Cancertope

In silico Platform for designing genome-based
Personalized immunotherapy or Vaccine against Cancer

Browse Results ...


The result page of search shows exclusive peptide/epitopes generated due to mutation [Neoepitope], the tissue of origin [Tissue], position of peptide in protein [Position], number of mismatches counted by aligning mutated and normal protein sequence [Num Mismatch, percentage of cell lines with this peptide over total number of cell lines [Promiscuity %]. The immune information include CTL epitopes (Yes/No), MHC I binders, MHC II binders (both given as number of alleles) and B cell epitopes (Yes/No). For more information, please click HERE


Result Reset Search:
ProteinNeoepitopesTissuePositionProt MutationcDNA MutationMutation TypeNum MismatchPromiscuity (%)Cell LineCTLMHC INHLApredMHC IIBcell
AKAP12AIEEDLEPETHYROID1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.868505CN000N
AKAP12AIEEDLEPETHYROID1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86BCPAPN000N
AKAP12AIEEDLEPETHYROID1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CGTHW1N000N
AKAP12AIEEDLEPETHYROID1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86ML1N000N
AKAP12AIEEDLEPETHYROID1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SW579N000N
AKAP12AIEEDLEPETHYROID1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TT2609C02N000N
AKAP12EEDLEPENGTHYROID1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.868505CN000N
AKAP12EEDLEPENGTHYROID1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86BCPAPN000N
AKAP12EEDLEPENGTHYROID1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CGTHW1N000N
AKAP12EEDLEPENGTHYROID1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86ML1N000N
AKAP12EEDLEPENGTHYROID1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SW579N000N
AKAP12EEDLEPENGTHYROID1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TT2609C02N000N
AKAP12IEEDLEPENTHYROID1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.868505CN200N
AKAP12IEEDLEPENTHYROID1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86BCPAPN200N
AKAP12IEEDLEPENTHYROID1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CGTHW1N200N
AKAP12IEEDLEPENTHYROID1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86ML1N200N
AKAP12IEEDLEPENTHYROID1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SW579N200N
AKAP12IEEDLEPENTHYROID1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TT2609C02N200N
AKAP12KVSVAIEEDTHYROID1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.868505CN000N
AKAP12KVSVAIEEDTHYROID1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86BCPAPN000N
AKAP12KVSVAIEEDTHYROID1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CGTHW1N000N
AKAP12KVSVAIEEDTHYROID1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86ML1N000N
AKAP12KVSVAIEEDTHYROID1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SW579N000N
AKAP12KVSVAIEEDTHYROID1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TT2609C02N000N
AKAP12SVAIEEDLETHYROID1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.868505CN000N
AKAP12SVAIEEDLETHYROID1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86BCPAPN000N
AKAP12SVAIEEDLETHYROID1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CGTHW1N000N
AKAP12SVAIEEDLETHYROID1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86ML1N000N
AKAP12SVAIEEDLETHYROID1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SW579N000N
AKAP12SVAIEEDLETHYROID1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TT2609C02N000N
AKAP12VAIEEDLEPTHYROID1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.868505CN000N
AKAP12VAIEEDLEPTHYROID1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86BCPAPN000N
AKAP12VAIEEDLEPTHYROID1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CGTHW1N000N
AKAP12VAIEEDLEPTHYROID1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86ML1N000N
AKAP12VAIEEDLEPTHYROID1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SW579N000N
AKAP12VAIEEDLEPTHYROID1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TT2609C02N000N
AKAP12VKVSVAIEETHYROID1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.868505CN002N
AKAP12VKVSVAIEETHYROID1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86BCPAPN002N
AKAP12VKVSVAIEETHYROID1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CGTHW1N002N
AKAP12VKVSVAIEETHYROID1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86ML1N002N
AKAP12VKVSVAIEETHYROID1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SW579N002N
AKAP12VKVSVAIEETHYROID1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TT2609C02N002N
AKAP12VSVAIEEDLTHYROID1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.868505CN1500Y
AKAP12VSVAIEEDLTHYROID1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86BCPAPN1500Y
AKAP12VSVAIEEDLTHYROID1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CGTHW1N1500Y
AKAP12VSVAIEEDLTHYROID1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86ML1N1500Y
AKAP12VSVAIEEDLTHYROID1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SW579N1500Y
AKAP12VSVAIEEDLTHYROID1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TT2609C02N1500Y
AKAP9DLEKTKQLETHYROID1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CAL62N000N
AKAP9DLEKTKQLETHYROID1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SW579N000N
AKAP9DLEKTKQLETHYROID1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TTN000N
AKAP9EKTKQLEEQTHYROID1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CAL62N000N
AKAP9EKTKQLEEQTHYROID1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SW579N000N
AKAP9EKTKQLEEQTHYROID1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TTN000N
AKAP9KQLEEQVQETHYROID1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CAL62N000N
AKAP9KQLEEQVQETHYROID1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SW579N000N
AKAP9KQLEEQVQETHYROID1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TTN000N
AKAP9KTKQLEEQVTHYROID1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27CAL62N200N
AKAP9KTKQLEEQVTHYROID1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SW579N200N
AKAP9KTKQLEEQVTHYROID1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27TTN200N
AKAP9LEKTKQLEETHYROID1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CAL62N000N
AKAP9LEKTKQLEETHYROID1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SW579N000N
AKAP9LEKTKQLEETHYROID1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TTN000N
AKAP9LQDLEKTKQTHYROID1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27CAL62N000N
AKAP9LQDLEKTKQTHYROID1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SW579N000N
AKAP9LQDLEKTKQTHYROID1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27TTN000N
AKAP9QDLEKTKQLTHYROID1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CAL62N900N
AKAP9QDLEKTKQLTHYROID1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SW579N900N
AKAP9QDLEKTKQLTHYROID1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TTN900N
AKAP9QLEEQVQELTHYROID1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27CAL62N1200N
AKAP9QLEEQVQELTHYROID1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SW579N1200N
AKAP9QLEEQVQELTHYROID1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27TTN1200N
AKAP9TKQLEEQVQTHYROID1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CAL62N000N
AKAP9TKQLEEQVQTHYROID1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SW579N000N
AKAP9TKQLEEQVQTHYROID1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TTN000N
AKAP9AGTQINLQSTHYROID2802p.I2804Tc.8411T>CMissense_Mutation10.11TTN100N
AKAP9GTQINLQSETHYROID2803p.I2804Tc.8411T>CMissense_Mutation10.11TTN000N
AKAP9ILVKNAGTQTHYROID2797p.I2804Tc.8411T>CMissense_Mutation10.11TTN006N
AKAP9KNAGTQINLTHYROID2800p.I2804Tc.8411T>CMissense_Mutation10.11TTY9190N
AKAP9LVKNAGTQITHYROID2798p.I2804Tc.8411T>CMissense_Mutation10.11TTN304N
AKAP9NAGTQINLQTHYROID2801p.I2804Tc.8411T>CMissense_Mutation10.11TTN000N
AKAP9QILVKNAGTTHYROID2796p.I2804Tc.8411T>CMissense_Mutation10.11TTN200N
AKAP9TQINLQSECTHYROID2804p.I2804Tc.8411T>CMissense_Mutation10.11TTN200N
AKAP9VKNAGTQINTHYROID2799p.I2804Tc.8411T>CMissense_Mutation10.11TTN106N
ALKDPSPLQVVVTHYROID1141p.A1148Vc.3443C>TMissense_Mutation10.11FTC133Y1290N
ALKLQVVVKTLPTHYROID1145p.A1148Vc.3443C>TMissense_Mutation10.11FTC133N000N
ALKNDPSPLQVVTHYROID1140p.A1148Vc.3443C>TMissense_Mutation10.11FTC133N500N
ALKPLQVVVKTLTHYROID1144p.A1148Vc.3443C>TMissense_Mutation10.11FTC133N200N
ALKPSPLQVVVKTHYROID1142p.A1148Vc.3443C>TMissense_Mutation10.11FTC133N000N
ALKQVVVKTLPETHYROID1146p.A1148Vc.3443C>TMissense_Mutation10.11FTC133N000N
ALKSPLQVVVKTTHYROID1143p.A1148Vc.3443C>TMissense_Mutation10.11FTC133N600N
ALKVVKTLPEVCTHYROID1148p.A1148Vc.3443C>TMissense_Mutation10.11FTC133N002N
ALKVVVKTLPEVTHYROID1147p.A1148Vc.3443C>TMissense_Mutation10.11FTC133N5017N
ALPK2ATRETVTIATHYROID1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74BCPAPY1140N
ALPK2ATRETVTIATHYROID1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74CAL62Y1140N
ALPK2CFQATRETVTHYROID998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74BCPAPY2110N
ALPK2CFQATRETVTHYROID998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74CAL62Y2110N
ALPK2ETVTIATEVTHYROID1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74BCPAPN400N
ALPK2ETVTIATEVTHYROID1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74CAL62N400N
ALPK2FQATRETVTTHYROID999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74BCPAPN600N
ALPK2FQATRETVTTHYROID999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74CAL62N600N
ALPK2QATRETVTITHYROID1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74BCPAPN600N
ALPK2QATRETVTITHYROID1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74CAL62N600N
ALPK2RETVTIATETHYROID1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74BCPAPN100N
ALPK2RETVTIATETHYROID1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74CAL62N100N
ALPK2TRETVTIATTHYROID1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74BCPAPN200N
ALPK2TRETVTIATTHYROID1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74CAL62N200N
BRAFATEKSRWSGTHYROID598p.V600Ec.1799T>AMissense_Mutation16.088305CN000N
BRAFATEKSRWSGTHYROID598p.V600Ec.1799T>AMissense_Mutation16.088505CN000N
BRAFATEKSRWSGTHYROID598p.V600Ec.1799T>AMissense_Mutation16.08BCPAPN000N
BRAFDFGLATEKSTHYROID594p.V600Ec.1799T>AMissense_Mutation16.088305CN000N
BRAFDFGLATEKSTHYROID594p.V600Ec.1799T>AMissense_Mutation16.088505CN000N
BRAFDFGLATEKSTHYROID594p.V600Ec.1799T>AMissense_Mutation16.08BCPAPN000N
BRAFEKSRWSGSHTHYROID600p.V600Ec.1799T>AMissense_Mutation16.088305CN100N
BRAFEKSRWSGSHTHYROID600p.V600Ec.1799T>AMissense_Mutation16.088505CN100N
BRAFEKSRWSGSHTHYROID600p.V600Ec.1799T>AMissense_Mutation16.08BCPAPN100N
BRAFFGLATEKSRTHYROID595p.V600Ec.1799T>AMissense_Mutation16.088305CN302N
BRAFFGLATEKSRTHYROID595p.V600Ec.1799T>AMissense_Mutation16.088505CN302N
BRAFFGLATEKSRTHYROID595p.V600Ec.1799T>AMissense_Mutation16.08BCPAPN302N
BRAFGDFGLATEKTHYROID593p.V600Ec.1799T>AMissense_Mutation16.088305CN100N
BRAFGDFGLATEKTHYROID593p.V600Ec.1799T>AMissense_Mutation16.088505CN100N
BRAFGDFGLATEKTHYROID593p.V600Ec.1799T>AMissense_Mutation16.08BCPAPN100N
BRAFGLATEKSRWTHYROID596p.V600Ec.1799T>AMissense_Mutation16.088305CN400N
BRAFGLATEKSRWTHYROID596p.V600Ec.1799T>AMissense_Mutation16.088505CN400N
BRAFGLATEKSRWTHYROID596p.V600Ec.1799T>AMissense_Mutation16.08BCPAPN400N
BRAFIGDFGLATETHYROID592p.V600Ec.1799T>AMissense_Mutation16.088305CN000N
BRAFIGDFGLATETHYROID592p.V600Ec.1799T>AMissense_Mutation16.088505CN000N
BRAFIGDFGLATETHYROID592p.V600Ec.1799T>AMissense_Mutation16.08BCPAPN000N
BRAFLATEKSRWSTHYROID597p.V600Ec.1799T>AMissense_Mutation16.088305CN200N
BRAFLATEKSRWSTHYROID597p.V600Ec.1799T>AMissense_Mutation16.088505CN200N
BRAFLATEKSRWSTHYROID597p.V600Ec.1799T>AMissense_Mutation16.08BCPAPN200N
BRAFTEKSRWSGSTHYROID599p.V600Ec.1799T>AMissense_Mutation16.088305CN300N
BRAFTEKSRWSGSTHYROID599p.V600Ec.1799T>AMissense_Mutation16.088505CN300N
BRAFTEKSRWSGSTHYROID599p.V600Ec.1799T>AMissense_Mutation16.08BCPAPN300N
CDH1APIPEPRTTTHYROID592p.I600Tc.1799T>CMissense_Mutation10.11FTC238N700Y
CDH1EPRTTFFCETHYROID596p.I600Tc.1799T>CMissense_Mutation10.11FTC238N000N
CDH1IPEPRTTFFTHYROID594p.I600Tc.1799T>CMissense_Mutation10.11FTC238Y12120N
CDH1PEPRTTFFCTHYROID595p.I600Tc.1799T>CMissense_Mutation10.11FTC238N000N
CDH1PIPEPRTTFTHYROID593p.I600Tc.1799T>CMissense_Mutation10.11FTC238N000N
CDH1PRTTFFCERTHYROID597p.I600Tc.1799T>CMissense_Mutation10.11FTC238N100N
CDH1RTTFFCERNTHYROID598p.I600Tc.1799T>CMissense_Mutation10.11FTC238N100Y
CDH1TFFCERNPKTHYROID600p.I600Tc.1799T>CMissense_Mutation10.11FTC238N100Y
CDH1TTFFCERNPTHYROID599p.I600Tc.1799T>CMissense_Mutation10.11FTC238N000Y
CHD1DQRSYGSRSTHYROID1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.868305CN100N
CHD1DQRSYGSRSTHYROID1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86BCPAPN100N
CHD1DQRSYGSRSTHYROID1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86CAL62N100N
CHD1DQRSYGSRSTHYROID1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86TTN100N
CHD1LDQRSYGSRTHYROID1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.868305CN000N
CHD1LDQRSYGSRTHYROID1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86BCPAPN000N
CHD1LDQRSYGSRTHYROID1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86CAL62N000N
CHD1LDQRSYGSRTHYROID1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86TTN000N
CHD1PLDQRSYGSTHYROID1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.868305CN000N
CHD1PLDQRSYGSTHYROID1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86BCPAPN000N
CHD1PLDQRSYGSTHYROID1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86CAL62N000N
CHD1PLDQRSYGSTHYROID1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86TTN000N
CHD1QRSYGSRSPTHYROID1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.868305CN000N
CHD1QRSYGSRSPTHYROID1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86BCPAPN000N
CHD1QRSYGSRSPTHYROID1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86CAL62N000N
CHD1QRSYGSRSPTHYROID1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86TTN000N
CHD1RSPLDQRSYTHYROID1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.868305CN600N
CHD1RSPLDQRSYTHYROID1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86BCPAPN600N
CHD1RSPLDQRSYTHYROID1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86CAL62N600N
CHD1RSPLDQRSYTHYROID1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86TTN600N
CHD1RSYGSRSPFTHYROID1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.868305CN900N
CHD1RSYGSRSPFTHYROID1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86BCPAPN900N
CHD1RSYGSRSPFTHYROID1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86CAL62N900N
CHD1RSYGSRSPFTHYROID1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86TTN900N
CHD1SPLDQRSYGTHYROID1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.868305CN000N
CHD1SPLDQRSYGTHYROID1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86BCPAPN000N
CHD1SPLDQRSYGTHYROID1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86CAL62N000N
CHD1SPLDQRSYGTHYROID1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86TTN000N
CHD1SYGSRSPFETHYROID1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.868305CN000N
CHD1SYGSRSPFETHYROID1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86BCPAPN000N
CHD1SYGSRSPFETHYROID1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86CAL62N000N
CHD1SYGSRSPFETHYROID1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86TTN000N
CREB3L2FTHITSDSFTHYROID95p.T100delc.299_301delCCAIn_Frame_Del444.478305CN801N
CREB3L2FTHITSDSFTHYROID95p.T100delc.299_301delCCAIn_Frame_Del444.47BCPAPN801N
CREB3L2FTHITSDSFTHYROID95p.T100delc.299_301delCCAIn_Frame_Del444.47FTC133N801N
CREB3L2FTHITSDSFTHYROID95p.T100delc.299_301delCCAIn_Frame_Del444.47ML1N801N
CREB3L2FTHITSDSFTHYROID95p.T100delc.299_301delCCAIn_Frame_Del444.47SW579N801N
CREB3L2HITSDSFNDTHYROID97p.T100delc.299_301delCCAIn_Frame_Del244.478305CN000N
CREB3L2HITSDSFNDTHYROID97p.T100delc.299_301delCCAIn_Frame_Del244.47BCPAPN000N
CREB3L2HITSDSFNDTHYROID97p.T100delc.299_301delCCAIn_Frame_Del244.47FTC133N000N
CREB3L2HITSDSFNDTHYROID97p.T100delc.299_301delCCAIn_Frame_Del244.47ML1N000N
CREB3L2HITSDSFNDTHYROID97p.T100delc.299_301delCCAIn_Frame_Del244.47SW579N000N
CREB3L2ITSDSFNDDTHYROID98p.T100delc.299_301delCCAIn_Frame_Del144.478305CN000N
CREB3L2ITSDSFNDDTHYROID98p.T100delc.299_301delCCAIn_Frame_Del144.47BCPAPN000N
CREB3L2ITSDSFNDDTHYROID98p.T100delc.299_301delCCAIn_Frame_Del144.47FTC133N000N
CREB3L2ITSDSFNDDTHYROID98p.T100delc.299_301delCCAIn_Frame_Del144.47ML1N000N
CREB3L2ITSDSFNDDTHYROID98p.T100delc.299_301delCCAIn_Frame_Del144.47SW579N000N
CREB3L2PFTHITSDSTHYROID94p.T100delc.299_301delCCAIn_Frame_Del344.478305CN000N
CREB3L2PFTHITSDSTHYROID94p.T100delc.299_301delCCAIn_Frame_Del344.47BCPAPN000N
CREB3L2PFTHITSDSTHYROID94p.T100delc.299_301delCCAIn_Frame_Del344.47FTC133N000N
CREB3L2PFTHITSDSTHYROID94p.T100delc.299_301delCCAIn_Frame_Del344.47ML1N000N
CREB3L2PFTHITSDSTHYROID94p.T100delc.299_301delCCAIn_Frame_Del344.47SW579N000N
CREB3L2QSPFTHITSTHYROID92p.T100delc.299_301delCCAIn_Frame_Del144.478305CN000N
CREB3L2QSPFTHITSTHYROID92p.T100delc.299_301delCCAIn_Frame_Del144.47BCPAPN000N
CREB3L2QSPFTHITSTHYROID92p.T100delc.299_301delCCAIn_Frame_Del144.47FTC133N000N
CREB3L2QSPFTHITSTHYROID92p.T100delc.299_301delCCAIn_Frame_Del144.47ML1N000N
CREB3L2QSPFTHITSTHYROID92p.T100delc.299_301delCCAIn_Frame_Del144.47SW579N000N
CREB3L2SPFTHITSDTHYROID93p.T100delc.299_301delCCAIn_Frame_Del244.478305CN100N
CREB3L2SPFTHITSDTHYROID93p.T100delc.299_301delCCAIn_Frame_Del244.47BCPAPN100N
CREB3L2SPFTHITSDTHYROID93p.T100delc.299_301delCCAIn_Frame_Del244.47FTC133N100N
CREB3L2SPFTHITSDTHYROID93p.T100delc.299_301delCCAIn_Frame_Del244.47ML1N100N
CREB3L2SPFTHITSDTHYROID93p.T100delc.299_301delCCAIn_Frame_Del244.47SW579N100N
CREB3L2THITSDSFNTHYROID96p.T100delc.299_301delCCAIn_Frame_Del344.478305CN100N
CREB3L2THITSDSFNTHYROID96p.T100delc.299_301delCCAIn_Frame_Del344.47BCPAPN100N
CREB3L2THITSDSFNTHYROID96p.T100delc.299_301delCCAIn_Frame_Del344.47FTC133N100N
CREB3L2THITSDSFNTHYROID96p.T100delc.299_301delCCAIn_Frame_Del344.47ML1N100N
