
PDE4DIPLRLSRSYRCURINARY_TRACT1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780N3033N
PDE4DIPLRLSRSYRCURINARY_TRACT1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1N3033N
PDE4DIPLRPNPTATPURINARY_TRACT1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N1029N
PDE4DIPLRPNPTATPURINARY_TRACT1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN1029N
PDE4DIPLRPNPTATPURINARY_TRACT1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N1029N
PDE4DIPLRPNPTATPURINARY_TRACT1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N1029N
PDE4DIPLSAPLALSSURINARY_TRACT1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376N200N
PDE4DIPLSAPLALSSURINARY_TRACT1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERN200N
PDE4DIPLSAPLALSSURINARY_TRACT1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780N200N
PDE4DIPLSAPLALSSURINARY_TRACT1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1N200N
PDE4DIPLSRSYRCCRURINARY_TRACT1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N300N
PDE4DIPLSRSYRCCRURINARY_TRACT1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN300N
PDE4DIPLSRSYRCCRURINARY_TRACT1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N300N
PDE4DIPLSRSYRCCRURINARY_TRACT1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N300N
PDE4DIPLSSLAAVRHURINARY_TRACT1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPLSSLAAVRHURINARY_TRACT1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPLSSLAAVRHURINARY_TRACT1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPLSSLAAVRHURINARY_TRACT1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPNPTATPSACURINARY_TRACT1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376N400N
PDE4DIPNPTATPSACURINARY_TRACT1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERN400N
PDE4DIPNPTATPSACURINARY_TRACT1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780N400N
PDE4DIPNPTATPSACURINARY_TRACT1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1N400N
PDE4DIPPALFLLLPQURINARY_TRACT1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPPALFLLLPQURINARY_TRACT1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPPALFLLLPQURINARY_TRACT1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPPALFLLLPQURINARY_TRACT1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPPASCLSAPLURINARY_TRACT1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376N000N
PDE4DIPPASCLSAPLURINARY_TRACT1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERN000N
PDE4DIPPASCLSAPLURINARY_TRACT1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780N000N
PDE4DIPPASCLSAPLURINARY_TRACT1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1N000N
PDE4DIPPIQAFIFTPURINARY_TRACT1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376N000N
PDE4DIPPIQAFIFTPURINARY_TRACT1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERN000N
PDE4DIPPIQAFIFTPURINARY_TRACT1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780N000N
PDE4DIPPIQAFIFTPURINARY_TRACT1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1N000N
PDE4DIPPLALSSLAAURINARY_TRACT1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376N100N
PDE4DIPPLALSSLAAURINARY_TRACT1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERN100N
PDE4DIPPLALSSLAAURINARY_TRACT1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780N100N
PDE4DIPPLALSSLAAURINARY_TRACT1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1N100N
PDE4DIPPNPTATPSAURINARY_TRACT1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPPNPTATPSAURINARY_TRACT1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPPNPTATPSAURINARY_TRACT1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPPNPTATPSAURINARY_TRACT1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPPPRRPTRPIURINARY_TRACT1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N900N
PDE4DIPPPRRPTRPIURINARY_TRACT1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN900N
PDE4DIPPPRRPTRPIURINARY_TRACT1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N900N
PDE4DIPPPRRPTRPIURINARY_TRACT1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N900N
PDE4DIPPQLHPASCLURINARY_TRACT1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N200N
PDE4DIPPQLHPASCLURINARY_TRACT1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN200N
PDE4DIPPQLHPASCLURINARY_TRACT1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N200N
PDE4DIPPQLHPASCLURINARY_TRACT1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N200N
PDE4DIPPRIPPRRPTURINARY_TRACT1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPPRIPPRRPTURINARY_TRACT1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPPRIPPRRPTURINARY_TRACT1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPPRIPPRRPTURINARY_TRACT1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPPRRPTRPIQURINARY_TRACT1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPPRRPTRPIQURINARY_TRACT1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPPRRPTRPIQURINARY_TRACT1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPPRRPTRPIQURINARY_TRACT1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPPSACQLPRIURINARY_TRACT1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPPSACQLPRIURINARY_TRACT1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPPSACQLPRIURINARY_TRACT1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPPSACQLPRIURINARY_TRACT1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPPSSTSASRGURINARY_TRACT1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35HT1376N000Y
PDE4DIPPSSTSASRGURINARY_TRACT1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35SCABERN000Y
PDE4DIPPSSTSASRGURINARY_TRACT1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35SW780N000Y
PDE4DIPPSSTSASRGURINARY_TRACT1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35UMUC1N000Y
PDE4DIPPSWLAFLRHURINARY_TRACT1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPPSWLAFLRHURINARY_TRACT1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPPSWLAFLRHURINARY_TRACT1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPPSWLAFLRHURINARY_TRACT1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPPTATPSACQURINARY_TRACT1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPPTATPSACQURINARY_TRACT1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPPTATPSACQURINARY_TRACT1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPPTATPSACQURINARY_TRACT1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPPTRPIQAFIURINARY_TRACT1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPPTRPIQAFIURINARY_TRACT1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPPTRPIQAFIURINARY_TRACT1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPPTRPIQAFIURINARY_TRACT1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPPWLRLSRSYURINARY_TRACT1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376N000N
PDE4DIPPWLRLSRSYURINARY_TRACT1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERN000N
PDE4DIPPWLRLSRSYURINARY_TRACT1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780N000N
PDE4DIPPWLRLSRSYURINARY_TRACT1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1N000N
PDE4DIPPYPSWLAFLURINARY_TRACT1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376Y4100N
PDE4DIPPYPSWLAFLURINARY_TRACT1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERY4100N
PDE4DIPPYPSWLAFLURINARY_TRACT1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780Y4100N
PDE4DIPPYPSWLAFLURINARY_TRACT1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1Y4100N
PDE4DIPQAFIFTPYPURINARY_TRACT1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376N000N
PDE4DIPQAFIFTPYPURINARY_TRACT1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERN000N
PDE4DIPQAFIFTPYPURINARY_TRACT1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780N000N
PDE4DIPQAFIFTPYPURINARY_TRACT1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1N000N
PDE4DIPQLHPASCLSURINARY_TRACT1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPQLHPASCLSURINARY_TRACT1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPQLHPASCLSURINARY_TRACT1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPQLHPASCLSURINARY_TRACT1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPQLPRIPPRRURINARY_TRACT1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N500Y
PDE4DIPQLPRIPPRRURINARY_TRACT1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN500Y
PDE4DIPQLPRIPPRRURINARY_TRACT1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N500Y
PDE4DIPQLPRIPPRRURINARY_TRACT1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N500Y
PDE4DIPQWSPWLRLSURINARY_TRACT1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPQWSPWLRLSURINARY_TRACT1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPQWSPWLRLSURINARY_TRACT1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPQWSPWLRLSURINARY_TRACT1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPRCCRSSWEKURINARY_TRACT1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376Y4100N
PDE4DIPRCCRSSWEKURINARY_TRACT1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERY4100N
PDE4DIPRCCRSSWEKURINARY_TRACT1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780Y4100N
PDE4DIPRCCRSSWEKURINARY_TRACT1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1Y4100N
PDE4DIPRGLRPNPTAURINARY_TRACT1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376N400N
PDE4DIPRGLRPNPTAURINARY_TRACT1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERN400N
PDE4DIPRGLRPNPTAURINARY_TRACT1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780N400N