CREB3L2THITSDSFNTHYROID96p.T100delc.299_301delCCAIn_Frame_Del344.47SW579N100N
CTBP2APSPNQPTNTHYROID966p.K974fsc.2922_2922delAFrame_Shift_Del124.348305CN300N
CTBP2APSPNQPTNTHYROID966p.K974fsc.2922_2922delAFrame_Shift_Del124.348505CN300N
CTBP2APSPNQPTNTHYROID966p.K974fsc.2922_2922delAFrame_Shift_Del124.34FTC133N300N
CTBP2APSPNQPTNTHYROID966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SW579N300N
CTBP2GTIESTPTSTHYROID976p.K974fsc.2922_2922delAFrame_Shift_Del524.348305CN100N
CTBP2GTIESTPTSTHYROID976p.K974fsc.2922_2922delAFrame_Shift_Del524.348505CN100N
CTBP2GTIESTPTSTHYROID976p.K974fsc.2922_2922delAFrame_Shift_Del524.34FTC133N100N
CTBP2GTIESTPTSTHYROID976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW579N100N
CTBP2NQPTNTGTITHYROID970p.K974fsc.2922_2922delAFrame_Shift_Del424.348305CN1000N
CTBP2NQPTNTGTITHYROID970p.K974fsc.2922_2922delAFrame_Shift_Del424.348505CN1000N
CTBP2NQPTNTGTITHYROID970p.K974fsc.2922_2922delAFrame_Shift_Del424.34FTC133N1000N
CTBP2NQPTNTGTITHYROID970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SW579N1000N
CTBP2NTGTIESTPTHYROID974p.K974fsc.2922_2922delAFrame_Shift_Del524.348305CN000N
CTBP2NTGTIESTPTHYROID974p.K974fsc.2922_2922delAFrame_Shift_Del524.348505CN000N
CTBP2NTGTIESTPTHYROID974p.K974fsc.2922_2922delAFrame_Shift_Del524.34FTC133N000N
CTBP2NTGTIESTPTHYROID974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW579N000N
CTBP2PNQPTNTGTTHYROID969p.K974fsc.2922_2922delAFrame_Shift_Del324.348305CN000N
CTBP2PNQPTNTGTTHYROID969p.K974fsc.2922_2922delAFrame_Shift_Del324.348505CN000N
CTBP2PNQPTNTGTTHYROID969p.K974fsc.2922_2922delAFrame_Shift_Del324.34FTC133N000N
CTBP2PNQPTNTGTTHYROID969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SW579N000N
CTBP2PSPNQPTNTTHYROID967p.K974fsc.2922_2922delAFrame_Shift_Del224.348305CN000N
CTBP2PSPNQPTNTTHYROID967p.K974fsc.2922_2922delAFrame_Shift_Del224.348505CN000N
CTBP2PSPNQPTNTTHYROID967p.K974fsc.2922_2922delAFrame_Shift_Del224.34FTC133N000N
CTBP2PSPNQPTNTTHYROID967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SW579N000N
CTBP2PTNTGTIESTHYROID972p.K974fsc.2922_2922delAFrame_Shift_Del524.348305CN000N
CTBP2PTNTGTIESTHYROID972p.K974fsc.2922_2922delAFrame_Shift_Del524.348505CN000N
CTBP2PTNTGTIESTHYROID972p.K974fsc.2922_2922delAFrame_Shift_Del524.34FTC133N000N
CTBP2PTNTGTIESTHYROID972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW579N000N
CTBP2QPTNTGTIETHYROID971p.K974fsc.2922_2922delAFrame_Shift_Del524.348305CN000N
CTBP2QPTNTGTIETHYROID971p.K974fsc.2922_2922delAFrame_Shift_Del524.348505CN000N
CTBP2QPTNTGTIETHYROID971p.K974fsc.2922_2922delAFrame_Shift_Del524.34FTC133N000N
CTBP2QPTNTGTIETHYROID971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW579N000N
CTBP2SPNQPTNTGTHYROID968p.K974fsc.2922_2922delAFrame_Shift_Del224.348305CN000N
CTBP2SPNQPTNTGTHYROID968p.K974fsc.2922_2922delAFrame_Shift_Del224.348505CN000N
CTBP2SPNQPTNTGTHYROID968p.K974fsc.2922_2922delAFrame_Shift_Del224.34FTC133N000N
CTBP2SPNQPTNTGTHYROID968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SW579N000N
CTBP2TGTIESTPTTHYROID975p.K974fsc.2922_2922delAFrame_Shift_Del524.348305CN000N
CTBP2TGTIESTPTTHYROID975p.K974fsc.2922_2922delAFrame_Shift_Del524.348505CN000N
CTBP2TGTIESTPTTHYROID975p.K974fsc.2922_2922delAFrame_Shift_Del524.34FTC133N000N
CTBP2TGTIESTPTTHYROID975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW579N000N
CTBP2TIESTPTSNTHYROID977p.K974fsc.2922_2922delAFrame_Shift_Del524.348305CN100N
CTBP2TIESTPTSNTHYROID977p.K974fsc.2922_2922delAFrame_Shift_Del524.348505CN100N
CTBP2TIESTPTSNTHYROID977p.K974fsc.2922_2922delAFrame_Shift_Del524.34FTC133N100N
CTBP2TIESTPTSNTHYROID977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW579N100N
CTBP2TNTGTIESTTHYROID973p.K974fsc.2922_2922delAFrame_Shift_Del524.348305CN000N
CTBP2TNTGTIESTTHYROID973p.K974fsc.2922_2922delAFrame_Shift_Del524.348505CN000N
CTBP2TNTGTIESTTHYROID973p.K974fsc.2922_2922delAFrame_Shift_Del524.34FTC133N000N
CTBP2TNTGTIESTTHYROID973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW579N000N
ERBB2CMQIVKGMSTHYROID826p.A830Vc.2489C>TMissense_Mutation10.22FTC133N000N
ERBB2CMQIVKGMSTHYROID826p.A830Vc.2489C>TMissense_Mutation10.22FTC238N000N
ERBB2IVKGMSYLETHYROID829p.A830Vc.2489C>TMissense_Mutation10.22FTC133N000N
ERBB2IVKGMSYLETHYROID829p.A830Vc.2489C>TMissense_Mutation10.22FTC238N000N
ERBB2LLNWCMQIVTHYROID822p.A830Vc.2489C>TMissense_Mutation10.22FTC133Y7111N
ERBB2LLNWCMQIVTHYROID822p.A830Vc.2489C>TMissense_Mutation10.22FTC238Y7111N
ERBB2LNWCMQIVKTHYROID823p.A830Vc.2489C>TMissense_Mutation10.22FTC133N202N
ERBB2LNWCMQIVKTHYROID823p.A830Vc.2489C>TMissense_Mutation10.22FTC238N202N
ERBB2MQIVKGMSYTHYROID827p.A830Vc.2489C>TMissense_Mutation10.22FTC133N7018N
ERBB2MQIVKGMSYTHYROID827p.A830Vc.2489C>TMissense_Mutation10.22FTC238N7018N
ERBB2NWCMQIVKGTHYROID824p.A830Vc.2489C>TMissense_Mutation10.22FTC133N000N
ERBB2NWCMQIVKGTHYROID824p.A830Vc.2489C>TMissense_Mutation10.22FTC238N000N
ERBB2QIVKGMSYLTHYROID828p.A830Vc.2489C>TMissense_Mutation10.22FTC133Y1090N
ERBB2QIVKGMSYLTHYROID828p.A830Vc.2489C>TMissense_Mutation10.22FTC238Y1090N
ERBB2VKGMSYLEDTHYROID830p.A830Vc.2489C>TMissense_Mutation10.22FTC133N003N
ERBB2VKGMSYLEDTHYROID830p.A830Vc.2489C>TMissense_Mutation10.22FTC238N003N
ERBB2WCMQIVKGMTHYROID825p.A830Vc.2489C>TMissense_Mutation10.22FTC133N5021N
ERBB2WCMQIVKGMTHYROID825p.A830Vc.2489C>TMissense_Mutation10.22FTC238N5021N
FMN2LPPLPGAAITHYROID934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03BCPAPN1401N
FMN2PLPPLPGAATHYROID933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03BCPAPN000N
GPR112ASISDMFIQTHYROID2652p.D2657delc.7966_7968delGATIn_Frame_Del466.78305CN000N
GPR112ASISDMFIQTHYROID2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7CGTHW1N000N
GPR112ASISDMFIQTHYROID2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7ML1N000N
GPR112ASISDMFIQTHYROID2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SW579N000N
GPR112ASISDMFIQTHYROID2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TT2609C02N000N
GPR112ISDMFIQNLTHYROID2654p.D2657delc.7966_7968delGATIn_Frame_Del266.78305CY11100N
GPR112ISDMFIQNLTHYROID2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7CGTHW1Y11100N
GPR112ISDMFIQNLTHYROID2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7ML1Y11100N
GPR112ISDMFIQNLTHYROID2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SW579Y11100N
GPR112ISDMFIQNLTHYROID2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TT2609C02Y11100N
GPR112SASISDMFITHYROID2651p.D2657delc.7966_7968delGATIn_Frame_Del366.78305CN700N
GPR112SASISDMFITHYROID2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7CGTHW1N700N
GPR112SASISDMFITHYROID2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7ML1N700N
GPR112SASISDMFITHYROID2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SW579N700N
GPR112SASISDMFITHYROID2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TT2609C02N700N
GPR112SDMFIQNLATHYROID2655p.D2657delc.7966_7968delGATIn_Frame_Del166.78305CN400N
GPR112SDMFIQNLATHYROID2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7CGTHW1N400N
GPR112SDMFIQNLATHYROID2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7ML1N400N
GPR112SDMFIQNLATHYROID2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SW579N400N
GPR112SDMFIQNLATHYROID2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TT2609C02N400N
GPR112SISDMFIQNTHYROID2653p.D2657delc.7966_7968delGATIn_Frame_Del366.78305CN000N
GPR112SISDMFIQNTHYROID2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7CGTHW1N000N
GPR112SISDMFIQNTHYROID2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7ML1N000N
GPR112SISDMFIQNTHYROID2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SW579N000N
GPR112SISDMFIQNTHYROID2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TT2609C02N000N
GPR112VSASISDMFTHYROID2650p.D2657delc.7966_7968delGATIn_Frame_Del266.78305CN900N
GPR112VSASISDMFTHYROID2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7CGTHW1N900N
GPR112VSASISDMFTHYROID2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7ML1N900N
GPR112VSASISDMFTHYROID2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SW579N900N
GPR112VSASISDMFTHYROID2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TT2609C02N900N
GPR112VVSASISDMTHYROID2649p.D2657delc.7966_7968delGATIn_Frame_Del166.78305CN5020N
GPR112VVSASISDMTHYROID2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7CGTHW1N5020N
GPR112VVSASISDMTHYROID2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7ML1N5020N
GPR112VVSASISDMTHYROID2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SW579N5020N
GPR112VVSASISDMTHYROID2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TT2609C02N5020N
GPR112AAPVDFVFPTHYROID477p.S482Fc.1445C>TMissense_Mutation10.11ML1N000Y
GPR112APVDFVFPRTHYROID478p.S482Fc.1445C>TMissense_Mutation10.11ML1Y690Y
GPR112DFVFPRNQTTHYROID481p.S482Fc.1445C>TMissense_Mutation10.11ML1N100N
GPR112FVFPRNQTATHYROID482p.S482Fc.1445C>TMissense_Mutation10.11ML1Y797N
GPR112ISTAAPVDFTHYROID474p.S482Fc.1445C>TMissense_Mutation10.11ML1N500N
GPR112PVDFVFPRNTHYROID479p.S482Fc.1445C>TMissense_Mutation10.11ML1N000N
GPR112STAAPVDFVTHYROID475p.S482Fc.1445C>TMissense_Mutation10.11ML1Y4120N
GPR112TAAPVDFVFTHYROID476p.S482Fc.1445C>TMissense_Mutation10.11ML1Y890Y
GPR112VDFVFPRNQTHYROID480p.S482Fc.1445C>TMissense_Mutation10.11ML1N000N
HSP90B1DEEETAKESTHYROID787p.E791delc.2362_2364delGAAIn_Frame_Del121.798505CN300N
HSP90B1DEEETAKESTHYROID787p.E791delc.2362_2364delGAAIn_Frame_Del121.79TT2609C02N300N
HSP90B1DVGTDEEETTHYROID783p.E791delc.2362_2364delGAAIn_Frame_Del121.798505CN200N
HSP90B1DVGTDEEETTHYROID783p.E791delc.2362_2364delGAAIn_Frame_Del121.79TT2609C02N200N
HSP90B1GTDEEETAKTHYROID785p.E791delc.2362_2364delGAAIn_Frame_Del321.798505CN400N
HSP90B1GTDEEETAKTHYROID785p.E791delc.2362_2364delGAAIn_Frame_Del321.79TT2609C02N400N
HSP90B1TDEEETAKETHYROID786p.E791delc.2362_2364delGAAIn_Frame_Del221.798505CN000N
HSP90B1TDEEETAKETHYROID786p.E791delc.2362_2364delGAAIn_Frame_Del221.79TT2609C02N000N
HSP90B1VGTDEEETATHYROID784p.E791delc.2362_2364delGAAIn_Frame_Del221.798505CN100N
HSP90B1VGTDEEETATHYROID784p.E791delc.2362_2364delGAAIn_Frame_Del221.79TT2609C02N100N
MAP3K1STTTTTTTETHYROID941p.T949delc.2822_2824delCAAIn_Frame_Del176.448305CN000N
MAP3K1STTTTTTTETHYROID941p.T949delc.2822_2824delCAAIn_Frame_Del176.448505CN000N
MAP3K1STTTTTTTETHYROID941p.T949delc.2822_2824delCAAIn_Frame_Del176.44CAL62N000N
MAP3K1STTTTTTTETHYROID941p.T949delc.2822_2824delCAAIn_Frame_Del176.44CGTHW1N000N
MAP3K1STTTTTTTETHYROID941p.T949delc.2822_2824delCAAIn_Frame_Del176.44FTC133N000N
MAP3K1STTTTTTTETHYROID941p.T949delc.2822_2824delCAAIn_Frame_Del176.44ML1N000N
MAP3K1STTTTTTTETHYROID941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SW579N000N
MAP3K1STTTTTTTETHYROID941p.T949delc.2822_2824delCAAIn_Frame_Del176.44TTN000N
MLL3AEYSILCKCTHYROID203p.M184fsc.550_551insAFrame_Shift_Ins60.11FTC238N700N
MLL3AKLSTTKTKTHYROID185p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238N100N
MLL3CKCKHPDSFTHYROID209p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238N200N
MLL3EKNAKLSTTTHYROID182p.M184fsc.550_551insAFrame_Shift_Ins40.11FTC238N100N
MLL3EKRTISSAETHYROID196p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238N000Y
MLL3EYSILCKCKTHYROID204p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238N100Y
MLL3GTYEKNAKLTHYROID179p.M184fsc.550_551insAFrame_Shift_Ins40.11FTC238Y22120Y
MLL3ILCKCKHPDTHYROID207p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238N009N
MLL3ISSAEYSILTHYROID200p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238Y10100N
MLL3KCKHPDSFRTHYROID210p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238N300N
MLL3KLSTTKTKRTHYROID186p.M184fsc.550_551insAFrame_Shift_Ins40.11FTC238N700N
MLL3KNAKLSTTKTHYROID183p.M184fsc.550_551insAFrame_Shift_Ins40.11FTC238N100N
MLL3KRTEKRTISTHYROID193p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238N300N
MLL3KRTISSAEYTHYROID197p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238N400N
MLL3KTKRTEKRTTHYROID191p.M184fsc.550_551insAFrame_Shift_Ins40.11FTC238N100N
MLL3LCKCKHPDSTHYROID208p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238N100N
MLL3LSTTKTKRTTHYROID187p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238N100N
MLL3NAKLSTTKTTHYROID184p.M184fsc.550_551insAFrame_Shift_Ins40.11FTC238N400N
MLL3NGTYEKNAKTHYROID178p.M184fsc.550_551insAFrame_Shift_Ins30.11FTC238N000N
MLL3NSNGTYEKNTHYROID176p.M184fsc.550_551insAFrame_Shift_Ins10.11FTC238N000N
MLL3RTEKRTISSTHYROID194p.M184fsc.550_551insAFrame_Shift_Ins40.11FTC238N200N
MLL3RTISSAEYSTHYROID198p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238N100N
MLL3SAEYSILCKTHYROID202p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238N300N
MLL3SILCKCKHPTHYROID206p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238N000N
MLL3SNGTYEKNATHYROID177p.M184fsc.550_551insAFrame_Shift_Ins20.11FTC238N000Y
MLL3SSAEYSILCTHYROID201p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238N100N
MLL3STTKTKRTETHYROID188p.M184fsc.550_551insAFrame_Shift_Ins40.11FTC238N000N
MLL3TEKRTISSATHYROID195p.M184fsc.550_551insAFrame_Shift_Ins40.11FTC238Y690N
MLL3TISSAEYSITHYROID199p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238Y1100N
MLL3TKRTEKRTITHYROID192p.M184fsc.550_551insAFrame_Shift_Ins40.11FTC238N200N
MLL3TKTKRTEKRTHYROID190p.M184fsc.550_551insAFrame_Shift_Ins40.11FTC238N100N
MLL3TTKTKRTEKTHYROID189p.M184fsc.550_551insAFrame_Shift_Ins40.11FTC238Y1120N
MLL3TYEKNAKLSTHYROID180p.M184fsc.550_551insAFrame_Shift_Ins40.11FTC238N100Y
MLL3YEKNAKLSTTHYROID181p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238N704N
MLL3YSILCKCKHTHYROID205p.M184fsc.550_551insAFrame_Shift_Ins50.11FTC238N2023N
MLL3APSQIPIQDTHYROID1858p.R1861Qc.5582G>AMissense_Mutation10.11FTC238N000N
MLL3PAPSQIPIQTHYROID1857p.R1861Qc.5582G>AMissense_Mutation10.11FTC238N000N
MLL3PPAPSQIPITHYROID1856p.R1861Qc.5582G>AMissense_Mutation10.11FTC238N700N
MLL3PPPAPSQIPTHYROID1855p.R1861Qc.5582G>AMissense_Mutation10.11FTC238N000N
MLL3PPPPAPSQITHYROID1854p.R1861Qc.5582G>AMissense_Mutation10.11FTC238N600N
MLL3PPPPPAPSQTHYROID1853p.R1861Qc.5582G>AMissense_Mutation10.11FTC238N000N
MLL3PSQIPIQDSTHYROID1859p.R1861Qc.5582G>AMissense_Mutation10.11FTC238N000N
MLL3QIPIQDSLSTHYROID1861p.R1861Qc.5582G>AMissense_Mutation10.11FTC238N000N
MLL3SQIPIQDSLTHYROID1860p.R1861Qc.5582G>AMissense_Mutation10.11FTC238Y18110N
MSH3AAAAPPAPATHYROID59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23BCPAPN200N
MSH3AAAAPPAPATHYROID59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23TTN200N
MSH3AAAPPAPAFTHYROID60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23BCPAPY8100N
MSH3AAAPPAPAFTHYROID60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23TTY8100N
MSH3AAPPAPAFPTHYROID61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23BCPAPN000N
MSH3AAPPAPAFPTHYROID61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23TTN000N
MSH6DKNYKTGSLTHYROID1041p.K1045fsc.3135_3135delGFrame_Shift_Del40.22FTC133N500N
MSH6DKNYKTGSLTHYROID1041p.K1045fsc.3135_3135delGFrame_Shift_Del40.22FTC238N500N
MSH6FDKNYKTGSTHYROID1040p.K1045fsc.3135_3135delGFrame_Shift_Del30.22FTC133N400N
MSH6FDKNYKTGSTHYROID1040p.K1045fsc.3135_3135delGFrame_Shift_Del30.22FTC238N400N
MSH6KNYKTGSLLTHYROID1042p.K1045fsc.3135_3135delGFrame_Shift_Del50.22FTC133N1500N
MSH6KNYKTGSLLTHYROID1042p.K1045fsc.3135_3135delGFrame_Shift_Del50.22FTC238N1500N
MSH6NFDKNYKTGTHYROID1039p.K1045fsc.3135_3135delGFrame_Shift_Del20.22FTC133N000N
MSH6NFDKNYKTGTHYROID1039p.K1045fsc.3135_3135delGFrame_Shift_Del20.22FTC238N000N
MSH6YNFDKNYKTTHYROID1038p.K1045fsc.3135_3135delGFrame_Shift_Del10.22FTC133N305N
MSH6YNFDKNYKTTHYROID1038p.K1045fsc.3135_3135delGFrame_Shift_Del10.22FTC238N305N
MSH6EDTPPLLRATHYROID1083p.T1085fsc.3253_3254insCFrame_Shift_Ins31.11FTC238N400Y
MSH6LLPEDTPPLTHYROID1080p.T1085fsc.3253_3254insCFrame_Shift_Ins11.11FTC238N1603Y
MSH6LPEDTPPLLTHYROID1081p.T1085fsc.3253_3254insCFrame_Shift_Ins11.11FTC238N1600Y
MSH6PEDTPPLLRTHYROID1082p.T1085fsc.3253_3254insCFrame_Shift_Ins21.11FTC238N000Y
MYLKASKELKKDVTHYROID1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02ML1N400N
MYLKKELKKDVKNTHYROID1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02ML1N500N
MYLKKSASKELKKTHYROID1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02ML1N400N
MYLKLKSASKELKTHYROID1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02ML1N105N
MYLKNLKSASKELTHYROID1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02ML1Y5100N
MYLKSASKELKKDTHYROID1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02ML1N000N
MYLKSKELKKDVKTHYROID1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02ML1N200N
NR1H2IRKQQQQQETHYROID170p.176_177insQc.516_517insCAGIn_Frame_Ins296.138305CN101Y
NR1H2IRKQQQQQETHYROID170p.176_177insQc.514_515insAACIn_Frame_Ins296.138505CN101Y
NR1H2IRKQQQQQETHYROID170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13BCPAPN101Y
NR1H2IRKQQQQQETHYROID170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13CAL62N101Y
NR1H2IRKQQQQQETHYROID170p.176_177insQc.514_515insAACIn_Frame_Ins296.13CGTHW1N101Y
NR1H2IRKQQQQQETHYROID170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13CGTHW1N101Y
NR1H2IRKQQQQQETHYROID170p.176_177insQc.514_515insAACIn_Frame_Ins296.13FTC133N101Y
NR1H2IRKQQQQQETHYROID170p.176_177insQc.514_515insAACIn_Frame_Ins296.13ML1N101Y
NR1H2IRKQQQQQETHYROID170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SW579N101Y
NR1H2IRKQQQQQETHYROID170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SW579N101Y
NR1H2IRKQQQQQETHYROID170p.176_177insQc.514_515insAACIn_Frame_Ins296.13TT2609C02N101Y
NR1H2IRKQQQQQETHYROID170p.176_177insQc.514_515insAACIn_Frame_Ins296.13TTN101Y
NR1H2KIRKQQQQQTHYROID169p.176_177insQc.516_517insCAGIn_Frame_Ins196.138305CN000Y
NR1H2KIRKQQQQQTHYROID169p.176_177insQc.514_515insAACIn_Frame_Ins196.138505CN000Y
NR1H2KIRKQQQQQTHYROID169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13BCPAPN000Y
NR1H2KIRKQQQQQTHYROID169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13CAL62N000Y
NR1H2KIRKQQQQQTHYROID169p.176_177insQc.514_515insAACIn_Frame_Ins196.13CGTHW1N000Y
NR1H2KIRKQQQQQTHYROID169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13CGTHW1N000Y
NR1H2KIRKQQQQQTHYROID169p.176_177insQc.514_515insAACIn_Frame_Ins196.13FTC133N000Y
NR1H2KIRKQQQQQTHYROID169p.176_177insQc.514_515insAACIn_Frame_Ins196.13ML1N000Y
NR1H2KIRKQQQQQTHYROID169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SW579N000Y
NR1H2KIRKQQQQQTHYROID169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SW579N000Y
NR1H2KIRKQQQQQTHYROID169p.176_177insQc.514_515insAACIn_Frame_Ins196.13TT2609C02N000Y
NR1H2KIRKQQQQQTHYROID169p.176_177insQc.514_515insAACIn_Frame_Ins196.13TTN000Y
NR1H2KQQQQQESQTHYROID172p.176_177insQc.516_517insCAGIn_Frame_Ins296.138305CN000Y
NR1H2KQQQQQESQTHYROID172p.176_177insQc.514_515insAACIn_Frame_Ins296.138505CN000Y
NR1H2KQQQQQESQTHYROID172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13BCPAPN000Y
NR1H2KQQQQQESQTHYROID172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13CAL62N000Y
NR1H2KQQQQQESQTHYROID172p.176_177insQc.514_515insAACIn_Frame_Ins296.13CGTHW1N000Y
NR1H2KQQQQQESQTHYROID172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13CGTHW1N000Y
NR1H2KQQQQQESQTHYROID172p.176_177insQc.514_515insAACIn_Frame_Ins296.13FTC133N000Y
NR1H2KQQQQQESQTHYROID172p.176_177insQc.514_515insAACIn_Frame_Ins296.13ML1N000Y
NR1H2KQQQQQESQTHYROID172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SW579N000Y
NR1H2KQQQQQESQTHYROID172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SW579N000Y
NR1H2KQQQQQESQTHYROID172p.176_177insQc.514_515insAACIn_Frame_Ins296.13TT2609C02N000Y
NR1H2KQQQQQESQTHYROID172p.176_177insQc.514_515insAACIn_Frame_Ins296.13TTN000Y
NR1H2QQQQQESQSTHYROID173p.176_177insQc.516_517insCAGIn_Frame_Ins196.138305CN000Y
NR1H2QQQQQESQSTHYROID173p.176_177insQc.514_515insAACIn_Frame_Ins196.138505CN000Y
NR1H2QQQQQESQSTHYROID173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13BCPAPN000Y
NR1H2QQQQQESQSTHYROID173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13CAL62N000Y
NR1H2QQQQQESQSTHYROID173p.176_177insQc.514_515insAACIn_Frame_Ins196.13CGTHW1N000Y
NR1H2QQQQQESQSTHYROID173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13CGTHW1N000Y
NR1H2QQQQQESQSTHYROID173p.176_177insQc.514_515insAACIn_Frame_Ins196.13FTC133N000Y
NR1H2QQQQQESQSTHYROID173p.176_177insQc.514_515insAACIn_Frame_Ins196.13ML1N000Y
NR1H2QQQQQESQSTHYROID173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SW579N000Y
NR1H2QQQQQESQSTHYROID173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SW579N000Y
NR1H2QQQQQESQSTHYROID173p.176_177insQc.514_515insAACIn_Frame_Ins196.13TT2609C02N000Y
NR1H2QQQQQESQSTHYROID173p.176_177insQc.514_515insAACIn_Frame_Ins196.13TTN000Y
NR1H2RKQQQQQESTHYROID171p.176_177insQc.516_517insCAGIn_Frame_Ins396.138305CN100Y
NR1H2RKQQQQQESTHYROID171p.176_177insQc.514_515insAACIn_Frame_Ins396.138505CN100Y
NR1H2RKQQQQQESTHYROID171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13BCPAPN100Y
NR1H2RKQQQQQESTHYROID171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13CAL62N100Y
NR1H2RKQQQQQESTHYROID171p.176_177insQc.514_515insAACIn_Frame_Ins396.13CGTHW1N100Y
NR1H2RKQQQQQESTHYROID171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13CGTHW1N100Y
NR1H2RKQQQQQESTHYROID171p.176_177insQc.514_515insAACIn_Frame_Ins396.13FTC133N100Y
NR1H2RKQQQQQESTHYROID171p.176_177insQc.514_515insAACIn_Frame_Ins396.13ML1N100Y
NR1H2RKQQQQQESTHYROID171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SW579N100Y
NR1H2RKQQQQQESTHYROID171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13SW579N100Y
NR1H2RKQQQQQESTHYROID171p.176_177insQc.514_515insAACIn_Frame_Ins396.13TT2609C02N100Y
NR1H2RKQQQQQESTHYROID171p.176_177insQc.514_515insAACIn_Frame_Ins396.13TTN100Y
NRASAGREEYSAMTHYROID59p.Q61Rc.182A>GMissense_Mutation10.77TT2609C02Y7100N
NRASDILDTAGRETHYROID54p.Q61Rc.182A>GMissense_Mutation10.77TT2609C02N000N
NRASDTAGREEYSTHYROID57p.Q61Rc.182A>GMissense_Mutation10.77TT2609C02N000N
NRASGREEYSAMRTHYROID60p.Q61Rc.182A>GMissense_Mutation10.77TT2609C02N400N
NRASILDTAGREETHYROID55p.Q61Rc.182A>GMissense_Mutation10.77TT2609C02N000N
NRASLDILDTAGRTHYROID53p.Q61Rc.182A>GMissense_Mutation10.77TT2609C02N003N
NRASLDTAGREEYTHYROID56p.Q61Rc.182A>GMissense_Mutation10.77TT2609C02N400N
NRASREEYSAMRDTHYROID61p.Q61Rc.182A>GMissense_Mutation10.77TT2609C02N000N
NRASTAGREEYSATHYROID58p.Q61Rc.182A>GMissense_Mutation10.77TT2609C02N200N
PDE4DIPANLDQGRVRTHYROID603p.L601fsc.1801_1801delCFrame_Shift_Del615.498505CY2110N
PDE4DIPANLDQGRVRTHYROID603p.L601fsc.1801_1801delCFrame_Shift_Del615.49SW579Y2110N
PDE4DIPATCSANLDQTHYROID599p.L601fsc.1801_1801delCFrame_Shift_Del615.498505CN000N
PDE4DIPATCSANLDQTHYROID599p.L601fsc.1801_1801delCFrame_Shift_Del615.49SW579N000N
PDE4DIPCSANLDQGRTHYROID601p.L601fsc.1801_1801delCFrame_Shift_Del515.498505CN300N
PDE4DIPCSANLDQGRTHYROID601p.L601fsc.1801_1801delCFrame_Shift_Del515.49SW579N300N
PDE4DIPDLSATCSANTHYROID596p.L601fsc.1801_1801delCFrame_Shift_Del415.498505CN000N
PDE4DIPDLSATCSANTHYROID596p.L601fsc.1801_1801delCFrame_Shift_Del415.49SW579N000N
PDE4DIPEDLSATCSATHYROID595p.L601fsc.1801_1801delCFrame_Shift_Del315.498505CN400N
PDE4DIPEDLSATCSATHYROID595p.L601fsc.1801_1801delCFrame_Shift_Del315.49SW579N400N
PDE4DIPEVEDLSATCTHYROID593p.L601fsc.1801_1801delCFrame_Shift_Del115.498505CN200N
PDE4DIPEVEDLSATCTHYROID593p.L601fsc.1801_1801delCFrame_Shift_Del115.49SW579N200N
PDE4DIPLSATCSANLTHYROID597p.L601fsc.1801_1801delCFrame_Shift_Del415.498505CN1102N
PDE4DIPLSATCSANLTHYROID597p.L601fsc.1801_1801delCFrame_Shift_Del415.49SW579N1102N
PDE4DIPSANLDQGRVTHYROID602p.L601fsc.1801_1801delCFrame_Shift_Del515.498505CN400N
PDE4DIPSANLDQGRVTHYROID602p.L601fsc.1801_1801delCFrame_Shift_Del515.49SW579N400N
PDE4DIPSATCSANLDTHYROID598p.L601fsc.1801_1801delCFrame_Shift_Del515.498505CN000N
PDE4DIPSATCSANLDTHYROID598p.L601fsc.1801_1801delCFrame_Shift_Del515.49SW579N000N
PDE4DIPTCSANLDQGTHYROID600p.L601fsc.1801_1801delCFrame_Shift_Del615.498505CN100N
PDE4DIPTCSANLDQGTHYROID600p.L601fsc.1801_1801delCFrame_Shift_Del615.49SW579N100N
PDE4DIPVEDLSATCSTHYROID594p.L601fsc.1801_1801delCFrame_Shift_Del215.498505CN300N
PDE4DIPVEDLSATCSTHYROID594p.L601fsc.1801_1801delCFrame_Shift_Del215.49SW579N300N
PDE4DIPADSRKKSSKTHYROID242p.E243fsc.729_729delAFrame_Shift_Del517.598505CN000Y
PDE4DIPADSRKKSSKTHYROID242p.E243fsc.729_729delAFrame_Shift_Del517.59CGTHW1N000Y
PDE4DIPADSRKKSSKTHYROID242p.E243fsc.729_729delAFrame_Shift_Del517.59SW579N000Y
PDE4DIPADSRKKSSKTHYROID242p.E243fsc.729_729delAFrame_Shift_Del517.59TT2609C02N000Y
PDE4DIPDSHLADSRKTHYROID238p.E243fsc.729_729delAFrame_Shift_Del417.598505CN200N
PDE4DIPDSHLADSRKTHYROID238p.E243fsc.729_729delAFrame_Shift_Del417.59CGTHW1N200N
PDE4DIPDSHLADSRKTHYROID238p.E243fsc.729_729delAFrame_Shift_Del417.59SW579N200N
PDE4DIPDSHLADSRKTHYROID238p.E243fsc.729_729delAFrame_Shift_Del417.59TT2609C02N200N
PDE4DIPDSRKKSSKQTHYROID243p.E243fsc.729_729delAFrame_Shift_Del417.598505CN200Y
PDE4DIPDSRKKSSKQTHYROID243p.E243fsc.729_729delAFrame_Shift_Del417.59CGTHW1N200Y
PDE4DIPDSRKKSSKQTHYROID243p.E243fsc.729_729delAFrame_Shift_Del417.59SW579N200Y
PDE4DIPDSRKKSSKQTHYROID243p.E243fsc.729_729delAFrame_Shift_Del417.59TT2609C02N200Y
PDE4DIPHLADSRKKSTHYROID240p.E243fsc.729_729delAFrame_Shift_Del517.598505CN000N
PDE4DIPHLADSRKKSTHYROID240p.E243fsc.729_729delAFrame_Shift_Del517.59CGTHW1N000N
PDE4DIPHLADSRKKSTHYROID240p.E243fsc.729_729delAFrame_Shift_Del517.59SW579N000N
PDE4DIPHLADSRKKSTHYROID240p.E243fsc.729_729delAFrame_Shift_Del517.59TT2609C02N000N
PDE4DIPKKSSKQRPPTHYROID246p.E243fsc.729_729delAFrame_Shift_Del517.598505CN100Y
PDE4DIPKKSSKQRPPTHYROID246p.E243fsc.729_729delAFrame_Shift_Del517.59CGTHW1N100Y
PDE4DIPKKSSKQRPPTHYROID246p.E243fsc.729_729delAFrame_Shift_Del517.59SW579N100Y
PDE4DIPKKSSKQRPPTHYROID246p.E243fsc.729_729delAFrame_Shift_Del517.59TT2609C02N100Y
PDE4DIPKQRPPTRFFTHYROID250p.E243fsc.729_729delAFrame_Shift_Del617.598505CY7100Y
PDE4DIPKQRPPTRFFTHYROID250p.E243fsc.729_729delAFrame_Shift_Del617.59CGTHW1Y7100Y
PDE4DIPKQRPPTRFFTHYROID250p.E243fsc.729_729delAFrame_Shift_Del617.59SW579Y7100Y
PDE4DIPKQRPPTRFFTHYROID250p.E243fsc.729_729delAFrame_Shift_Del617.59TT2609C02Y7100Y
PDE4DIPKSSKQRPPTTHYROID247p.E243fsc.729_729delAFrame_Shift_Del517.598505CN200Y
PDE4DIPKSSKQRPPTTHYROID247p.E243fsc.729_729delAFrame_Shift_Del517.59CGTHW1N200Y
PDE4DIPKSSKQRPPTTHYROID247p.E243fsc.729_729delAFrame_Shift_Del517.59SW579N200Y
PDE4DIPKSSKQRPPTTHYROID247p.E243fsc.729_729delAFrame_Shift_Del517.59TT2609C02N200Y
PDE4DIPLADSRKKSSTHYROID241p.E243fsc.729_729delAFrame_Shift_Del517.598505CN100N
PDE4DIPLADSRKKSSTHYROID241p.E243fsc.729_729delAFrame_Shift_Del517.59CGTHW1N100N
PDE4DIPLADSRKKSSTHYROID241p.E243fsc.729_729delAFrame_Shift_Del517.59SW579N100N
PDE4DIPLADSRKKSSTHYROID241p.E243fsc.729_729delAFrame_Shift_Del517.59TT2609C02N100N
PDE4DIPPPTRFFKRNTHYROID253p.E243fsc.729_729delAFrame_Shift_Del517.598505CN000Y
PDE4DIPPPTRFFKRNTHYROID253p.E243fsc.729_729delAFrame_Shift_Del517.59CGTHW1N000Y
PDE4DIPPPTRFFKRNTHYROID253p.E243fsc.729_729delAFrame_Shift_Del517.59SW579N000Y
PDE4DIPPPTRFFKRNTHYROID253p.E243fsc.729_729delAFrame_Shift_Del517.59TT2609C02N000Y
PDE4DIPPTRFFKRNLTHYROID254p.E243fsc.729_729delAFrame_Shift_Del617.598505CY2110Y
PDE4DIPPTRFFKRNLTHYROID254p.E243fsc.729_729delAFrame_Shift_Del617.59CGTHW1Y2110Y
PDE4DIPPTRFFKRNLTHYROID254p.E243fsc.729_729delAFrame_Shift_Del617.59SW579Y2110Y
PDE4DIPPTRFFKRNLTHYROID254p.E243fsc.729_729delAFrame_Shift_Del617.59TT2609C02Y2110Y
PDE4DIPQRPPTRFFKTHYROID251p.E243fsc.729_729delAFrame_Shift_Del617.598505CY2100Y
PDE4DIPQRPPTRFFKTHYROID251p.E243fsc.729_729delAFrame_Shift_Del617.59CGTHW1Y2100Y
PDE4DIPQRPPTRFFKTHYROID251p.E243fsc.729_729delAFrame_Shift_Del617.59SW579Y2100Y
PDE4DIPQRPPTRFFKTHYROID251p.E243fsc.729_729delAFrame_Shift_Del617.59TT2609C02Y2100Y
PDE4DIPRFFKRNLMKTHYROID256p.E243fsc.729_729delAFrame_Shift_Del617.598505CY2130N
PDE4DIPRFFKRNLMKTHYROID256p.E243fsc.729_729delAFrame_Shift_Del617.59CGTHW1Y2130N
PDE4DIPRFFKRNLMKTHYROID256p.E243fsc.729_729delAFrame_Shift_Del617.59SW579Y2130N
PDE4DIPRFFKRNLMKTHYROID256p.E243fsc.729_729delAFrame_Shift_Del617.59TT2609C02Y2130N
PDE4DIPRKKSSKQRPTHYROID245p.E243fsc.729_729delAFrame_Shift_Del417.598505CN100Y
PDE4DIPRKKSSKQRPTHYROID245p.E243fsc.729_729delAFrame_Shift_Del417.59CGTHW1N100Y
PDE4DIPRKKSSKQRPTHYROID245p.E243fsc.729_729delAFrame_Shift_Del417.59SW579N100Y
PDE4DIPRKKSSKQRPTHYROID245p.E243fsc.729_729delAFrame_Shift_Del417.59TT2609C02N100Y
PDE4DIPRPPTRFFKRTHYROID252p.E243fsc.729_729delAFrame_Shift_Del617.598505CY590Y
PDE4DIPRPPTRFFKRTHYROID252p.E243fsc.729_729delAFrame_Shift_Del617.59CGTHW1Y590Y
PDE4DIPRPPTRFFKRTHYROID252p.E243fsc.729_729delAFrame_Shift_Del617.59SW579Y590Y
PDE4DIPRPPTRFFKRTHYROID252p.E243fsc.729_729delAFrame_Shift_Del617.59TT2609C02Y590Y
PDE4DIPSDSHLADSRTHYROID237p.E243fsc.729_729delAFrame_Shift_Del317.598505CN000N
PDE4DIPSDSHLADSRTHYROID237p.E243fsc.729_729delAFrame_Shift_Del317.59CGTHW1N000N
PDE4DIPSDSHLADSRTHYROID237p.E243fsc.729_729delAFrame_Shift_Del317.59SW579N000N
PDE4DIPSDSHLADSRTHYROID237p.E243fsc.729_729delAFrame_Shift_Del317.59TT2609C02N000N
PDE4DIPSHLADSRKKTHYROID239p.E243fsc.729_729delAFrame_Shift_Del417.598505CN000N
PDE4DIPSHLADSRKKTHYROID239p.E243fsc.729_729delAFrame_Shift_Del417.59CGTHW1N000N
PDE4DIPSHLADSRKKTHYROID239p.E243fsc.729_729delAFrame_Shift_Del417.59SW579N000N
PDE4DIPSHLADSRKKTHYROID239p.E243fsc.729_729delAFrame_Shift_Del417.59TT2609C02N000N
PDE4DIPSKQRPPTRFTHYROID249p.E243fsc.729_729delAFrame_Shift_Del517.598505CN200Y
PDE4DIPSKQRPPTRFTHYROID249p.E243fsc.729_729delAFrame_Shift_Del517.59CGTHW1N200Y
PDE4DIPSKQRPPTRFTHYROID249p.E243fsc.729_729delAFrame_Shift_Del517.59SW579N200Y
PDE4DIPSKQRPPTRFTHYROID249p.E243fsc.729_729delAFrame_Shift_Del517.59TT2609C02N200Y
PDE4DIPSRKKSSKQRTHYROID244p.E243fsc.729_729delAFrame_Shift_Del417.598505CY390Y
PDE4DIPSRKKSSKQRTHYROID244p.E243fsc.729_729delAFrame_Shift_Del417.59CGTHW1Y390Y
PDE4DIPSRKKSSKQRTHYROID244p.E243fsc.729_729delAFrame_Shift_Del417.59SW579Y390Y
PDE4DIPSRKKSSKQRTHYROID244p.E243fsc.729_729delAFrame_Shift_Del417.59TT2609C02Y390Y
PDE4DIPSSKQRPPTRTHYROID248p.E243fsc.729_729delAFrame_Shift_Del517.598505CY390Y
PDE4DIPSSKQRPPTRTHYROID248p.E243fsc.729_729delAFrame_Shift_Del517.59CGTHW1Y390Y
PDE4DIPSSKQRPPTRTHYROID248p.E243fsc.729_729delAFrame_Shift_Del517.59SW579Y390Y
PDE4DIPSSKQRPPTRTHYROID248p.E243fsc.729_729delAFrame_Shift_Del517.59TT2609C02Y390Y
PDE4DIPSVSDSHLADTHYROID235p.E243fsc.729_729delAFrame_Shift_Del117.598505CN000N
PDE4DIPSVSDSHLADTHYROID235p.E243fsc.729_729delAFrame_Shift_Del117.59CGTHW1N000N
PDE4DIPSVSDSHLADTHYROID235p.E243fsc.729_729delAFrame_Shift_Del117.59SW579N000N
PDE4DIPSVSDSHLADTHYROID235p.E243fsc.729_729delAFrame_Shift_Del117.59TT2609C02N000N
PDE4DIPTRFFKRNLMTHYROID255p.E243fsc.729_729delAFrame_Shift_Del617.598505CY390Y
PDE4DIPTRFFKRNLMTHYROID255p.E243fsc.729_729delAFrame_Shift_Del617.59CGTHW1Y390Y
PDE4DIPTRFFKRNLMTHYROID255p.E243fsc.729_729delAFrame_Shift_Del617.59SW579Y390Y
PDE4DIPTRFFKRNLMTHYROID255p.E243fsc.729_729delAFrame_Shift_Del617.59TT2609C02Y390Y
PDE4DIPVSDSHLADSTHYROID236p.E243fsc.729_729delAFrame_Shift_Del217.598505CN100N
PDE4DIPVSDSHLADSTHYROID236p.E243fsc.729_729delAFrame_Shift_Del217.59CGTHW1N100N
PDE4DIPVSDSHLADSTHYROID236p.E243fsc.729_729delAFrame_Shift_Del217.59SW579N100N
PDE4DIPVSDSHLADSTHYROID236p.E243fsc.729_729delAFrame_Shift_Del217.59TT2609C02N100N
PDE4DIPDKAVLWSGLTHYROID483p.V486fsc.1458_1458delTFrame_Shift_Del518.58BCPAPN400N
PDE4DIPDKAVLWSGLTHYROID483p.V486fsc.1458_1458delTFrame_Shift_Del518.58CAL62N400N
PDE4DIPDKAVLWSGLTHYROID483p.V486fsc.1458_1458delTFrame_Shift_Del518.58FTC133N400N
PDE4DIPDKAVLWSGLTHYROID483p.V486fsc.1458_1458delTFrame_Shift_Del518.58FTC238N400N
PDE4DIPHDKAVLWSGTHYROID482p.V486fsc.1458_1458delTFrame_Shift_Del418.58BCPAPN000N
PDE4DIPHDKAVLWSGTHYROID482p.V486fsc.1458_1458delTFrame_Shift_Del418.58CAL62N000N
PDE4DIPHDKAVLWSGTHYROID482p.V486fsc.1458_1458delTFrame_Shift_Del418.58FTC133N000N
PDE4DIPHDKAVLWSGTHYROID482p.V486fsc.1458_1458delTFrame_Shift_Del418.58FTC238N000N
PDE4DIPIHDKAVLWSTHYROID481p.V486fsc.1458_1458delTFrame_Shift_Del318.58BCPAPN2020N
PDE4DIPIHDKAVLWSTHYROID481p.V486fsc.1458_1458delTFrame_Shift_Del318.58CAL62N2020N
PDE4DIPIHDKAVLWSTHYROID481p.V486fsc.1458_1458delTFrame_Shift_Del318.58FTC133N2020N
PDE4DIPIHDKAVLWSTHYROID481p.V486fsc.1458_1458delTFrame_Shift_Del318.58FTC238N2020N
PDE4DIPQRIHDKAVLTHYROID479p.V486fsc.1458_1458delTFrame_Shift_Del118.58BCPAPN600N
PDE4DIPQRIHDKAVLTHYROID479p.V486fsc.1458_1458delTFrame_Shift_Del118.58CAL62N600N
PDE4DIPQRIHDKAVLTHYROID479p.V486fsc.1458_1458delTFrame_Shift_Del118.58FTC133N600N
PDE4DIPQRIHDKAVLTHYROID479p.V486fsc.1458_1458delTFrame_Shift_Del118.58FTC238N600N
PDE4DIPRIHDKAVLWTHYROID480p.V486fsc.1458_1458delTFrame_Shift_Del218.58BCPAPN400N
PDE4DIPRIHDKAVLWTHYROID480p.V486fsc.1458_1458delTFrame_Shift_Del218.58CAL62N400N
PDE4DIPRIHDKAVLWTHYROID480p.V486fsc.1458_1458delTFrame_Shift_Del218.58FTC133N400N
PDE4DIPRIHDKAVLWTHYROID480p.V486fsc.1458_1458delTFrame_Shift_Del218.58FTC238N400N
PDE4DIPAAVRHQWSPTHYROID1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPN000N
PDE4DIPAAVRHQWSPTHYROID1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62N000N
PDE4DIPAAVRHQWSPTHYROID1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133N000N
PDE4DIPAAVRHQWSPTHYROID1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238N000N
PDE4DIPACQLPRIPPTHYROID1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPN000N
PDE4DIPACQLPRIPPTHYROID1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62N000N
PDE4DIPACQLPRIPPTHYROID1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133N000N
PDE4DIPACQLPRIPPTHYROID1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238N000N
PDE4DIPAFIFTPYPSTHYROID1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPAFIFTPYPSTHYROID1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPAFIFTPYPSTHYROID1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPAFIFTPYPSTHYROID1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPAFLRHHCPQTHYROID1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPAFLRHHCPQTHYROID1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPAFLRHHCPQTHYROID1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPAFLRHHCPQTHYROID1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPALFLLLPQLTHYROID1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPY16110N
PDE4DIPALFLLLPQLTHYROID1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62Y16110N
PDE4DIPALFLLLPQLTHYROID1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133Y16110N
PDE4DIPALFLLLPQLTHYROID1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238Y16110N
PDE4DIPALSSLAAVRTHYROID1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPY6100N
PDE4DIPALSSLAAVRTHYROID1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62Y6100N
PDE4DIPALSSLAAVRTHYROID1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133Y6100N
PDE4DIPALSSLAAVRTHYROID1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238Y6100N
PDE4DIPAPLALSSLATHYROID1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN1000N
PDE4DIPAPLALSSLATHYROID1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N1000N
PDE4DIPAPLALSSLATHYROID1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N1000N
PDE4DIPAPLALSSLATHYROID1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N1000N
PDE4DIPASCLSAPLATHYROID1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPN100N
PDE4DIPASCLSAPLATHYROID1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62N100N
PDE4DIPASCLSAPLATHYROID1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133N100N
PDE4DIPASCLSAPLATHYROID1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238N100N
PDE4DIPASRGLRPNPTHYROID1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000Y
PDE4DIPASRGLRPNPTHYROID1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000Y
PDE4DIPASRGLRPNPTHYROID1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000Y
PDE4DIPASRGLRPNPTHYROID1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000Y
PDE4DIPATPSACQLPTHYROID1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPATPSACQLPTHYROID1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPATPSACQLPTHYROID1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPATPSACQLPTHYROID1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPAVRHQWSPWTHYROID1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPN100N