PDE4DIPRGLRPNPTAURINARY_TRACT1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1N400N
PDE4DIPRHHCPQLHPURINARY_TRACT1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376N000N
PDE4DIPRHHCPQLHPURINARY_TRACT1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERN000N
PDE4DIPRHHCPQLHPURINARY_TRACT1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780N000N
PDE4DIPRHHCPQLHPURINARY_TRACT1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1N000N
PDE4DIPRHQWSPWLRURINARY_TRACT1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N100Y
PDE4DIPRHQWSPWLRURINARY_TRACT1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN100Y
PDE4DIPRHQWSPWLRURINARY_TRACT1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N100Y
PDE4DIPRHQWSPWLRURINARY_TRACT1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N100Y
PDE4DIPRIPPRRPTRURINARY_TRACT1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376Y790N
PDE4DIPRIPPRRPTRURINARY_TRACT1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERY790N
PDE4DIPRIPPRRPTRURINARY_TRACT1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780Y790N
PDE4DIPRIPPRRPTRURINARY_TRACT1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1Y790N
PDE4DIPRLSRSYRCCURINARY_TRACT1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376Y290N
PDE4DIPRLSRSYRCCURINARY_TRACT1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERY290N
PDE4DIPRLSRSYRCCURINARY_TRACT1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780Y290N
PDE4DIPRLSRSYRCCURINARY_TRACT1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1Y290N
PDE4DIPRPIQAFIFTURINARY_TRACT1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376N500N
PDE4DIPRPIQAFIFTURINARY_TRACT1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERN500N
PDE4DIPRPIQAFIFTURINARY_TRACT1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780N500N
PDE4DIPRPIQAFIFTURINARY_TRACT1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1N500N
PDE4DIPRPNPTATPSURINARY_TRACT1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N300N
PDE4DIPRPNPTATPSURINARY_TRACT1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN300N
PDE4DIPRPNPTATPSURINARY_TRACT1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N300N
PDE4DIPRPNPTATPSURINARY_TRACT1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N300N
PDE4DIPRPTRPIQAFURINARY_TRACT1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376Y12100N
PDE4DIPRPTRPIQAFURINARY_TRACT1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERY12100N
PDE4DIPRPTRPIQAFURINARY_TRACT1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780Y12100N
PDE4DIPRPTRPIQAFURINARY_TRACT1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1Y12100N
PDE4DIPRRPTRPIQAURINARY_TRACT1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N500N
PDE4DIPRRPTRPIQAURINARY_TRACT1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN500N
PDE4DIPRRPTRPIQAURINARY_TRACT1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N500N
PDE4DIPRRPTRPIQAURINARY_TRACT1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N500N
PDE4DIPRSSWEKVPAURINARY_TRACT1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N200N
PDE4DIPRSSWEKVPAURINARY_TRACT1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN200N
PDE4DIPRSSWEKVPAURINARY_TRACT1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N200N
PDE4DIPRSSWEKVPAURINARY_TRACT1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N200N
PDE4DIPRSYRCCRSSURINARY_TRACT1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N100N
PDE4DIPRSYRCCRSSURINARY_TRACT1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN100N
PDE4DIPRSYRCCRSSURINARY_TRACT1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N100N
PDE4DIPRSYRCCRSSURINARY_TRACT1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N100N
PDE4DIPSACQLPRIPURINARY_TRACT1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPSACQLPRIPURINARY_TRACT1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPSACQLPRIPURINARY_TRACT1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPSACQLPRIPURINARY_TRACT1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPSAPLALSSLURINARY_TRACT1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376Y15100N
PDE4DIPSAPLALSSLURINARY_TRACT1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERY15100N
PDE4DIPSAPLALSSLURINARY_TRACT1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780Y15100N
PDE4DIPSAPLALSSLURINARY_TRACT1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1Y15100N
PDE4DIPSASRGLRPNURINARY_TRACT1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N100Y
PDE4DIPSASRGLRPNURINARY_TRACT1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN100Y