PDE4DIPAVRHQWSPWTHYROID1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62N100N
PDE4DIPAVRHQWSPWTHYROID1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133N100N
PDE4DIPAVRHQWSPWTHYROID1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238N100N
PDE4DIPCCRSSWEKVTHYROID1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN100N
PDE4DIPCCRSSWEKVTHYROID1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N100N
PDE4DIPCCRSSWEKVTHYROID1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N100N
PDE4DIPCCRSSWEKVTHYROID1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N100N
PDE4DIPCLSAPLALSTHYROID1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPCLSAPLALSTHYROID1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPCLSAPLALSTHYROID1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPCLSAPLALSTHYROID1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPCPQLHPASCTHYROID1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN400N
PDE4DIPCPQLHPASCTHYROID1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N400N
PDE4DIPCPQLHPASCTHYROID1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N400N
PDE4DIPCPQLHPASCTHYROID1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N400N
PDE4DIPCQLPRIPPRTHYROID1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN600Y
PDE4DIPCQLPRIPPRTHYROID1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N600Y
PDE4DIPCQLPRIPPRTHYROID1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N600Y
PDE4DIPCQLPRIPPRTHYROID1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N600Y
PDE4DIPCRSSWEKVPTHYROID1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPCRSSWEKVPTHYROID1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPCRSSWEKVPTHYROID1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPCRSSWEKVPTHYROID1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPEKVPALFLLTHYROID1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPN800N
PDE4DIPEKVPALFLLTHYROID1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62N800N
PDE4DIPEKVPALFLLTHYROID1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133N800N
PDE4DIPEKVPALFLLTHYROID1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238N800N
PDE4DIPFIFTPYPSWTHYROID1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPN500N
PDE4DIPFIFTPYPSWTHYROID1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62N500N
PDE4DIPFIFTPYPSWTHYROID1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133N500N
PDE4DIPFIFTPYPSWTHYROID1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238N500N
PDE4DIPFLLLPQLHCTHYROID1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN7023N
PDE4DIPFLLLPQLHCTHYROID1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N7023N
PDE4DIPFLLLPQLHCTHYROID1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N7023N
PDE4DIPFLLLPQLHCTHYROID1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N7023N
PDE4DIPFLRHHCPQLTHYROID1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPY1399N
PDE4DIPFLRHHCPQLTHYROID1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62Y1399N
PDE4DIPFLRHHCPQLTHYROID1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133Y1399N
PDE4DIPFLRHHCPQLTHYROID1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238Y1399N
PDE4DIPFTPYPSWLATHYROID1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPN602N
PDE4DIPFTPYPSWLATHYROID1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62N602N
PDE4DIPFTPYPSWLATHYROID1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133N602N
PDE4DIPFTPYPSWLATHYROID1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238N602N
PDE4DIPGLRPNPTATTHYROID1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN200N
PDE4DIPGLRPNPTATTHYROID1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N200N
PDE4DIPGLRPNPTATTHYROID1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N200N
PDE4DIPGLRPNPTATTHYROID1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N200N
PDE4DIPHCPQLHPASTHYROID1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN100N
PDE4DIPHCPQLHPASTHYROID1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N100N
PDE4DIPHCPQLHPASTHYROID1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N100N
PDE4DIPHCPQLHPASTHYROID1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N100N
PDE4DIPHHCPQLHPATHYROID1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPN200N
PDE4DIPHHCPQLHPATHYROID1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62N200N
PDE4DIPHHCPQLHPATHYROID1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133N200N
PDE4DIPHHCPQLHPATHYROID1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238N200N
PDE4DIPHPASCLSAPTHYROID1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN100N
PDE4DIPHPASCLSAPTHYROID1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N100N
PDE4DIPHPASCLSAPTHYROID1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N100N
PDE4DIPHPASCLSAPTHYROID1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N100N
PDE4DIPHQWSPWLRLTHYROID1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPY14120Y
PDE4DIPHQWSPWLRLTHYROID1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62Y14120Y
PDE4DIPHQWSPWLRLTHYROID1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133Y14120Y
PDE4DIPHQWSPWLRLTHYROID1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238Y14120Y
PDE4DIPIFTPYPSWLTHYROID1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPN900N
PDE4DIPIFTPYPSWLTHYROID1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62N900N
PDE4DIPIFTPYPSWLTHYROID1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133N900N
PDE4DIPIFTPYPSWLTHYROID1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238N900N
PDE4DIPIPPRRPTRPTHYROID1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN100N
PDE4DIPIPPRRPTRPTHYROID1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N100N
PDE4DIPIPPRRPTRPTHYROID1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N100N
PDE4DIPIPPRRPTRPTHYROID1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N100N
PDE4DIPIQAFIFTPYTHYROID1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPN900N
PDE4DIPIQAFIFTPYTHYROID1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62N900N
PDE4DIPIQAFIFTPYTHYROID1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133N900N
PDE4DIPIQAFIFTPYTHYROID1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238N900N
PDE4DIPKPSSTSASRTHYROID1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35BCPAPY490N
PDE4DIPKPSSTSASRTHYROID1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35CAL62Y490N
PDE4DIPKPSSTSASRTHYROID1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35FTC133Y490N
PDE4DIPKPSSTSASRTHYROID1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35FTC238Y490N
PDE4DIPKVPALFLLLTHYROID1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPY1890N
PDE4DIPKVPALFLLLTHYROID1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62Y1890N
PDE4DIPKVPALFLLLTHYROID1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133Y1890N
PDE4DIPKVPALFLLLTHYROID1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238Y1890N
PDE4DIPLAAVRHQWSTHYROID1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN100N
PDE4DIPLAAVRHQWSTHYROID1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N100N
PDE4DIPLAAVRHQWSTHYROID1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N100N
PDE4DIPLAAVRHQWSTHYROID1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N100N
PDE4DIPLAFLRHHCPTHYROID1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPN000N
PDE4DIPLAFLRHHCPTHYROID1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62N000N
PDE4DIPLAFLRHHCPTHYROID1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133N000N
PDE4DIPLAFLRHHCPTHYROID1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238N000N
PDE4DIPLALSSLAAVTHYROID1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPN1000N
PDE4DIPLALSSLAAVTHYROID1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62N1000N
PDE4DIPLALSSLAAVTHYROID1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133N1000N
PDE4DIPLALSSLAAVTHYROID1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238N1000N
PDE4DIPLFLLLPQLHTHYROID1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN0032N
PDE4DIPLFLLLPQLHTHYROID1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N0032N
PDE4DIPLFLLLPQLHTHYROID1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N0032N
PDE4DIPLFLLLPQLHTHYROID1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N0032N
PDE4DIPLHPASCLSATHYROID1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPN307N
PDE4DIPLHPASCLSATHYROID1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62N307N
PDE4DIPLHPASCLSATHYROID1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133N307N
PDE4DIPLHPASCLSATHYROID1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238N307N
PDE4DIPLPRIPPRRPTHYROID1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN100N
PDE4DIPLPRIPPRRPTHYROID1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N100N
PDE4DIPLPRIPPRRPTHYROID1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N100N
PDE4DIPLPRIPPRRPTHYROID1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N100N
PDE4DIPLRHHCPQLHTHYROID1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN2020N
PDE4DIPLRHHCPQLHTHYROID1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N2020N
PDE4DIPLRHHCPQLHTHYROID1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N2020N
PDE4DIPLRHHCPQLHTHYROID1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N2020N
PDE4DIPLRLSRSYRCTHYROID1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPN3033N
PDE4DIPLRLSRSYRCTHYROID1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62N3033N
PDE4DIPLRLSRSYRCTHYROID1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133N3033N
PDE4DIPLRLSRSYRCTHYROID1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238N3033N
PDE4DIPLRPNPTATPTHYROID1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN1029N
PDE4DIPLRPNPTATPTHYROID1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N1029N
PDE4DIPLRPNPTATPTHYROID1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N1029N
PDE4DIPLRPNPTATPTHYROID1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N1029N
PDE4DIPLSAPLALSSTHYROID1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPN200N
PDE4DIPLSAPLALSSTHYROID1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62N200N
PDE4DIPLSAPLALSSTHYROID1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133N200N
PDE4DIPLSAPLALSSTHYROID1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238N200N
PDE4DIPLSRSYRCCRTHYROID1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN300N
PDE4DIPLSRSYRCCRTHYROID1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N300N
PDE4DIPLSRSYRCCRTHYROID1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N300N
PDE4DIPLSRSYRCCRTHYROID1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N300N
PDE4DIPLSSLAAVRHTHYROID1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPLSSLAAVRHTHYROID1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPLSSLAAVRHTHYROID1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPLSSLAAVRHTHYROID1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPNPTATPSACTHYROID1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPN400N
PDE4DIPNPTATPSACTHYROID1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62N400N
PDE4DIPNPTATPSACTHYROID1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133N400N
PDE4DIPNPTATPSACTHYROID1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238N400N
PDE4DIPPALFLLLPQTHYROID1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPPALFLLLPQTHYROID1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPPALFLLLPQTHYROID1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPPALFLLLPQTHYROID1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPPASCLSAPLTHYROID1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPN000N
PDE4DIPPASCLSAPLTHYROID1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62N000N
PDE4DIPPASCLSAPLTHYROID1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133N000N
PDE4DIPPASCLSAPLTHYROID1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238N000N
PDE4DIPPIQAFIFTPTHYROID1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPN000N
PDE4DIPPIQAFIFTPTHYROID1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62N000N
PDE4DIPPIQAFIFTPTHYROID1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133N000N
PDE4DIPPIQAFIFTPTHYROID1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238N000N
PDE4DIPPLALSSLAATHYROID1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPN100N
PDE4DIPPLALSSLAATHYROID1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62N100N
PDE4DIPPLALSSLAATHYROID1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133N100N
PDE4DIPPLALSSLAATHYROID1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238N100N
PDE4DIPPNPTATPSATHYROID1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPPNPTATPSATHYROID1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPPNPTATPSATHYROID1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPPNPTATPSATHYROID1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPPPRRPTRPITHYROID1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN900N
PDE4DIPPPRRPTRPITHYROID1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N900N
PDE4DIPPPRRPTRPITHYROID1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N900N
PDE4DIPPPRRPTRPITHYROID1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N900N
PDE4DIPPQLHPASCLTHYROID1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN200N
PDE4DIPPQLHPASCLTHYROID1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N200N
PDE4DIPPQLHPASCLTHYROID1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N200N
PDE4DIPPQLHPASCLTHYROID1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N200N
PDE4DIPPRIPPRRPTTHYROID1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPPRIPPRRPTTHYROID1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPPRIPPRRPTTHYROID1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPPRIPPRRPTTHYROID1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPPRRPTRPIQTHYROID1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPPRRPTRPIQTHYROID1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPPRRPTRPIQTHYROID1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPPRRPTRPIQTHYROID1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPPSACQLPRITHYROID1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPPSACQLPRITHYROID1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPPSACQLPRITHYROID1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPPSACQLPRITHYROID1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPPSSTSASRGTHYROID1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35BCPAPN000Y
PDE4DIPPSSTSASRGTHYROID1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35CAL62N000Y
PDE4DIPPSSTSASRGTHYROID1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35FTC133N000Y
PDE4DIPPSSTSASRGTHYROID1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35FTC238N000Y
PDE4DIPPSWLAFLRHTHYROID1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPPSWLAFLRHTHYROID1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPPSWLAFLRHTHYROID1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPPSWLAFLRHTHYROID1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPPTATPSACQTHYROID1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPPTATPSACQTHYROID1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPPTATPSACQTHYROID1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPPTATPSACQTHYROID1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPPTRPIQAFITHYROID1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPPTRPIQAFITHYROID1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPPTRPIQAFITHYROID1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPPTRPIQAFITHYROID1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPPWLRLSRSYTHYROID1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPN000N
PDE4DIPPWLRLSRSYTHYROID1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62N000N
PDE4DIPPWLRLSRSYTHYROID1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133N000N
PDE4DIPPWLRLSRSYTHYROID1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238N000N
PDE4DIPPYPSWLAFLTHYROID1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPY4100N
PDE4DIPPYPSWLAFLTHYROID1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62Y4100N
PDE4DIPPYPSWLAFLTHYROID1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133Y4100N
PDE4DIPPYPSWLAFLTHYROID1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238Y4100N
PDE4DIPQAFIFTPYPTHYROID1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPN000N
PDE4DIPQAFIFTPYPTHYROID1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62N000N
PDE4DIPQAFIFTPYPTHYROID1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133N000N
PDE4DIPQAFIFTPYPTHYROID1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238N000N
PDE4DIPQLHPASCLSTHYROID1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPQLHPASCLSTHYROID1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPQLHPASCLSTHYROID1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPQLHPASCLSTHYROID1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPQLPRIPPRRTHYROID1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN500Y
PDE4DIPQLPRIPPRRTHYROID1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N500Y
PDE4DIPQLPRIPPRRTHYROID1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N500Y
PDE4DIPQLPRIPPRRTHYROID1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N500Y
PDE4DIPQWSPWLRLSTHYROID1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPQWSPWLRLSTHYROID1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPQWSPWLRLSTHYROID1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPQWSPWLRLSTHYROID1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPRCCRSSWEKTHYROID1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPY4100N
PDE4DIPRCCRSSWEKTHYROID1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62Y4100N
PDE4DIPRCCRSSWEKTHYROID1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133Y4100N
PDE4DIPRCCRSSWEKTHYROID1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238Y4100N
PDE4DIPRGLRPNPTATHYROID1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPN400N
PDE4DIPRGLRPNPTATHYROID1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62N400N
PDE4DIPRGLRPNPTATHYROID1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133N400N
PDE4DIPRGLRPNPTATHYROID1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238N400N
PDE4DIPRHHCPQLHPTHYROID1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPN000N
PDE4DIPRHHCPQLHPTHYROID1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62N000N
PDE4DIPRHHCPQLHPTHYROID1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133N000N
PDE4DIPRHHCPQLHPTHYROID1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238N000N
PDE4DIPRHQWSPWLRTHYROID1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN100Y
PDE4DIPRHQWSPWLRTHYROID1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N100Y
PDE4DIPRHQWSPWLRTHYROID1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N100Y
PDE4DIPRHQWSPWLRTHYROID1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N100Y
PDE4DIPRIPPRRPTRTHYROID1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPY790N
PDE4DIPRIPPRRPTRTHYROID1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62Y790N
PDE4DIPRIPPRRPTRTHYROID1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133Y790N
PDE4DIPRIPPRRPTRTHYROID1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238Y790N
PDE4DIPRLSRSYRCCTHYROID1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPY290N
PDE4DIPRLSRSYRCCTHYROID1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62Y290N
PDE4DIPRLSRSYRCCTHYROID1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133Y290N
PDE4DIPRLSRSYRCCTHYROID1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238Y290N
PDE4DIPRPIQAFIFTTHYROID1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPN500N
PDE4DIPRPIQAFIFTTHYROID1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62N500N
PDE4DIPRPIQAFIFTTHYROID1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133N500N
PDE4DIPRPIQAFIFTTHYROID1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238N500N
PDE4DIPRPNPTATPSTHYROID1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN300N
PDE4DIPRPNPTATPSTHYROID1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N300N
PDE4DIPRPNPTATPSTHYROID1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N300N
PDE4DIPRPNPTATPSTHYROID1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N300N
PDE4DIPRPTRPIQAFTHYROID1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPY12100N
PDE4DIPRPTRPIQAFTHYROID1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62Y12100N
PDE4DIPRPTRPIQAFTHYROID1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133Y12100N
PDE4DIPRPTRPIQAFTHYROID1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238Y12100N
PDE4DIPRRPTRPIQATHYROID1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN500N
PDE4DIPRRPTRPIQATHYROID1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N500N
PDE4DIPRRPTRPIQATHYROID1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N500N
PDE4DIPRRPTRPIQATHYROID1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N500N
PDE4DIPRSSWEKVPATHYROID1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN200N
PDE4DIPRSSWEKVPATHYROID1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N200N
PDE4DIPRSSWEKVPATHYROID1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N200N
PDE4DIPRSSWEKVPATHYROID1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N200N
PDE4DIPRSYRCCRSSTHYROID1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN100N
PDE4DIPRSYRCCRSSTHYROID1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N100N
PDE4DIPRSYRCCRSSTHYROID1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N100N
PDE4DIPRSYRCCRSSTHYROID1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N100N
PDE4DIPSACQLPRIPTHYROID1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPSACQLPRIPTHYROID1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPSACQLPRIPTHYROID1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPSACQLPRIPTHYROID1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPSAPLALSSLTHYROID1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPY15100N
PDE4DIPSAPLALSSLTHYROID1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62Y15100N
PDE4DIPSAPLALSSLTHYROID1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133Y15100N
PDE4DIPSAPLALSSLTHYROID1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238Y15100N
PDE4DIPSASRGLRPNTHYROID1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN100Y
PDE4DIPSASRGLRPNTHYROID1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N100Y
PDE4DIPSASRGLRPNTHYROID1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N100Y
PDE4DIPSASRGLRPNTHYROID1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N100Y
PDE4DIPSCLSAPLALTHYROID1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN1000N
PDE4DIPSCLSAPLALTHYROID1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N1000N
PDE4DIPSCLSAPLALTHYROID1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N1000N
PDE4DIPSCLSAPLALTHYROID1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N1000N
PDE4DIPSLAAVRHQWTHYROID1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPN300N
PDE4DIPSLAAVRHQWTHYROID1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62N300N
PDE4DIPSLAAVRHQWTHYROID1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133N300N
PDE4DIPSLAAVRHQWTHYROID1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238N300N
PDE4DIPSPWLRLSRSTHYROID1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPN500Y
PDE4DIPSPWLRLSRSTHYROID1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62N500Y
PDE4DIPSPWLRLSRSTHYROID1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133N500Y
PDE4DIPSPWLRLSRSTHYROID1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238N500Y
PDE4DIPSRGLRPNPTTHYROID1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN300Y
PDE4DIPSRGLRPNPTTHYROID1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N300Y
PDE4DIPSRGLRPNPTTHYROID1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N300Y
PDE4DIPSRGLRPNPTTHYROID1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N300Y
PDE4DIPSRSYRCCRSTHYROID1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN300N
PDE4DIPSRSYRCCRSTHYROID1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N300N
PDE4DIPSRSYRCCRSTHYROID1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N300N
PDE4DIPSRSYRCCRSTHYROID1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N300N
PDE4DIPSSLAAVRHQTHYROID1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPN000Y
PDE4DIPSSLAAVRHQTHYROID1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62N000Y
PDE4DIPSSLAAVRHQTHYROID1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133N000Y
PDE4DIPSSLAAVRHQTHYROID1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238N000Y
PDE4DIPSSTSASRGLTHYROID1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35BCPAPN700N
PDE4DIPSSTSASRGLTHYROID1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35CAL62N700N
PDE4DIPSSTSASRGLTHYROID1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35FTC133N700N
PDE4DIPSSTSASRGLTHYROID1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35FTC238N700N
PDE4DIPSSWEKVPALTHYROID1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPY1990N
PDE4DIPSSWEKVPALTHYROID1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62Y1990N
PDE4DIPSSWEKVPALTHYROID1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133Y1990N
PDE4DIPSSWEKVPALTHYROID1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238Y1990N
PDE4DIPSTSASRGLRTHYROID1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35BCPAPN400N
PDE4DIPSTSASRGLRTHYROID1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35CAL62N400N
PDE4DIPSTSASRGLRTHYROID1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35FTC133N400N
PDE4DIPSTSASRGLRTHYROID1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35FTC238N400N
PDE4DIPSWEKVPALFTHYROID1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN300N
PDE4DIPSWEKVPALFTHYROID1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N300N
PDE4DIPSWEKVPALFTHYROID1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N300N
PDE4DIPSWEKVPALFTHYROID1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N300N
PDE4DIPSWLAFLRHHTHYROID1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN000N
PDE4DIPSWLAFLRHHTHYROID1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N000N
PDE4DIPSWLAFLRHHTHYROID1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N000N
PDE4DIPSWLAFLRHHTHYROID1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N000N
PDE4DIPSYRCCRSSWTHYROID1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPY2100N
PDE4DIPSYRCCRSSWTHYROID1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62Y2100N
PDE4DIPSYRCCRSSWTHYROID1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133Y2100N
PDE4DIPSYRCCRSSWTHYROID1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238Y2100N
PDE4DIPTATPSACQLTHYROID1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPN1100N
PDE4DIPTATPSACQLTHYROID1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62N1100N
PDE4DIPTATPSACQLTHYROID1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133N1100N
PDE4DIPTATPSACQLTHYROID1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238N1100N
PDE4DIPTPSACQLPRTHYROID1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN500N
PDE4DIPTPSACQLPRTHYROID1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N500N
PDE4DIPTPSACQLPRTHYROID1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N500N
PDE4DIPTPSACQLPRTHYROID1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N500N
PDE4DIPTPYPSWLAFTHYROID1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPY19100N
PDE4DIPTPYPSWLAFTHYROID1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62Y19100N
PDE4DIPTPYPSWLAFTHYROID1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133Y19100N
PDE4DIPTPYPSWLAFTHYROID1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238Y19100N
PDE4DIPTRPIQAFIFTHYROID1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN400N
PDE4DIPTRPIQAFIFTHYROID1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N400N
PDE4DIPTRPIQAFIFTHYROID1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N400N
PDE4DIPTRPIQAFIFTHYROID1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N400N
PDE4DIPTSASRGLRPTHYROID1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPN000N
PDE4DIPTSASRGLRPTHYROID1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62N000N
PDE4DIPTSASRGLRPTHYROID1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133N000N
PDE4DIPTSASRGLRPTHYROID1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238N000N
PDE4DIPVPALFLLLPTHYROID1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN200N
PDE4DIPVPALFLLLPTHYROID1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N200N
PDE4DIPVPALFLLLPTHYROID1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N200N
PDE4DIPVPALFLLLPTHYROID1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N200N
PDE4DIPVRHQWSPWLTHYROID1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPN905Y
PDE4DIPVRHQWSPWLTHYROID1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62N905Y
PDE4DIPVRHQWSPWLTHYROID1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133N905Y
PDE4DIPVRHQWSPWLTHYROID1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238N905Y
PDE4DIPWEKVPALFLTHYROID1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPY12125N
PDE4DIPWEKVPALFLTHYROID1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62Y12125N
PDE4DIPWEKVPALFLTHYROID1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133Y12125N
PDE4DIPWEKVPALFLTHYROID1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238Y12125N
PDE4DIPWLAFLRHHCTHYROID1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BCPAPY41017N
PDE4DIPWLAFLRHHCTHYROID1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL62Y41017N
PDE4DIPWLAFLRHHCTHYROID1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC133Y41017N
PDE4DIPWLAFLRHHCTHYROID1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35FTC238Y41017N
PDE4DIPWLRLSRSYRTHYROID1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPY71012N
PDE4DIPWLRLSRSYRTHYROID1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62Y71012N
PDE4DIPWLRLSRSYRTHYROID1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133Y71012N
PDE4DIPWLRLSRSYRTHYROID1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238Y71012N
PDE4DIPWSPWLRLSRTHYROID1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BCPAPN605Y
PDE4DIPWSPWLRLSRTHYROID1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL62N605Y
PDE4DIPWSPWLRLSRTHYROID1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC133N605Y
PDE4DIPWSPWLRLSRTHYROID1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35FTC238N605Y
PDE4DIPYPSWLAFLRTHYROID1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN702N
PDE4DIPYPSWLAFLRTHYROID1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N702N
PDE4DIPYPSWLAFLRTHYROID1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N702N
PDE4DIPYPSWLAFLRTHYROID1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N702N
PDE4DIPYRCCRSSWETHYROID1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BCPAPN305N
PDE4DIPYRCCRSSWETHYROID1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL62N305N
PDE4DIPYRCCRSSWETHYROID1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC133N305N
PDE4DIPYRCCRSSWETHYROID1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35FTC238N305N
PDE4DIPEIRTGTKHPTHYROID428p.Q432fsc.1294_1295delCAFrame_Shift_Del50.118305CN000N
PDE4DIPEKYNEIRTGTHYROID424p.Q432fsc.1294_1295delCAFrame_Shift_Del10.118305CN000N
PDE4DIPGTKHPAPKPTHYROID432p.Q432fsc.1294_1295delCAFrame_Shift_Del50.118305CN000N
PDE4DIPIRTGTKHPATHYROID429p.Q432fsc.1294_1295delCAFrame_Shift_Del60.118305CN4013N
PDE4DIPKYNEIRTGTTHYROID425p.Q432fsc.1294_1295delCAFrame_Shift_Del20.118305CN300N
PDE4DIPNEIRTGTKHTHYROID427p.Q432fsc.1294_1295delCAFrame_Shift_Del40.118305CN200N
PDE4DIPRTGTKHPAPTHYROID430p.Q432fsc.1294_1295delCAFrame_Shift_Del60.118305CN000N
PDE4DIPTGTKHPAPKTHYROID431p.Q432fsc.1294_1295delCAFrame_Shift_Del60.118305CN000N
PDE4DIPYNEIRTGTKTHYROID426p.Q432fsc.1294_1295delCAFrame_Shift_Del30.118305CN302N
PDE4DIPARPHSPPRGTHYROID1784p.Q1785Rc.5354A>GMissense_Mutation10.11FTC238N100N
PDE4DIPLNSARPHSPTHYROID1781p.Q1785Rc.5354A>GMissense_Mutation10.11FTC238N000N
PDE4DIPNSARPHSPPTHYROID1782p.Q1785Rc.5354A>GMissense_Mutation10.11FTC238N000Y
PDE4DIPRPHSPPRGTTHYROID1785p.Q1785Rc.5354A>GMissense_Mutation10.11FTC238N500N
PDE4DIPSARPHSPPRTHYROID1783p.Q1785Rc.5354A>GMissense_Mutation10.11FTC238N300N
PDE4DIPSSYYLNSARTHYROID1777p.Q1785Rc.5354A>GMissense_Mutation10.11FTC238N400N
PDE4DIPSYYLNSARPTHYROID1778p.Q1785Rc.5354A>GMissense_Mutation10.11FTC238N000N
PDE4DIPYLNSARPHSTHYROID1780p.Q1785Rc.5354A>GMissense_Mutation10.11FTC238N3018N
PDE4DIPYYLNSARPHTHYROID1779p.Q1785Rc.5354A>GMissense_Mutation10.11FTC238N2020N
PIK3C2GCSWGSIGKHTHYROID124p.P129delc.384_386delCCCIn_Frame_Del447.238305CN000N
PIK3C2GCSWGSIGKHTHYROID124p.P129delc.384_386delCCCIn_Frame_Del447.238505CN000N
PIK3C2GCSWGSIGKHTHYROID124p.P129delc.384_386delCCCIn_Frame_Del447.23BCPAPN000N
PIK3C2GCSWGSIGKHTHYROID124p.P129delc.384_386delCCCIn_Frame_Del447.23FTC238N000N
PIK3C2GCSWGSIGKHTHYROID124p.P129delc.384_386delCCCIn_Frame_Del447.23ML1N000N
PIK3C2GCSWGSIGKHTHYROID124p.P129delc.384_386delCCCIn_Frame_Del447.23TT2609C02N000N
PIK3C2GECSWGSIGKTHYROID123p.P129delc.384_386delCCCIn_Frame_Del347.238305CN100N
PIK3C2GECSWGSIGKTHYROID123p.P129delc.384_386delCCCIn_Frame_Del347.238505CN100N
PIK3C2GECSWGSIGKTHYROID123p.P129delc.384_386delCCCIn_Frame_Del347.23BCPAPN100N
PIK3C2GECSWGSIGKTHYROID123p.P129delc.384_386delCCCIn_Frame_Del347.23FTC238N100N
PIK3C2GECSWGSIGKTHYROID123p.P129delc.384_386delCCCIn_Frame_Del347.23ML1N100N
PIK3C2GECSWGSIGKTHYROID123p.P129delc.384_386delCCCIn_Frame_Del347.23TT2609C02N100N
PIK3C2GGSIGKHHGATHYROID127p.P129delc.384_386delCCCIn_Frame_Del247.238305CN300N
PIK3C2GGSIGKHHGATHYROID127p.P129delc.384_386delCCCIn_Frame_Del247.238505CN300N
PIK3C2GGSIGKHHGATHYROID127p.P129delc.384_386delCCCIn_Frame_Del247.23BCPAPN300N
PIK3C2GGSIGKHHGATHYROID127p.P129delc.384_386delCCCIn_Frame_Del247.23FTC238N300N
PIK3C2GGSIGKHHGATHYROID127p.P129delc.384_386delCCCIn_Frame_Del247.23ML1N300N
PIK3C2GGSIGKHHGATHYROID127p.P129delc.384_386delCCCIn_Frame_Del247.23TT2609C02N300N
PIK3C2GKECSWGSIGTHYROID122p.P129delc.384_386delCCCIn_Frame_Del247.238305CN000N
PIK3C2GKECSWGSIGTHYROID122p.P129delc.384_386delCCCIn_Frame_Del247.238505CN000N
PIK3C2GKECSWGSIGTHYROID122p.P129delc.384_386delCCCIn_Frame_Del247.23BCPAPN000N
PIK3C2GKECSWGSIGTHYROID122p.P129delc.384_386delCCCIn_Frame_Del247.23FTC238N000N
PIK3C2GKECSWGSIGTHYROID122p.P129delc.384_386delCCCIn_Frame_Del247.23ML1N000N
PIK3C2GKECSWGSIGTHYROID122p.P129delc.384_386delCCCIn_Frame_Del247.23TT2609C02N000N
PIK3C2GNKECSWGSITHYROID121p.P129delc.384_386delCCCIn_Frame_Del147.238305CN100N
PIK3C2GNKECSWGSITHYROID121p.P129delc.384_386delCCCIn_Frame_Del147.238505CN100N
PIK3C2GNKECSWGSITHYROID121p.P129delc.384_386delCCCIn_Frame_Del147.23BCPAPN100N
PIK3C2GNKECSWGSITHYROID121p.P129delc.384_386delCCCIn_Frame_Del147.23FTC238N100N
PIK3C2GNKECSWGSITHYROID121p.P129delc.384_386delCCCIn_Frame_Del147.23ML1N100N
PIK3C2GNKECSWGSITHYROID121p.P129delc.384_386delCCCIn_Frame_Del147.23TT2609C02N100N
PIK3C2GSIGKHHGADTHYROID128p.P129delc.384_386delCCCIn_Frame_Del147.238305CN000N
PIK3C2GSIGKHHGADTHYROID128p.P129delc.384_386delCCCIn_Frame_Del147.238505CN000N
PIK3C2GSIGKHHGADTHYROID128p.P129delc.384_386delCCCIn_Frame_Del147.23BCPAPN000N
PIK3C2GSIGKHHGADTHYROID128p.P129delc.384_386delCCCIn_Frame_Del147.23FTC238N000N
PIK3C2GSIGKHHGADTHYROID128p.P129delc.384_386delCCCIn_Frame_Del147.23ML1N000N
PIK3C2GSIGKHHGADTHYROID128p.P129delc.384_386delCCCIn_Frame_Del147.23TT2609C02N000N
PIK3C2GSWGSIGKHHTHYROID125p.P129delc.384_386delCCCIn_Frame_Del447.238305CN000N
PIK3C2GSWGSIGKHHTHYROID125p.P129delc.384_386delCCCIn_Frame_Del447.238505CN000N
PIK3C2GSWGSIGKHHTHYROID125p.P129delc.384_386delCCCIn_Frame_Del447.23BCPAPN000N
PIK3C2GSWGSIGKHHTHYROID125p.P129delc.384_386delCCCIn_Frame_Del447.23FTC238N000N
PIK3C2GSWGSIGKHHTHYROID125p.P129delc.384_386delCCCIn_Frame_Del447.23ML1N000N
PIK3C2GSWGSIGKHHTHYROID125p.P129delc.384_386delCCCIn_Frame_Del447.23TT2609C02N000N