PDE4DIPSASRGLRPNURINARY_TRACT1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N100Y
PDE4DIPSASRGLRPNURINARY_TRACT1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N100Y
PDE4DIPSCLSAPLALURINARY_TRACT1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N1000N
PDE4DIPSCLSAPLALURINARY_TRACT1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN1000N
PDE4DIPSCLSAPLALURINARY_TRACT1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N1000N
PDE4DIPSCLSAPLALURINARY_TRACT1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N1000N
PDE4DIPSLAAVRHQWURINARY_TRACT1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376N300N
PDE4DIPSLAAVRHQWURINARY_TRACT1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERN300N
PDE4DIPSLAAVRHQWURINARY_TRACT1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780N300N
PDE4DIPSLAAVRHQWURINARY_TRACT1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1N300N
PDE4DIPSPWLRLSRSURINARY_TRACT1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376N500Y
PDE4DIPSPWLRLSRSURINARY_TRACT1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERN500Y
PDE4DIPSPWLRLSRSURINARY_TRACT1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780N500Y
PDE4DIPSPWLRLSRSURINARY_TRACT1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1N500Y
PDE4DIPSRGLRPNPTURINARY_TRACT1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N300Y
PDE4DIPSRGLRPNPTURINARY_TRACT1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN300Y
PDE4DIPSRGLRPNPTURINARY_TRACT1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N300Y
PDE4DIPSRGLRPNPTURINARY_TRACT1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N300Y
PDE4DIPSRSYRCCRSURINARY_TRACT1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N300N
PDE4DIPSRSYRCCRSURINARY_TRACT1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN300N
PDE4DIPSRSYRCCRSURINARY_TRACT1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N300N
PDE4DIPSRSYRCCRSURINARY_TRACT1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N300N
PDE4DIPSSLAAVRHQURINARY_TRACT1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376N000Y
PDE4DIPSSLAAVRHQURINARY_TRACT1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERN000Y
PDE4DIPSSLAAVRHQURINARY_TRACT1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780N000Y
PDE4DIPSSLAAVRHQURINARY_TRACT1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1N000Y
PDE4DIPSSTSASRGLURINARY_TRACT1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35HT1376N700N
PDE4DIPSSTSASRGLURINARY_TRACT1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35SCABERN700N
PDE4DIPSSTSASRGLURINARY_TRACT1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35SW780N700N
PDE4DIPSSTSASRGLURINARY_TRACT1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35UMUC1N700N
PDE4DIPSSWEKVPALURINARY_TRACT1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376Y1990N
PDE4DIPSSWEKVPALURINARY_TRACT1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERY1990N
PDE4DIPSSWEKVPALURINARY_TRACT1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780Y1990N
PDE4DIPSSWEKVPALURINARY_TRACT1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1Y1990N
PDE4DIPSTSASRGLRURINARY_TRACT1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35HT1376N400N
PDE4DIPSTSASRGLRURINARY_TRACT1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35SCABERN400N
PDE4DIPSTSASRGLRURINARY_TRACT1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35SW780N400N
PDE4DIPSTSASRGLRURINARY_TRACT1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35UMUC1N400N
PDE4DIPSWEKVPALFURINARY_TRACT1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N300N
PDE4DIPSWEKVPALFURINARY_TRACT1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN300N
PDE4DIPSWEKVPALFURINARY_TRACT1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N300N
PDE4DIPSWEKVPALFURINARY_TRACT1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N300N
PDE4DIPSWLAFLRHHURINARY_TRACT1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N000N
PDE4DIPSWLAFLRHHURINARY_TRACT1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN000N
PDE4DIPSWLAFLRHHURINARY_TRACT1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N000N
PDE4DIPSWLAFLRHHURINARY_TRACT1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N000N
PDE4DIPSYRCCRSSWURINARY_TRACT1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376Y2100N
PDE4DIPSYRCCRSSWURINARY_TRACT1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERY2100N
PDE4DIPSYRCCRSSWURINARY_TRACT1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780Y2100N
PDE4DIPSYRCCRSSWURINARY_TRACT1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1Y2100N
PDE4DIPTATPSACQLURINARY_TRACT1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376N1100N