PIK3C2GWGSIGKHHGTHYROID126p.P129delc.384_386delCCCIn_Frame_Del347.238305CN107Y
PIK3C2GWGSIGKHHGTHYROID126p.P129delc.384_386delCCCIn_Frame_Del347.238505CN107Y
PIK3C2GWGSIGKHHGTHYROID126p.P129delc.384_386delCCCIn_Frame_Del347.23BCPAPN107Y
PIK3C2GWGSIGKHHGTHYROID126p.P129delc.384_386delCCCIn_Frame_Del347.23FTC238N107Y
PIK3C2GWGSIGKHHGTHYROID126p.P129delc.384_386delCCCIn_Frame_Del347.23ML1N107Y
PIK3C2GWGSIGKHHGTHYROID126p.P129delc.384_386delCCCIn_Frame_Del347.23TT2609C02N107Y
PRKDCAGHAMLAGPTHYROID1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN000N
PRKDCAGHAMLAGPTHYROID1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN000N
PRKDCAGHAMLAGPTHYROID1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN000N
PRKDCAGHAMLAGPTHYROID1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N000N
PRKDCAGHAMLAGPTHYROID1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N000N
PRKDCAGHAMLAGPTHYROID1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N000N
PRKDCAGHAMLAGPTHYROID1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N000N
PRKDCAGHAMLAGPTHYROID1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N000N
PRKDCAGHAMLAGPTHYROID1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N000N
PRKDCAGHAMLAGPTHYROID1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N000N
PRKDCAGHAMLAGPTHYROID1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN000N
PRKDCAGPAPGRVGTHYROID1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN100N
PRKDCAGPAPGRVGTHYROID1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN100N
PRKDCAGPAPGRVGTHYROID1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN100N
PRKDCAGPAPGRVGTHYROID1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N100N
PRKDCAGPAPGRVGTHYROID1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N100N
PRKDCAGPAPGRVGTHYROID1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N100N
PRKDCAGPAPGRVGTHYROID1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N100N
PRKDCAGPAPGRVGTHYROID1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N100N
PRKDCAGPAPGRVGTHYROID1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N100N
PRKDCAGPAPGRVGTHYROID1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N100N
PRKDCAGPAPGRVGTHYROID1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN100N
PRKDCAIQPAGHAMTHYROID1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CY290N
PRKDCAIQPAGHAMTHYROID1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CY290N
PRKDCAIQPAGHAMTHYROID1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPY290N
PRKDCAIQPAGHAMTHYROID1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62Y290N
PRKDCAIQPAGHAMTHYROID1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1Y290N
PRKDCAIQPAGHAMTHYROID1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133Y290N
PRKDCAIQPAGHAMTHYROID1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238Y290N
PRKDCAIQPAGHAMTHYROID1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1Y290N
PRKDCAIQPAGHAMTHYROID1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579Y290N
PRKDCAIQPAGHAMTHYROID1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02Y290N
PRKDCAIQPAGHAMTHYROID1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTY290N
PRKDCAMLAGPAPGTHYROID1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN000N
PRKDCAMLAGPAPGTHYROID1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN000N
PRKDCAMLAGPAPGTHYROID1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN000N
PRKDCAMLAGPAPGTHYROID1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N000N
PRKDCAMLAGPAPGTHYROID1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N000N
PRKDCAMLAGPAPGTHYROID1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N000N
PRKDCAMLAGPAPGTHYROID1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N000N
PRKDCAMLAGPAPGTHYROID1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N000N
PRKDCAMLAGPAPGTHYROID1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N000N
PRKDCAMLAGPAPGTHYROID1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N000N
PRKDCAMLAGPAPGTHYROID1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN000N
PRKDCAPGRVGVLQTHYROID1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN000N
PRKDCAPGRVGVLQTHYROID1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN000N
PRKDCAPGRVGVLQTHYROID1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN000N
PRKDCAPGRVGVLQTHYROID1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N000N
PRKDCAPGRVGVLQTHYROID1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N000N
PRKDCAPGRVGVLQTHYROID1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N000N
PRKDCAPGRVGVLQTHYROID1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N000N
PRKDCAPGRVGVLQTHYROID1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N000N
PRKDCAPGRVGVLQTHYROID1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N000N
PRKDCAPGRVGVLQTHYROID1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N000N
PRKDCAPGRVGVLQTHYROID1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN000N
PRKDCAQPTLLYPSTHYROID1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.488305CN000Y
PRKDCAQPTLLYPSTHYROID1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.488505CN000Y
PRKDCAQPTLLYPSTHYROID1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48BCPAPN000Y
PRKDCAQPTLLYPSTHYROID1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48CAL62N000Y
PRKDCAQPTLLYPSTHYROID1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48CGTHW1N000Y
PRKDCAQPTLLYPSTHYROID1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48FTC133N000Y
PRKDCAQPTLLYPSTHYROID1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48FTC238N000Y
PRKDCAQPTLLYPSTHYROID1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48ML1N000Y
PRKDCAQPTLLYPSTHYROID1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SW579N000Y
PRKDCAQPTLLYPSTHYROID1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48TT2609C02N000Y
PRKDCAQPTLLYPSTHYROID1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48TTN000Y
PRKDCCRSAPGPRYTHYROID1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN300N
PRKDCCRSAPGPRYTHYROID1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN300N
PRKDCCRSAPGPRYTHYROID1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN300N
PRKDCCRSAPGPRYTHYROID1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N300N
PRKDCCRSAPGPRYTHYROID1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N300N
PRKDCCRSAPGPRYTHYROID1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N300N
PRKDCCRSAPGPRYTHYROID1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N300N
PRKDCCRSAPGPRYTHYROID1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N300N
PRKDCCRSAPGPRYTHYROID1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N300N
PRKDCCRSAPGPRYTHYROID1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N300N
PRKDCCRSAPGPRYTHYROID1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN300N
PRKDCENCRSAPGPTHYROID1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.488305CN000N
PRKDCENCRSAPGPTHYROID1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.488505CN000N
PRKDCENCRSAPGPTHYROID1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48BCPAPN000N
PRKDCENCRSAPGPTHYROID1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48CAL62N000N
PRKDCENCRSAPGPTHYROID1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48CGTHW1N000N
PRKDCENCRSAPGPTHYROID1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48FTC133N000N
PRKDCENCRSAPGPTHYROID1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48FTC238N000N
PRKDCENCRSAPGPTHYROID1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48ML1N000N
PRKDCENCRSAPGPTHYROID1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SW579N000N
PRKDCENCRSAPGPTHYROID1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TT2609C02N000N
PRKDCENCRSAPGPTHYROID1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TTN000N
PRKDCGAIQPAGHATHYROID1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN400N
PRKDCGAIQPAGHATHYROID1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN400N
PRKDCGAIQPAGHATHYROID1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN400N
PRKDCGAIQPAGHATHYROID1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N400N
PRKDCGAIQPAGHATHYROID1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N400N
PRKDCGAIQPAGHATHYROID1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N400N
PRKDCGAIQPAGHATHYROID1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N400N
PRKDCGAIQPAGHATHYROID1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N400N
PRKDCGAIQPAGHATHYROID1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N400N
PRKDCGAIQPAGHATHYROID1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N400N
PRKDCGAIQPAGHATHYROID1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN400N
PRKDCGHAMLAGPATHYROID1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN100N
PRKDCGHAMLAGPATHYROID1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN100N
PRKDCGHAMLAGPATHYROID1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN100N
PRKDCGHAMLAGPATHYROID1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N100N
PRKDCGHAMLAGPATHYROID1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N100N
PRKDCGHAMLAGPATHYROID1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N100N
PRKDCGHAMLAGPATHYROID1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N100N
PRKDCGHAMLAGPATHYROID1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N100N
PRKDCGHAMLAGPATHYROID1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N100N
PRKDCGHAMLAGPATHYROID1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N100N
PRKDCGHAMLAGPATHYROID1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN100N
PRKDCGPAPGRVGVTHYROID1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CY13150N
PRKDCGPAPGRVGVTHYROID1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CY13150N
PRKDCGPAPGRVGVTHYROID1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPY13150N
PRKDCGPAPGRVGVTHYROID1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62Y13150N
PRKDCGPAPGRVGVTHYROID1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1Y13150N
PRKDCGPAPGRVGVTHYROID1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133Y13150N
PRKDCGPAPGRVGVTHYROID1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238Y13150N
PRKDCGPAPGRVGVTHYROID1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1Y13150N
PRKDCGPAPGRVGVTHYROID1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579Y13150N
PRKDCGPAPGRVGVTHYROID1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02Y13150N
PRKDCGPAPGRVGVTHYROID1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTY13150N
PRKDCGRVGVLQHVTHYROID1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CY490N
PRKDCGRVGVLQHVTHYROID1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CY490N
PRKDCGRVGVLQHVTHYROID1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPY490N
PRKDCGRVGVLQHVTHYROID1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62Y490N
PRKDCGRVGVLQHVTHYROID1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1Y490N
PRKDCGRVGVLQHVTHYROID1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133Y490N
PRKDCGRVGVLQHVTHYROID1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238Y490N
PRKDCGRVGVLQHVTHYROID1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1Y490N
PRKDCGRVGVLQHVTHYROID1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579Y490N
PRKDCGRVGVLQHVTHYROID1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02Y490N
PRKDCGRVGVLQHVTHYROID1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTY490N
PRKDCGVLQHVHWRTHYROID1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CY690N
PRKDCGVLQHVHWRTHYROID1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CY690N
PRKDCGVLQHVHWRTHYROID1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPY690N
PRKDCGVLQHVHWRTHYROID1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62Y690N
PRKDCGVLQHVHWRTHYROID1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1Y690N
PRKDCGVLQHVHWRTHYROID1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133Y690N
PRKDCGVLQHVHWRTHYROID1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238Y690N
PRKDCGVLQHVHWRTHYROID1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1Y690N
PRKDCGVLQHVHWRTHYROID1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579Y690N
PRKDCGVLQHVHWRTHYROID1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02Y690N
PRKDCGVLQHVHWRTHYROID1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTY690N
PRKDCHAMLAGPAPTHYROID1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN000N
PRKDCHAMLAGPAPTHYROID1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN000N
PRKDCHAMLAGPAPTHYROID1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN000N
PRKDCHAMLAGPAPTHYROID1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N000N
PRKDCHAMLAGPAPTHYROID1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N000N
PRKDCHAMLAGPAPTHYROID1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N000N
PRKDCHAMLAGPAPTHYROID1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N000N
PRKDCHAMLAGPAPTHYROID1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N000N
PRKDCHAMLAGPAPTHYROID1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N000N
PRKDCHAMLAGPAPTHYROID1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N000N
PRKDCHAMLAGPAPTHYROID1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN000N
PRKDCHVHWRENCRTHYROID1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.488305CY690N
PRKDCHVHWRENCRTHYROID1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.488505CY690N
PRKDCHVHWRENCRTHYROID1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48BCPAPY690N
PRKDCHVHWRENCRTHYROID1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48CAL62Y690N
PRKDCHVHWRENCRTHYROID1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48CGTHW1Y690N
PRKDCHVHWRENCRTHYROID1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48FTC133Y690N
PRKDCHVHWRENCRTHYROID1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48FTC238Y690N
PRKDCHVHWRENCRTHYROID1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48ML1Y690N
PRKDCHVHWRENCRTHYROID1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SW579Y690N
PRKDCHVHWRENCRTHYROID1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48TT2609C02Y690N
PRKDCHVHWRENCRTHYROID1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48TTY690N
PRKDCHWRENCRSATHYROID1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.488305CN100N
PRKDCHWRENCRSATHYROID1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.488505CN100N
PRKDCHWRENCRSATHYROID1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48BCPAPN100N
PRKDCHWRENCRSATHYROID1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48CAL62N100N
PRKDCHWRENCRSATHYROID1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48CGTHW1N100N
PRKDCHWRENCRSATHYROID1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48FTC133N100N
PRKDCHWRENCRSATHYROID1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48FTC238N100N
PRKDCHWRENCRSATHYROID1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48ML1N100N
PRKDCHWRENCRSATHYROID1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SW579N100N
PRKDCHWRENCRSATHYROID1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48TT2609C02N100N
PRKDCHWRENCRSATHYROID1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48TTN100N
PRKDCIQPAGHAMLTHYROID1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN1400N
PRKDCIQPAGHAMLTHYROID1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN1400N
PRKDCIQPAGHAMLTHYROID1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN1400N
PRKDCIQPAGHAMLTHYROID1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N1400N
PRKDCIQPAGHAMLTHYROID1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N1400N
PRKDCIQPAGHAMLTHYROID1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N1400N
PRKDCIQPAGHAMLTHYROID1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N1400N
PRKDCIQPAGHAMLTHYROID1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N1400N
PRKDCIQPAGHAMLTHYROID1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N1400N
PRKDCIQPAGHAMLTHYROID1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N1400N
PRKDCIQPAGHAMLTHYROID1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN1400N
PRKDCLAGPAPGRVTHYROID1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.488305CN500N
PRKDCLAGPAPGRVTHYROID1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.488505CN500N
PRKDCLAGPAPGRVTHYROID1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48BCPAPN500N
PRKDCLAGPAPGRVTHYROID1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48CAL62N500N
PRKDCLAGPAPGRVTHYROID1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48CGTHW1N500N
PRKDCLAGPAPGRVTHYROID1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48FTC133N500N
PRKDCLAGPAPGRVTHYROID1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48FTC238N500N
PRKDCLAGPAPGRVTHYROID1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48ML1N500N
PRKDCLAGPAPGRVTHYROID1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SW579N500N
PRKDCLAGPAPGRVTHYROID1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TT2609C02N500N
PRKDCLAGPAPGRVTHYROID1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TTN500N
PRKDCLAQPTLLYPTHYROID1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.488305CN000N
PRKDCLAQPTLLYPTHYROID1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.488505CN000N
PRKDCLAQPTLLYPTHYROID1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48BCPAPN000N
PRKDCLAQPTLLYPTHYROID1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48CAL62N000N
PRKDCLAQPTLLYPTHYROID1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48CGTHW1N000N
PRKDCLAQPTLLYPTHYROID1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48FTC133N000N
PRKDCLAQPTLLYPTHYROID1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48FTC238N000N
PRKDCLAQPTLLYPTHYROID1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48ML1N000N
PRKDCLAQPTLLYPTHYROID1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SW579N000N
PRKDCLAQPTLLYPTHYROID1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48TT2609C02N000N
PRKDCLAQPTLLYPTHYROID1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48TTN000N
PRKDCLLYPSGAIQTHYROID1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN100N
PRKDCLLYPSGAIQTHYROID1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN100N
PRKDCLLYPSGAIQTHYROID1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN100N
PRKDCLLYPSGAIQTHYROID1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N100N
PRKDCLLYPSGAIQTHYROID1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N100N
PRKDCLLYPSGAIQTHYROID1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N100N
PRKDCLLYPSGAIQTHYROID1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N100N
PRKDCLLYPSGAIQTHYROID1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N100N
PRKDCLLYPSGAIQTHYROID1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N100N
PRKDCLLYPSGAIQTHYROID1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N100N
PRKDCLLYPSGAIQTHYROID1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN100N
PRKDCLQHVHWRENTHYROID1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN000N
PRKDCLQHVHWRENTHYROID1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN000N
PRKDCLQHVHWRENTHYROID1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN000N
PRKDCLQHVHWRENTHYROID1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N000N
PRKDCLQHVHWRENTHYROID1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N000N
PRKDCLQHVHWRENTHYROID1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N000N
PRKDCLQHVHWRENTHYROID1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N000N
PRKDCLQHVHWRENTHYROID1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N000N
PRKDCLQHVHWRENTHYROID1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N000N
PRKDCLQHVHWRENTHYROID1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N000N
PRKDCLQHVHWRENTHYROID1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN000N
PRKDCLYPSGAIQPTHYROID1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN000N
PRKDCLYPSGAIQPTHYROID1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN000N
PRKDCLYPSGAIQPTHYROID1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN000N
PRKDCLYPSGAIQPTHYROID1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N000N
PRKDCLYPSGAIQPTHYROID1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N000N
PRKDCLYPSGAIQPTHYROID1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N000N
PRKDCLYPSGAIQPTHYROID1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N000N
PRKDCLYPSGAIQPTHYROID1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N000N
PRKDCLYPSGAIQPTHYROID1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N000N
PRKDCLYPSGAIQPTHYROID1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N000N
PRKDCLYPSGAIQPTHYROID1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN000N
PRKDCMLAGPAPGRTHYROID1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN500N
PRKDCMLAGPAPGRTHYROID1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN500N
PRKDCMLAGPAPGRTHYROID1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN500N
PRKDCMLAGPAPGRTHYROID1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N500N
PRKDCMLAGPAPGRTHYROID1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N500N
PRKDCMLAGPAPGRTHYROID1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N500N
PRKDCMLAGPAPGRTHYROID1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N500N
PRKDCMLAGPAPGRTHYROID1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N500N
PRKDCMLAGPAPGRTHYROID1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N500N
PRKDCMLAGPAPGRTHYROID1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N500N
PRKDCMLAGPAPGRTHYROID1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN500N
PRKDCNCRSAPGPRTHYROID1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN300N
PRKDCNCRSAPGPRTHYROID1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN300N
PRKDCNCRSAPGPRTHYROID1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN300N
PRKDCNCRSAPGPRTHYROID1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N300N
PRKDCNCRSAPGPRTHYROID1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N300N
PRKDCNCRSAPGPRTHYROID1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N300N
PRKDCNCRSAPGPRTHYROID1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N300N
PRKDCNCRSAPGPRTHYROID1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N300N
PRKDCNCRSAPGPRTHYROID1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N300N
PRKDCNCRSAPGPRTHYROID1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N300N
PRKDCNCRSAPGPRTHYROID1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN300N
PRKDCPAGHAMLAGTHYROID1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN000N
PRKDCPAGHAMLAGTHYROID1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN000N
PRKDCPAGHAMLAGTHYROID1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN000N
PRKDCPAGHAMLAGTHYROID1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N000N
PRKDCPAGHAMLAGTHYROID1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N000N
PRKDCPAGHAMLAGTHYROID1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N000N
PRKDCPAGHAMLAGTHYROID1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N000N
PRKDCPAGHAMLAGTHYROID1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N000N
PRKDCPAGHAMLAGTHYROID1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N000N
PRKDCPAGHAMLAGTHYROID1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N000N
PRKDCPAGHAMLAGTHYROID1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN000N
PRKDCPAPGRVGVLTHYROID1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN400N
PRKDCPAPGRVGVLTHYROID1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN400N
PRKDCPAPGRVGVLTHYROID1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN400N
PRKDCPAPGRVGVLTHYROID1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N400N
PRKDCPAPGRVGVLTHYROID1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N400N
PRKDCPAPGRVGVLTHYROID1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N400N
PRKDCPAPGRVGVLTHYROID1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N400N
PRKDCPAPGRVGVLTHYROID1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N400N
PRKDCPAPGRVGVLTHYROID1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N400N
PRKDCPAPGRVGVLTHYROID1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N400N
PRKDCPAPGRVGVLTHYROID1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN400N
PRKDCPGRVGVLQHTHYROID1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN000N
PRKDCPGRVGVLQHTHYROID1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN000N
PRKDCPGRVGVLQHTHYROID1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN000N
PRKDCPGRVGVLQHTHYROID1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N000N
PRKDCPGRVGVLQHTHYROID1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N000N
PRKDCPGRVGVLQHTHYROID1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N000N
PRKDCPGRVGVLQHTHYROID1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N000N
PRKDCPGRVGVLQHTHYROID1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N000N
PRKDCPGRVGVLQHTHYROID1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N000N
PRKDCPGRVGVLQHTHYROID1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N000N
PRKDCPGRVGVLQHTHYROID1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN000N
PRKDCPSGAIQPAGTHYROID1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN000N
PRKDCPSGAIQPAGTHYROID1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN000N
PRKDCPSGAIQPAGTHYROID1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN000N
PRKDCPSGAIQPAGTHYROID1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N000N
PRKDCPSGAIQPAGTHYROID1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N000N
PRKDCPSGAIQPAGTHYROID1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N000N
PRKDCPSGAIQPAGTHYROID1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N000N
PRKDCPSGAIQPAGTHYROID1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N000N
PRKDCPSGAIQPAGTHYROID1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N000N
PRKDCPSGAIQPAGTHYROID1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N000N
PRKDCPSGAIQPAGTHYROID1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN000N
PRKDCPTLLYPSGATHYROID1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.488305CN100N
PRKDCPTLLYPSGATHYROID1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.488505CN100N
PRKDCPTLLYPSGATHYROID1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48BCPAPN100N
PRKDCPTLLYPSGATHYROID1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48CAL62N100N
PRKDCPTLLYPSGATHYROID1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48CGTHW1N100N
PRKDCPTLLYPSGATHYROID1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48FTC133N100N
PRKDCPTLLYPSGATHYROID1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48FTC238N100N
PRKDCPTLLYPSGATHYROID1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48ML1N100N
PRKDCPTLLYPSGATHYROID1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48SW579N100N
PRKDCPTLLYPSGATHYROID1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48TT2609C02N100N
PRKDCPTLLYPSGATHYROID1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48TTN100N
PRKDCQHVHWRENCTHYROID1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN100N
PRKDCQHVHWRENCTHYROID1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN100N
PRKDCQHVHWRENCTHYROID1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN100N
PRKDCQHVHWRENCTHYROID1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N100N
PRKDCQHVHWRENCTHYROID1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N100N
PRKDCQHVHWRENCTHYROID1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N100N
PRKDCQHVHWRENCTHYROID1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N100N
PRKDCQHVHWRENCTHYROID1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N100N
PRKDCQHVHWRENCTHYROID1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N100N
PRKDCQHVHWRENCTHYROID1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N100N
PRKDCQHVHWRENCTHYROID1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN100N
PRKDCQPAGHAMLATHYROID1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN800N
PRKDCQPAGHAMLATHYROID1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN800N
PRKDCQPAGHAMLATHYROID1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN800N
PRKDCQPAGHAMLATHYROID1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N800N
PRKDCQPAGHAMLATHYROID1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N800N
PRKDCQPAGHAMLATHYROID1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N800N
PRKDCQPAGHAMLATHYROID1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N800N
PRKDCQPAGHAMLATHYROID1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N800N
PRKDCQPAGHAMLATHYROID1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N800N
PRKDCQPAGHAMLATHYROID1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N800N
PRKDCQPAGHAMLATHYROID1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN800N
PRKDCQPTLLYPSGTHYROID1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.488305CN000N
PRKDCQPTLLYPSGTHYROID1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.488505CN000N
PRKDCQPTLLYPSGTHYROID1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48BCPAPN000N
PRKDCQPTLLYPSGTHYROID1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48CAL62N000N
PRKDCQPTLLYPSGTHYROID1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48CGTHW1N000N
PRKDCQPTLLYPSGTHYROID1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48FTC133N000N
PRKDCQPTLLYPSGTHYROID1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48FTC238N000N
PRKDCQPTLLYPSGTHYROID1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48ML1N000N
PRKDCQPTLLYPSGTHYROID1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SW579N000N
PRKDCQPTLLYPSGTHYROID1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48TT2609C02N000N
PRKDCQPTLLYPSGTHYROID1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48TTN000N
PRKDCRENCRSAPGTHYROID1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.488305CN100N
PRKDCRENCRSAPGTHYROID1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.488505CN100N
PRKDCRENCRSAPGTHYROID1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48BCPAPN100N
PRKDCRENCRSAPGTHYROID1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48CAL62N100N
PRKDCRENCRSAPGTHYROID1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48CGTHW1N100N
PRKDCRENCRSAPGTHYROID1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48FTC133N100N
PRKDCRENCRSAPGTHYROID1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48FTC238N100N
PRKDCRENCRSAPGTHYROID1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48ML1N100N
PRKDCRENCRSAPGTHYROID1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SW579N100N
PRKDCRENCRSAPGTHYROID1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TT2609C02N100N
PRKDCRENCRSAPGTHYROID1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TTN100N
PRKDCRVGVLQHVHTHYROID1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN100N
PRKDCRVGVLQHVHTHYROID1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN100N
PRKDCRVGVLQHVHTHYROID1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN100N
PRKDCRVGVLQHVHTHYROID1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N100N
PRKDCRVGVLQHVHTHYROID1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N100N
PRKDCRVGVLQHVHTHYROID1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N100N
PRKDCRVGVLQHVHTHYROID1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N100N
PRKDCRVGVLQHVHTHYROID1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N100N
PRKDCRVGVLQHVHTHYROID1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N100N
PRKDCRVGVLQHVHTHYROID1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N100N
PRKDCRVGVLQHVHTHYROID1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN100N
PRKDCSGAIQPAGHTHYROID1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN000N
PRKDCSGAIQPAGHTHYROID1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN000N
PRKDCSGAIQPAGHTHYROID1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN000N
PRKDCSGAIQPAGHTHYROID1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N000N
PRKDCSGAIQPAGHTHYROID1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N000N
PRKDCSGAIQPAGHTHYROID1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N000N
PRKDCSGAIQPAGHTHYROID1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N000N
PRKDCSGAIQPAGHTHYROID1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N000N
PRKDCSGAIQPAGHTHYROID1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N000N
PRKDCSGAIQPAGHTHYROID1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N000N
PRKDCSGAIQPAGHTHYROID1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN000N
PRKDCTLLYPSGAITHYROID1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.488305CN1000N
PRKDCTLLYPSGAITHYROID1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.488505CN1000N
PRKDCTLLYPSGAITHYROID1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48BCPAPN1000N
PRKDCTLLYPSGAITHYROID1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48CAL62N1000N
PRKDCTLLYPSGAITHYROID1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48CGTHW1N1000N
PRKDCTLLYPSGAITHYROID1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48FTC133N1000N
PRKDCTLLYPSGAITHYROID1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48FTC238N1000N
PRKDCTLLYPSGAITHYROID1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48ML1N1000N
PRKDCTLLYPSGAITHYROID1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SW579N1000N
PRKDCTLLYPSGAITHYROID1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TT2609C02N1000N
PRKDCTLLYPSGAITHYROID1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TTN1000N
PRKDCVGVLQHVHWTHYROID1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN400N
PRKDCVGVLQHVHWTHYROID1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN400N
PRKDCVGVLQHVHWTHYROID1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN400N
PRKDCVGVLQHVHWTHYROID1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N400N
PRKDCVGVLQHVHWTHYROID1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N400N
PRKDCVGVLQHVHWTHYROID1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N400N
PRKDCVGVLQHVHWTHYROID1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N400N
PRKDCVGVLQHVHWTHYROID1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N400N
PRKDCVGVLQHVHWTHYROID1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N400N
PRKDCVGVLQHVHWTHYROID1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N400N
PRKDCVGVLQHVHWTHYROID1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN400N
PRKDCVHWRENCRSTHYROID1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN106N
PRKDCVHWRENCRSTHYROID1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN106N
PRKDCVHWRENCRSTHYROID1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN106N
PRKDCVHWRENCRSTHYROID1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N106N
PRKDCVHWRENCRSTHYROID1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N106N
PRKDCVHWRENCRSTHYROID1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N106N
PRKDCVHWRENCRSTHYROID1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N106N
PRKDCVHWRENCRSTHYROID1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N106N
PRKDCVHWRENCRSTHYROID1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N106N
PRKDCVHWRENCRSTHYROID1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N106N
PRKDCVHWRENCRSTHYROID1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN106N
PRKDCVLQHVHWRETHYROID1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN001N
PRKDCVLQHVHWRETHYROID1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN001N
PRKDCVLQHVHWRETHYROID1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN001N
PRKDCVLQHVHWRETHYROID1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N001N
PRKDCVLQHVHWRETHYROID1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N001N
PRKDCVLQHVHWRETHYROID1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N001N
PRKDCVLQHVHWRETHYROID1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N001N
PRKDCVLQHVHWRETHYROID1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N001N