PDE4DIPTATPSACQLURINARY_TRACT1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERN1100N
PDE4DIPTATPSACQLURINARY_TRACT1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780N1100N
PDE4DIPTATPSACQLURINARY_TRACT1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1N1100N
PDE4DIPTPSACQLPRURINARY_TRACT1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N500N
PDE4DIPTPSACQLPRURINARY_TRACT1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN500N
PDE4DIPTPSACQLPRURINARY_TRACT1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N500N
PDE4DIPTPSACQLPRURINARY_TRACT1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N500N
PDE4DIPTPYPSWLAFURINARY_TRACT1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376Y19100N
PDE4DIPTPYPSWLAFURINARY_TRACT1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERY19100N
PDE4DIPTPYPSWLAFURINARY_TRACT1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780Y19100N
PDE4DIPTPYPSWLAFURINARY_TRACT1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1Y19100N
PDE4DIPTRPIQAFIFURINARY_TRACT1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N400N
PDE4DIPTRPIQAFIFURINARY_TRACT1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN400N
PDE4DIPTRPIQAFIFURINARY_TRACT1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N400N
PDE4DIPTRPIQAFIFURINARY_TRACT1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N400N
PDE4DIPTSASRGLRPURINARY_TRACT1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376N000N
PDE4DIPTSASRGLRPURINARY_TRACT1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERN000N
PDE4DIPTSASRGLRPURINARY_TRACT1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780N000N
PDE4DIPTSASRGLRPURINARY_TRACT1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1N000N
PDE4DIPVPALFLLLPURINARY_TRACT1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N200N
PDE4DIPVPALFLLLPURINARY_TRACT1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN200N
PDE4DIPVPALFLLLPURINARY_TRACT1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N200N
PDE4DIPVPALFLLLPURINARY_TRACT1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N200N
PDE4DIPVRHQWSPWLURINARY_TRACT1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376N905Y
PDE4DIPVRHQWSPWLURINARY_TRACT1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERN905Y
PDE4DIPVRHQWSPWLURINARY_TRACT1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780N905Y
PDE4DIPVRHQWSPWLURINARY_TRACT1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1N905Y
PDE4DIPWEKVPALFLURINARY_TRACT1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376Y12125N
PDE4DIPWEKVPALFLURINARY_TRACT1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERY12125N
PDE4DIPWEKVPALFLURINARY_TRACT1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780Y12125N
PDE4DIPWEKVPALFLURINARY_TRACT1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1Y12125N
PDE4DIPWLAFLRHHCURINARY_TRACT1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HT1376Y41017N
PDE4DIPWLAFLRHHCURINARY_TRACT1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SCABERY41017N
PDE4DIPWLAFLRHHCURINARY_TRACT1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SW780Y41017N
PDE4DIPWLAFLRHHCURINARY_TRACT1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35UMUC1Y41017N
PDE4DIPWLRLSRSYRURINARY_TRACT1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376Y71012N
PDE4DIPWLRLSRSYRURINARY_TRACT1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERY71012N
PDE4DIPWLRLSRSYRURINARY_TRACT1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780Y71012N
PDE4DIPWLRLSRSYRURINARY_TRACT1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1Y71012N
PDE4DIPWSPWLRLSRURINARY_TRACT1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HT1376N605Y
PDE4DIPWSPWLRLSRURINARY_TRACT1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SCABERN605Y
PDE4DIPWSPWLRLSRURINARY_TRACT1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SW780N605Y
PDE4DIPWSPWLRLSRURINARY_TRACT1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35UMUC1N605Y
PDE4DIPYPSWLAFLRURINARY_TRACT1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N702N
PDE4DIPYPSWLAFLRURINARY_TRACT1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN702N
PDE4DIPYPSWLAFLRURINARY_TRACT1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N702N
PDE4DIPYPSWLAFLRURINARY_TRACT1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N702N
PDE4DIPYRCCRSSWEURINARY_TRACT1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HT1376N305N
PDE4DIPYRCCRSSWEURINARY_TRACT1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SCABERN305N
PDE4DIPYRCCRSSWEURINARY_TRACT1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SW780N305N
PDE4DIPYRCCRSSWEURINARY_TRACT1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35UMUC1N305N
PDE4DIPAESNSNTISURINARY_TRACT1669p.P1675Tc.5023C>AMissense_Mutation10.11SW1710N300N
PDE4DIPAKAESNSNTURINARY_TRACT1667p.P1675Tc.5023C>AMissense_Mutation10.11SW1710N100N
PDE4DIPANVLGLDTSURINARY_TRACT2146p.G2148Vc.6443G>TMissense_Mutation10.11647VN000N
PDE4DIPDNSNKTLEAURINARY_TRACT461p.D464Nc.1390G>AMissense_Mutation10.11KMBC2N000N
PDE4DIPESNSNTISLURINARY_TRACT1670p.P1675Tc.5023C>AMissense_Mutation10.11SW1710Y9120N
PDE4DIPIINRANVLGURINARY_TRACT2142p.G2148Vc.6443G>TMissense_Mutation10.11647VN002N
PDE4DIPINRANVLGLURINARY_TRACT2143p.G2148Vc.6443G>TMissense_Mutation10.11647VY81629N
PDE4DIPKAESNSNTIURINARY_TRACT1668p.P1675Tc.5023C>AMissense_Mutation10.11SW1710Y8120N
PDE4DIPLLQYRDNSNURINARY_TRACT456p.D464Nc.1390G>AMissense_Mutation10.11KMBC2N000Y
PDE4DIPLQYRDNSNKURINARY_TRACT457p.D464Nc.1390G>AMissense_Mutation10.11KMBC2N504N
PDE4DIPNKTLEANEMURINARY_TRACT464p.D464Nc.1390G>AMissense_Mutation10.11KMBC2N200N
PDE4DIPNRANVLGLDURINARY_TRACT2144p.G2148Vc.6443G>TMissense_Mutation10.11647VN100N
PDE4DIPNSNKTLEANURINARY_TRACT462p.D464Nc.1390G>AMissense_Mutation10.11KMBC2N100N
PDE4DIPNSNTISLPTURINARY_TRACT1672p.P1675Tc.5023C>AMissense_Mutation10.11SW1710N100N
PDE4DIPNTISLPTPQURINARY_TRACT1674p.P1675Tc.5023C>AMissense_Mutation10.11SW1710N000N
PDE4DIPNVLGLDTSPURINARY_TRACT2147p.G2148Vc.6443G>TMissense_Mutation10.11647VN000N
PDE4DIPPIINRANVLURINARY_TRACT2141p.G2148Vc.6443G>TMissense_Mutation10.11647VN000N
PDE4DIPQYRDNSNKTURINARY_TRACT458p.D464Nc.1390G>AMissense_Mutation10.11KMBC2N300Y
PDE4DIPRANVLGLDTURINARY_TRACT2145p.G2148Vc.6443G>TMissense_Mutation10.11647VN200N
PDE4DIPRDNSNKTLEURINARY_TRACT460p.D464Nc.1390G>AMissense_Mutation10.11KMBC2N100N
PDE4DIPSNKTLEANEURINARY_TRACT463p.D464Nc.1390G>AMissense_Mutation10.11KMBC2N000N
PDE4DIPSNSNTISLPURINARY_TRACT1671p.P1675Tc.5023C>AMissense_Mutation10.11SW1710N000N
PDE4DIPSNTISLPTPURINARY_TRACT1673p.P1675Tc.5023C>AMissense_Mutation10.11SW1710N000N
PDE4DIPTISLPTPQNURINARY_TRACT1675p.P1675Tc.5023C>AMissense_Mutation10.11SW1710N000N
PDE4DIPTPIINRANVURINARY_TRACT2140p.G2148Vc.6443G>TMissense_Mutation10.11647VY15120N
PDE4DIPVLGLDTSPVURINARY_TRACT2148p.G2148Vc.6443G>TMissense_Mutation10.11647VN609N
PDE4DIPYRDNSNKTLURINARY_TRACT459p.D464Nc.1390G>AMissense_Mutation10.11KMBC2N804N
PDE4DIPAFLLTMFWRURINARY_TRACT2248p.S2249Fc.6746C>TMissense_Mutation10.33KU1919Y390N
PDE4DIPALEESAFLLURINARY_TRACT2243p.S2249Fc.6746C>TMissense_Mutation10.33KU1919Y12140N
PDE4DIPEESAFLLTMURINARY_TRACT2245p.S2249Fc.6746C>TMissense_Mutation10.33KU1919Y690N
PDE4DIPESAFLLTMFURINARY_TRACT2246p.S2249Fc.6746C>TMissense_Mutation10.33KU1919N600N
PDE4DIPFLLTMFWRAURINARY_TRACT2249p.S2249Fc.6746C>TMissense_Mutation10.33KU1919N1001N
PDE4DIPHALEESAFLURINARY_TRACT2242p.S2249Fc.6746C>TMissense_Mutation10.33KU1919N1900N
PDE4DIPHHALEESAFURINARY_TRACT2241p.S2249Fc.6746C>TMissense_Mutation10.33KU1919N300N
PDE4DIPLEESAFLLTURINARY_TRACT2244p.S2249Fc.6746C>TMissense_Mutation10.33KU1919N600N
PDE4DIPSAFLLTMFWURINARY_TRACT2247p.S2249Fc.6746C>TMissense_Mutation10.33KU1919N600N
PDGFRAAKVEETVAVURINARY_TRACT491p.I497Vc.1489A>GMissense_Mutation10.11639VN200N
PDGFRAATSEVYQIMURINARY_TRACT921p.E927Qc.2779G>CMissense_Mutation10.11KMBC2Y590N
PDGFRADHATSEVYQURINARY_TRACT919p.E927Qc.2779G>CMissense_Mutation10.11KMBC2N000Y
PDGFRAEETVAVRCLURINARY_TRACT494p.I497Vc.1489A>GMissense_Mutation10.11639VY6100N
PDGFRAETVAVRCLAURINARY_TRACT495p.I497Vc.1489A>GMissense_Mutation10.11639VN300N
PDGFRAEVYQIMVKCURINARY_TRACT924p.E927Qc.2779G>CMissense_Mutation10.11KMBC2N100N
PDGFRAFAKVEETVAURINARY_TRACT490p.I497Vc.1489A>GMissense_Mutation10.11639VN500N
PDGFRAHATSEVYQIURINARY_TRACT920p.E927Qc.2779G>CMissense_Mutation10.11KMBC2Y7110Y
PDGFRAKVEETVAVRURINARY_TRACT492p.I497Vc.1489A>GMissense_Mutation10.11639VY7110N
PDGFRAQIMVKCWNSURINARY_TRACT927p.E927Qc.2779G>CMissense_Mutation10.11KMBC2N000N
PDGFRASEVYQIMVKURINARY_TRACT923p.E927Qc.2779G>CMissense_Mutation10.11KMBC2N500N
PDGFRATFAKVEETVURINARY_TRACT489p.I497Vc.1489A>GMissense_Mutation10.11639VN200N
PDGFRATSEVYQIMVURINARY_TRACT922p.E927Qc.2779G>CMissense_Mutation10.11KMBC2N200N
PDGFRATVAVRCLAKURINARY_TRACT496p.I497Vc.1489A>GMissense_Mutation10.11639VY4140N
PDGFRAVAVRCLAKNURINARY_TRACT497p.I497Vc.1489A>GMissense_Mutation10.11639VN203N
PDGFRAVEETVAVRCURINARY_TRACT493p.I497Vc.1489A>GMissense_Mutation10.11639VN600N
PDGFRAVYQIMVKCWURINARY_TRACT925p.E927Qc.2779G>CMissense_Mutation10.11KMBC2N400N
PDGFRAYQIMVKCWNURINARY_TRACT926p.E927Qc.2779G>CMissense_Mutation10.11KMBC2N2031N
PIK3C2GCSWGSIGKHURINARY_TRACT124p.P129delc.384_386delCCCIn_Frame_Del447.23253JBVN000N
PIK3C2GCSWGSIGKHURINARY_TRACT124p.P129delc.384_386delCCCIn_Frame_Del447.23253JN000N
PIK3C2GCSWGSIGKHURINARY_TRACT124p.P129delc.384_386delCCCIn_Frame_Del447.23ACCSN000N
PIK3C2GCSWGSIGKHURINARY_TRACT124p.P129delc.384_386delCCCIn_Frame_Del447.23CAL29N000N
PIK3C2GCSWGSIGKHURINARY_TRACT124p.P129delc.384_386delCCCIn_Frame_Del447.23J82N000N
PIK3C2GCSWGSIGKHURINARY_TRACT124p.P129delc.384_386delCCCIn_Frame_Del447.23RT11284N000N
PIK3C2GCSWGSIGKHURINARY_TRACT124p.P129delc.384_386delCCCIn_Frame_Del447.23RT112N000N
PIK3C2GCSWGSIGKHURINARY_TRACT124p.P129delc.384_386delCCCIn_Frame_Del447.23RT4N000N
PIK3C2GCSWGSIGKHURINARY_TRACT124p.P129delc.384_386delCCCIn_Frame_Del447.23SCABERN000N
PIK3C2GCSWGSIGKHURINARY_TRACT124p.P129delc.384_386delCCCIn_Frame_Del447.23SW780N000N
PIK3C2GCSWGSIGKHURINARY_TRACT124p.P129delc.384_386delCCCIn_Frame_Del447.23VMCUB1N000N
PIK3C2GECSWGSIGKURINARY_TRACT123p.P129delc.384_386delCCCIn_Frame_Del347.23253JBVN100N
PIK3C2GECSWGSIGKURINARY_TRACT123p.P129delc.384_386delCCCIn_Frame_Del347.23253JN100N
PIK3C2GECSWGSIGKURINARY_TRACT123p.P129delc.384_386delCCCIn_Frame_Del347.23ACCSN100N
PIK3C2GECSWGSIGKURINARY_TRACT123p.P129delc.384_386delCCCIn_Frame_Del347.23CAL29N100N
PIK3C2GECSWGSIGKURINARY_TRACT123p.P129delc.384_386delCCCIn_Frame_Del347.23J82N100N
PIK3C2GECSWGSIGKURINARY_TRACT123p.P129delc.384_386delCCCIn_Frame_Del347.23RT11284N100N
PIK3C2GECSWGSIGKURINARY_TRACT123p.P129delc.384_386delCCCIn_Frame_Del347.23RT112N100N
PIK3C2GECSWGSIGKURINARY_TRACT123p.P129delc.384_386delCCCIn_Frame_Del347.23RT4N100N
PIK3C2GECSWGSIGKURINARY_TRACT123p.P129delc.384_386delCCCIn_Frame_Del347.23SCABERN100N
PIK3C2GECSWGSIGKURINARY_TRACT123p.P129delc.384_386delCCCIn_Frame_Del347.23SW780N100N
PIK3C2GECSWGSIGKURINARY_TRACT123p.P129delc.384_386delCCCIn_Frame_Del347.23VMCUB1N100N
PIK3C2GGSIGKHHGAURINARY_TRACT127p.P129delc.384_386delCCCIn_Frame_Del247.23253JBVN300N
PIK3C2GGSIGKHHGAURINARY_TRACT127p.P129delc.384_386delCCCIn_Frame_Del247.23253JN300N
PIK3C2GGSIGKHHGAURINARY_TRACT127p.P129delc.384_386delCCCIn_Frame_Del247.23ACCSN300N
PIK3C2GGSIGKHHGAURINARY_TRACT127p.P129delc.384_386delCCCIn_Frame_Del247.23CAL29N300N
PIK3C2GGSIGKHHGAURINARY_TRACT127p.P129delc.384_386delCCCIn_Frame_Del247.23J82N300N
PIK3C2GGSIGKHHGAURINARY_TRACT127p.P129delc.384_386delCCCIn_Frame_Del247.23RT11284N300N
PIK3C2GGSIGKHHGAURINARY_TRACT127p.P129delc.384_386delCCCIn_Frame_Del247.23RT112N300N
PIK3C2GGSIGKHHGAURINARY_TRACT127p.P129delc.384_386delCCCIn_Frame_Del247.23RT4N300N
PIK3C2GGSIGKHHGAURINARY_TRACT127p.P129delc.384_386delCCCIn_Frame_Del247.23SCABERN300N
PIK3C2GGSIGKHHGAURINARY_TRACT127p.P129delc.384_386delCCCIn_Frame_Del247.23SW780N300N
PIK3C2GGSIGKHHGAURINARY_TRACT127p.P129delc.384_386delCCCIn_Frame_Del247.23VMCUB1N300N
PIK3C2GKECSWGSIGURINARY_TRACT122p.P129delc.384_386delCCCIn_Frame_Del247.23253JBVN000N
PIK3C2GKECSWGSIGURINARY_TRACT122p.P129delc.384_386delCCCIn_Frame_Del247.23253JN000N
PIK3C2GKECSWGSIGURINARY_TRACT122p.P129delc.384_386delCCCIn_Frame_Del247.23ACCSN000N
PIK3C2GKECSWGSIGURINARY_TRACT122p.P129delc.384_386delCCCIn_Frame_Del247.23CAL29N000N
PIK3C2GKECSWGSIGURINARY_TRACT122p.P129delc.384_386delCCCIn_Frame_Del247.23J82N000N
PIK3C2GKECSWGSIGURINARY_TRACT122p.P129delc.384_386delCCCIn_Frame_Del247.23RT11284N000N
PIK3C2GKECSWGSIGURINARY_TRACT122p.P129delc.384_386delCCCIn_Frame_Del247.23RT112N000N
PIK3C2GKECSWGSIGURINARY_TRACT122p.P129delc.384_386delCCCIn_Frame_Del247.23RT4N000N
PIK3C2GKECSWGSIGURINARY_TRACT122p.P129delc.384_386delCCCIn_Frame_Del247.23SCABERN000N
PIK3C2GKECSWGSIGURINARY_TRACT122p.P129delc.384_386delCCCIn_Frame_Del247.23SW780N000N
PIK3C2GKECSWGSIGURINARY_TRACT122p.P129delc.384_386delCCCIn_Frame_Del247.23VMCUB1N000N
PIK3C2GNKECSWGSIURINARY_TRACT121p.P129delc.384_386delCCCIn_Frame_Del147.23253JBVN100N
PIK3C2GNKECSWGSIURINARY_TRACT121p.P129delc.384_386delCCCIn_Frame_Del147.23253JN100N
PIK3C2GNKECSWGSIURINARY_TRACT121p.P129delc.384_386delCCCIn_Frame_Del147.23ACCSN100N
PIK3C2GNKECSWGSIURINARY_TRACT121p.P129delc.384_386delCCCIn_Frame_Del147.23CAL29N100N
PIK3C2GNKECSWGSIURINARY_TRACT121p.P129delc.384_386delCCCIn_Frame_Del147.23J82N100N
PIK3C2GNKECSWGSIURINARY_TRACT121p.P129delc.384_386delCCCIn_Frame_Del147.23RT11284N100N
PIK3C2GNKECSWGSIURINARY_TRACT121p.P129delc.384_386delCCCIn_Frame_Del147.23RT112N100N
PIK3C2GNKECSWGSIURINARY_TRACT121p.P129delc.384_386delCCCIn_Frame_Del147.23RT4N100N
PIK3C2GNKECSWGSIURINARY_TRACT121p.P129delc.384_386delCCCIn_Frame_Del147.23SCABERN100N
PIK3C2GNKECSWGSIURINARY_TRACT121p.P129delc.384_386delCCCIn_Frame_Del147.23SW780N100N
PIK3C2GNKECSWGSIURINARY_TRACT121p.P129delc.384_386delCCCIn_Frame_Del147.23VMCUB1N100N
PIK3C2GSIGKHHGADURINARY_TRACT128p.P129delc.384_386delCCCIn_Frame_Del147.23253JBVN000N
PIK3C2GSIGKHHGADURINARY_TRACT128p.P129delc.384_386delCCCIn_Frame_Del147.23253JN000N
PIK3C2GSIGKHHGADURINARY_TRACT128p.P129delc.384_386delCCCIn_Frame_Del147.23ACCSN000N
PIK3C2GSIGKHHGADURINARY_TRACT128p.P129delc.384_386delCCCIn_Frame_Del147.23CAL29N000N
PIK3C2GSIGKHHGADURINARY_TRACT128p.P129delc.384_386delCCCIn_Frame_Del147.23J82N000N
PIK3C2GSIGKHHGADURINARY_TRACT128p.P129delc.384_386delCCCIn_Frame_Del147.23RT11284N000N
PIK3C2GSIGKHHGADURINARY_TRACT128p.P129delc.384_386delCCCIn_Frame_Del147.23RT112N000N
PIK3C2GSIGKHHGADURINARY_TRACT128p.P129delc.384_386delCCCIn_Frame_Del147.23RT4N000N
PIK3C2GSIGKHHGADURINARY_TRACT128p.P129delc.384_386delCCCIn_Frame_Del147.23SCABERN000N
PIK3C2GSIGKHHGADURINARY_TRACT128p.P129delc.384_386delCCCIn_Frame_Del147.23SW780N000N
PIK3C2GSIGKHHGADURINARY_TRACT128p.P129delc.384_386delCCCIn_Frame_Del147.23VMCUB1N000N
PIK3C2GSWGSIGKHHURINARY_TRACT125p.P129delc.384_386delCCCIn_Frame_Del447.23253JBVN000N
PIK3C2GSWGSIGKHHURINARY_TRACT125p.P129delc.384_386delCCCIn_Frame_Del447.23253JN000N
PIK3C2GSWGSIGKHHURINARY_TRACT125p.P129delc.384_386delCCCIn_Frame_Del447.23ACCSN000N
PIK3C2GSWGSIGKHHURINARY_TRACT125p.P129delc.384_386delCCCIn_Frame_Del447.23CAL29N000N
PIK3C2GSWGSIGKHHURINARY_TRACT125p.P129delc.384_386delCCCIn_Frame_Del447.23J82N000N
PIK3C2GSWGSIGKHHURINARY_TRACT125p.P129delc.384_386delCCCIn_Frame_Del447.23RT11284N000N
PIK3C2GSWGSIGKHHURINARY_TRACT125p.P129delc.384_386delCCCIn_Frame_Del447.23RT112N000N
PIK3C2GSWGSIGKHHURINARY_TRACT125p.P129delc.384_386delCCCIn_Frame_Del447.23RT4N000N
PIK3C2GSWGSIGKHHURINARY_TRACT125p.P129delc.384_386delCCCIn_Frame_Del447.23SCABERN000N
PIK3C2GSWGSIGKHHURINARY_TRACT125p.P129delc.384_386delCCCIn_Frame_Del447.23SW780N000N
PIK3C2GSWGSIGKHHURINARY_TRACT125p.P129delc.384_386delCCCIn_Frame_Del447.23VMCUB1N000N
PIK3C2GWGSIGKHHGURINARY_TRACT126p.P129delc.384_386delCCCIn_Frame_Del347.23253JBVN107Y
PIK3C2GWGSIGKHHGURINARY_TRACT126p.P129delc.384_386delCCCIn_Frame_Del347.23253JN107Y
PIK3C2GWGSIGKHHGURINARY_TRACT126p.P129delc.384_386delCCCIn_Frame_Del347.23ACCSN107Y
PIK3C2GWGSIGKHHGURINARY_TRACT126p.P129delc.384_386delCCCIn_Frame_Del347.23CAL29N107Y
PIK3C2GWGSIGKHHGURINARY_TRACT126p.P129delc.384_386delCCCIn_Frame_Del347.23J82N107Y
PIK3C2GWGSIGKHHGURINARY_TRACT126p.P129delc.384_386delCCCIn_Frame_Del347.23RT11284N107Y
PIK3C2GWGSIGKHHGURINARY_TRACT126p.P129delc.384_386delCCCIn_Frame_Del347.23RT112N107Y
PIK3C2GWGSIGKHHGURINARY_TRACT126p.P129delc.384_386delCCCIn_Frame_Del347.23RT4N107Y
PIK3C2GWGSIGKHHGURINARY_TRACT126p.P129delc.384_386delCCCIn_Frame_Del347.23SCABERN107Y
PIK3C2GWGSIGKHHGURINARY_TRACT126p.P129delc.384_386delCCCIn_Frame_Del347.23SW780N107Y
PIK3C2GWGSIGKHHGURINARY_TRACT126p.P129delc.384_386delCCCIn_Frame_Del347.23VMCUB1N107Y
PIK3C2GGVNFYQSSEURINARY_TRACT464p.E465Vc.1394A>TMissense_Mutation10.11BFTC905N000N
PIK3C2GHSQLLLNLMURINARY_TRACT1109p.S1117Tc.3349T>AMissense_Mutation10.11647VN600Y
PIK3C2GILQRKGVNFURINARY_TRACT459p.E465Vc.1394A>TMissense_Mutation10.11BFTC905N600N
PIK3C2GKGVNFYQSSURINARY_TRACT463p.E465Vc.1394A>TMissense_Mutation10.11BFTC905N200N
PIK3C2GLILQRKGVNURINARY_TRACT458p.E465Vc.1394A>TMissense_Mutation10.11BFTC905N004N
PIK3C2GLLLNLMEMMURINARY_TRACT1112p.S1117Tc.3349T>AMissense_Mutation10.11647VN1000N
PIK3C2GLLNLMEMMLURINARY_TRACT1113p.S1117Tc.3349T>AMissense_Mutation10.11647VN1201N
PIK3C2GLMEMMLYAGURINARY_TRACT1116p.S1117Tc.3349T>AMissense_Mutation10.11647VN100N
PIK3C2GLNLMEMMLYURINARY_TRACT1114p.S1117Tc.3349T>AMissense_Mutation10.11647VN6016N
PIK3C2GLQRKGVNFYURINARY_TRACT460p.E465Vc.1394A>TMissense_Mutation10.11BFTC905N7018N
PIK3C2GMEMMLYAGLURINARY_TRACT1117p.S1117Tc.3349T>AMissense_Mutation10.11647VN1405N
PIK3C2GNLMEMMLYAURINARY_TRACT1115p.S1117Tc.3349T>AMissense_Mutation10.11647VY7120N
PIK3C2GQLLLNLMEMURINARY_TRACT1111p.S1117Tc.3349T>AMissense_Mutation10.11647VY8110N
PIK3C2GQRKGVNFYQURINARY_TRACT461p.E465Vc.1394A>TMissense_Mutation10.11BFTC905N100N
PIK3C2GRKGVNFYQSURINARY_TRACT462p.E465Vc.1394A>TMissense_Mutation10.11BFTC905N100N
PIK3C2GSLILQRKGVURINARY_TRACT457p.E465Vc.1394A>TMissense_Mutation10.11BFTC905N400N
PIK3C2GSQLLLNLMEURINARY_TRACT1110p.S1117Tc.3349T>AMissense_Mutation10.11647VN000N
PIK3C2GVNFYQSSETURINARY_TRACT465p.E465Vc.1394A>TMissense_Mutation10.11BFTC905N004N
PIK3CAAIGMLVCEFURINARY_TRACT120p.P124Lc.371C>TMissense_Mutation10.11J82N400N
PIK3CAEIGFAIGMLURINARY_TRACT116p.P124Lc.371C>TMissense_Mutation10.11J82N600N
PIK3CAFAIGMLVCEURINARY_TRACT119p.P124Lc.371C>TMissense_Mutation10.11J82N200N
PIK3CAFFFWHLKSQURINARY_TRACT666p.E674Qc.2020G>CMissense_Mutation10.11VMCUB1N2014N
PIK3CAFFWHLKSQMURINARY_TRACT667p.E674Qc.2020G>CMissense_Mutation10.11VMCUB1N509N
PIK3CAFWHLKSQMHURINARY_TRACT668p.E674Qc.2020G>CMissense_Mutation10.11VMCUB1N