PRKDCVLQHVHWRETHYROID1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N001N
PRKDCVLQHVHWRETHYROID1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N001N
PRKDCVLQHVHWRETHYROID1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN001N
PRKDCWRENCRSAPTHYROID1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CN300N
PRKDCWRENCRSAPTHYROID1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CN300N
PRKDCWRENCRSAPTHYROID1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPN300N
PRKDCWRENCRSAPTHYROID1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62N300N
PRKDCWRENCRSAPTHYROID1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1N300N
PRKDCWRENCRSAPTHYROID1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133N300N
PRKDCWRENCRSAPTHYROID1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238N300N
PRKDCWRENCRSAPTHYROID1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1N300N
PRKDCWRENCRSAPTHYROID1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579N300N
PRKDCWRENCRSAPTHYROID1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02N300N
PRKDCWRENCRSAPTHYROID1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN300N
PRKDCYPSGAIQPATHYROID1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488305CY990N
PRKDCYPSGAIQPATHYROID1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.488505CY990N
PRKDCYPSGAIQPATHYROID1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48BCPAPY990N
PRKDCYPSGAIQPATHYROID1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL62Y990N
PRKDCYPSGAIQPATHYROID1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CGTHW1Y990N
PRKDCYPSGAIQPATHYROID1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC133Y990N
PRKDCYPSGAIQPATHYROID1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48FTC238Y990N
PRKDCYPSGAIQPATHYROID1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ML1Y990N
PRKDCYPSGAIQPATHYROID1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW579Y990N
PRKDCYPSGAIQPATHYROID1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TT2609C02Y990N
PRKDCYPSGAIQPATHYROID1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTY990N
PRKDCAVLNSMLDQTHYROID1595p.G1599Sc.4795G>AMissense_Mutation10.11CAL62N000N
PRKDCDQAPGVWMITHYROID595p.E596Qc.1786G>CMissense_Mutation10.11TT2609C02Y7160N
PRKDCENGDQAPGVTHYROID592p.E596Qc.1786G>CMissense_Mutation10.11TT2609C02N000Y
PRKDCEQENGDQAPTHYROID590p.E596Qc.1786G>CMissense_Mutation10.11TT2609C02N000Y
PRKDCGDQAPGVWMTHYROID594p.E596Qc.1786G>CMissense_Mutation10.11TT2609C02N500N
PRKDCGEQENGDQATHYROID589p.E596Qc.1786G>CMissense_Mutation10.11TT2609C02N600N
PRKDCKMVSAVLNSTHYROID1591p.G1599Sc.4795G>AMissense_Mutation10.11CAL62N100N
PRKDCLNSMLDQSFTHYROID1597p.G1599Sc.4795G>AMissense_Mutation10.11CAL62N300N
PRKDCMVSAVLNSMTHYROID1592p.G1599Sc.4795G>AMissense_Mutation10.11CAL62Y61018N
PRKDCNGDQAPGVWTHYROID593p.E596Qc.1786G>CMissense_Mutation10.11TT2609C02N300Y
PRKDCNSMLDQSFRTHYROID1598p.G1599Sc.4795G>AMissense_Mutation10.11CAL62N300N
PRKDCQAPGVWMIPTHYROID596p.E596Qc.1786G>CMissense_Mutation10.11TT2609C02N000N
PRKDCQENGDQAPGTHYROID591p.E596Qc.1786G>CMissense_Mutation10.11TT2609C02N000Y
PRKDCSAVLNSMLDTHYROID1594p.G1599Sc.4795G>AMissense_Mutation10.11CAL62N200N
PRKDCSMLDQSFRETHYROID1599p.G1599Sc.4795G>AMissense_Mutation10.11CAL62N000Y
PRKDCVGEQENGDQTHYROID588p.E596Qc.1786G>CMissense_Mutation10.11TT2609C02N000N
PRKDCVLNSMLDQSTHYROID1596p.G1599Sc.4795G>AMissense_Mutation10.11CAL62N005N
PRKDCVSAVLNSMLTHYROID1593p.G1599Sc.4795G>AMissense_Mutation10.11CAL62N1100N
RB1DLSFPWNVLTHYROID511p.IL517delc.1548_1553delGATTCTIn_Frame_Del30.11FTC133Y5110N
RB1FPWNVLNLKTHYROID514p.IL517delc.1548_1553delGATTCTIn_Frame_Del30.11FTC133N700Y
RB1GTDLSFPWNTHYROID509p.IL517delc.1548_1553delGATTCTIn_Frame_Del10.11FTC133N100N
RB1LSFPWNVLNTHYROID512p.IL517delc.1548_1553delGATTCTIn_Frame_Del40.11FTC133N000N
RB1PWNVLNLKATHYROID515p.IL517delc.1548_1553delGATTCTIn_Frame_Del20.11FTC133N000N
RB1SFPWNVLNLTHYROID513p.IL517delc.1548_1553delGATTCTIn_Frame_Del40.11FTC133Y10130N
RB1TDLSFPWNVTHYROID510p.IL517delc.1548_1553delGATTCTIn_Frame_Del20.11FTC133Y7100N
RB1WNVLNLKAFTHYROID516p.IL517delc.1548_1553delGATTCTIn_Frame_Del10.11FTC133Y6149N
RECQL4ADMCTPTARTHYROID829p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4ADMCTPTARTHYROID829p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4ADMCTPTARTHYROID829p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4ADMCTPTARTHYROID829p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4ADMCTPTARTHYROID829p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4ADMCTPTARTHYROID829p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4ADMCTPTARTHYROID829p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4ADMCTPTARTHYROID829p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4ADMCTPTARTHYROID829p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4AFMQGQLGWTHYROID759p.R766fsc.2296_2296delCFrame_Shift_Del274.348305CN200N
RECQL4AFMQGQLGWTHYROID759p.R766fsc.2296_2296delCFrame_Shift_Del274.348505CN200N
RECQL4AFMQGQLGWTHYROID759p.R766fsc.2296_2296delCFrame_Shift_Del274.34CAL62N200N
RECQL4AFMQGQLGWTHYROID759p.R766fsc.2296_2296delCFrame_Shift_Del274.34CGTHW1N200N
RECQL4AFMQGQLGWTHYROID759p.R766fsc.2296_2296delCFrame_Shift_Del274.34FTC133N200N
RECQL4AFMQGQLGWTHYROID759p.R766fsc.2296_2296delCFrame_Shift_Del274.34FTC238N200N
RECQL4AFMQGQLGWTHYROID759p.R766fsc.2296_2296delCFrame_Shift_Del274.34ML1N200N
RECQL4AFMQGQLGWTHYROID759p.R766fsc.2296_2296delCFrame_Shift_Del274.34SW579N200N
RECQL4AFMQGQLGWTHYROID759p.R766fsc.2296_2296delCFrame_Shift_Del274.34TTN200N
RECQL4AGPGVTGSLTHYROID803p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN1200N
RECQL4AGPGVTGSLTHYROID803p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN1200N
RECQL4AGPGVTGSLTHYROID803p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N1200N
RECQL4AGPGVTGSLTHYROID803p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N1200N
RECQL4AGPGVTGSLTHYROID803p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N1200N
RECQL4AGPGVTGSLTHYROID803p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N1200N
RECQL4AGPGVTGSLTHYROID803p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N1200N
RECQL4AGPGVTGSLTHYROID803p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N1200N
RECQL4AGPGVTGSLTHYROID803p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN1200N
RECQL4AKTCESCADTHYROID822p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4AKTCESCADTHYROID822p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4AKTCESCADTHYROID822p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4AKTCESCADTHYROID822p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4AKTCESCADTHYROID822p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4AKTCESCADTHYROID822p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4AKTCESCADTHYROID822p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4AKTCESCADTHYROID822p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4AKTCESCADTHYROID822p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4ASRATCRPWTHYROID794p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CY3110N
RECQL4ASRATCRPWTHYROID794p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CY3110N
RECQL4ASRATCRPWTHYROID794p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62Y3110N
RECQL4ASRATCRPWTHYROID794p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1Y3110N
RECQL4ASRATCRPWTHYROID794p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133Y3110N
RECQL4ASRATCRPWTHYROID794p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238Y3110N
RECQL4ASRATCRPWTHYROID794p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1Y3110N
RECQL4ASRATCRPWTHYROID794p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579Y3110N
RECQL4ASRATCRPWTHYROID794p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTY3110N
RECQL4ATCRPWAGPTHYROID797p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4ATCRPWAGPTHYROID797p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4ATCRPWAGPTHYROID797p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4ATCRPWAGPTHYROID797p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4ATCRPWAGPTHYROID797p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4ATCRPWAGPTHYROID797p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4ATCRPWAGPTHYROID797p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4ATCRPWAGPTHYROID797p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4ATCRPWAGPTHYROID797p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4ATSSCSPRATHYROID814p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN100Y
RECQL4ATSSCSPRATHYROID814p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN100Y
RECQL4ATSSCSPRATHYROID814p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N100Y
RECQL4ATSSCSPRATHYROID814p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N100Y
RECQL4ATSSCSPRATHYROID814p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N100Y
RECQL4ATSSCSPRATHYROID814p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N100Y
RECQL4ATSSCSPRATHYROID814p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N100Y
RECQL4ATSSCSPRATHYROID814p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N100Y
RECQL4ATSSCSPRATHYROID814p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN100Y
RECQL4CADMCTPTATHYROID828p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN300N
RECQL4CADMCTPTATHYROID828p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN300N
RECQL4CADMCTPTATHYROID828p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N300N
RECQL4CADMCTPTATHYROID828p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N300N
RECQL4CADMCTPTATHYROID828p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N300N
RECQL4CADMCTPTATHYROID828p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N300N
RECQL4CADMCTPTATHYROID828p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N300N
RECQL4CADMCTPTATHYROID828p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N300N
RECQL4CADMCTPTATHYROID828p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN300N
RECQL4CCIWGCPQATHYROID786p.R766fsc.2296_2296delCFrame_Shift_Del674.348305CN100N
RECQL4CCIWGCPQATHYROID786p.R766fsc.2296_2296delCFrame_Shift_Del674.348505CN100N
RECQL4CCIWGCPQATHYROID786p.R766fsc.2296_2296delCFrame_Shift_Del674.34CAL62N100N
RECQL4CCIWGCPQATHYROID786p.R766fsc.2296_2296delCFrame_Shift_Del674.34CGTHW1N100N
RECQL4CCIWGCPQATHYROID786p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC133N100N
RECQL4CCIWGCPQATHYROID786p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC238N100N
RECQL4CCIWGCPQATHYROID786p.R766fsc.2296_2296delCFrame_Shift_Del674.34ML1N100N
RECQL4CCIWGCPQATHYROID786p.R766fsc.2296_2296delCFrame_Shift_Del674.34SW579N100N
RECQL4CCIWGCPQATHYROID786p.R766fsc.2296_2296delCFrame_Shift_Del674.34TTN100N
RECQL4CESCADMCTTHYROID825p.R766fsc.2296_2296delCFrame_Shift_Del674.348305CN500N
RECQL4CESCADMCTTHYROID825p.R766fsc.2296_2296delCFrame_Shift_Del674.348505CN500N
RECQL4CESCADMCTTHYROID825p.R766fsc.2296_2296delCFrame_Shift_Del674.34CAL62N500N
RECQL4CESCADMCTTHYROID825p.R766fsc.2296_2296delCFrame_Shift_Del674.34CGTHW1N500N
RECQL4CESCADMCTTHYROID825p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC133N500N
RECQL4CESCADMCTTHYROID825p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC238N500N
RECQL4CESCADMCTTHYROID825p.R766fsc.2296_2296delCFrame_Shift_Del674.34ML1N500N
RECQL4CESCADMCTTHYROID825p.R766fsc.2296_2296delCFrame_Shift_Del674.34SW579N500N
RECQL4CESCADMCTTHYROID825p.R766fsc.2296_2296delCFrame_Shift_Del674.34TTN500N
RECQL4CGLCCIWGCTHYROID783p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN100N
RECQL4CGLCCIWGCTHYROID783p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN100N
RECQL4CGLCCIWGCTHYROID783p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N100N
RECQL4CGLCCIWGCTHYROID783p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N100N
RECQL4CGLCCIWGCTHYROID783p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N100N
RECQL4CGLCCIWGCTHYROID783p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N100N
RECQL4CGLCCIWGCTHYROID783p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N100N
RECQL4CGLCCIWGCTHYROID783p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N100N
RECQL4CGLCCIWGCTHYROID783p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN100N
RECQL4CIWGCPQASTHYROID787p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4CIWGCPQASTHYROID787p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4CIWGCPQASTHYROID787p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4CIWGCPQASTHYROID787p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4CIWGCPQASTHYROID787p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4CIWGCPQASTHYROID787p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4CIWGCPQASTHYROID787p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4CIWGCPQASTHYROID787p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4CIWGCPQASTHYROID787p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4CPQASRATCTHYROID791p.R766fsc.2296_2296delCFrame_Shift_Del674.348305CN400Y
RECQL4CPQASRATCTHYROID791p.R766fsc.2296_2296delCFrame_Shift_Del674.348505CN400Y
RECQL4CPQASRATCTHYROID791p.R766fsc.2296_2296delCFrame_Shift_Del674.34CAL62N400Y
RECQL4CPQASRATCTHYROID791p.R766fsc.2296_2296delCFrame_Shift_Del674.34CGTHW1N400Y
RECQL4CPQASRATCTHYROID791p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC133N400Y
RECQL4CPQASRATCTHYROID791p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC238N400Y
RECQL4CPQASRATCTHYROID791p.R766fsc.2296_2296delCFrame_Shift_Del674.34ML1N400Y
RECQL4CPQASRATCTHYROID791p.R766fsc.2296_2296delCFrame_Shift_Del674.34SW579N400Y
RECQL4CPQASRATCTHYROID791p.R766fsc.2296_2296delCFrame_Shift_Del674.34TTN400Y
RECQL4CRPWAGPGVTHYROID799p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN400N
RECQL4CRPWAGPGVTHYROID799p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN400N
RECQL4CRPWAGPGVTHYROID799p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N400N
RECQL4CRPWAGPGVTHYROID799p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N400N
RECQL4CRPWAGPGVTHYROID799p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N400N
RECQL4CRPWAGPGVTHYROID799p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N400N
RECQL4CRPWAGPGVTHYROID799p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N400N
RECQL4CRPWAGPGVTHYROID799p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N400N
RECQL4CRPWAGPGVTHYROID799p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN400N
RECQL4CSPRAKTCETHYROID818p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4CSPRAKTCETHYROID818p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4CSPRAKTCETHYROID818p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4CSPRAKTCETHYROID818p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4CSPRAKTCETHYROID818p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4CSPRAKTCETHYROID818p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4CSPRAKTCETHYROID818p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4CSPRAKTCETHYROID818p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4CSPRAKTCETHYROID818p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4CTPTARTSWTHYROID832p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN100N
RECQL4CTPTARTSWTHYROID832p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN100N
RECQL4CTPTARTSWTHYROID832p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N100N
RECQL4CTPTARTSWTHYROID832p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N100N
RECQL4CTPTARTSWTHYROID832p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N100N
RECQL4CTPTARTSWTHYROID832p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N100N
RECQL4CTPTARTSWTHYROID832p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N100N
RECQL4CTPTARTSWTHYROID832p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N100N
RECQL4CTPTARTSWTHYROID832p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN100N
RECQL4DMCTPTARTTHYROID830p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN200N
RECQL4DMCTPTARTTHYROID830p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN200N
RECQL4DMCTPTARTTHYROID830p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N200N
RECQL4DMCTPTARTTHYROID830p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N200N
RECQL4DMCTPTARTTHYROID830p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N200N
RECQL4DMCTPTARTTHYROID830p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N200N
RECQL4DMCTPTARTTHYROID830p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N200N
RECQL4DMCTPTARTTHYROID830p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N200N
RECQL4DMCTPTARTTHYROID830p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN200N
RECQL4ESCADMCTPTHYROID826p.R766fsc.2296_2296delCFrame_Shift_Del674.348305CN000N
RECQL4ESCADMCTPTHYROID826p.R766fsc.2296_2296delCFrame_Shift_Del674.348505CN000N
RECQL4ESCADMCTPTHYROID826p.R766fsc.2296_2296delCFrame_Shift_Del674.34CAL62N000N
RECQL4ESCADMCTPTHYROID826p.R766fsc.2296_2296delCFrame_Shift_Del674.34CGTHW1N000N
RECQL4ESCADMCTPTHYROID826p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC133N000N
RECQL4ESCADMCTPTHYROID826p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC238N000N
RECQL4ESCADMCTPTHYROID826p.R766fsc.2296_2296delCFrame_Shift_Del674.34ML1N000N
RECQL4ESCADMCTPTHYROID826p.R766fsc.2296_2296delCFrame_Shift_Del674.34SW579N000N
RECQL4ESCADMCTPTHYROID826p.R766fsc.2296_2296delCFrame_Shift_Del674.34TTN000N
RECQL4FMQGQLGWWTHYROID760p.R766fsc.2296_2296delCFrame_Shift_Del374.348305CN500N
RECQL4FMQGQLGWWTHYROID760p.R766fsc.2296_2296delCFrame_Shift_Del374.348505CN500N
RECQL4FMQGQLGWWTHYROID760p.R766fsc.2296_2296delCFrame_Shift_Del374.34CAL62N500N
RECQL4FMQGQLGWWTHYROID760p.R766fsc.2296_2296delCFrame_Shift_Del374.34CGTHW1N500N
RECQL4FMQGQLGWWTHYROID760p.R766fsc.2296_2296delCFrame_Shift_Del374.34FTC133N500N
RECQL4FMQGQLGWWTHYROID760p.R766fsc.2296_2296delCFrame_Shift_Del374.34FTC238N500N
RECQL4FMQGQLGWWTHYROID760p.R766fsc.2296_2296delCFrame_Shift_Del374.34ML1N500N
RECQL4FMQGQLGWWTHYROID760p.R766fsc.2296_2296delCFrame_Shift_Del374.34SW579N500N
RECQL4FMQGQLGWWTHYROID760p.R766fsc.2296_2296delCFrame_Shift_Del374.34TTN500N
RECQL4GCPQASRATTHYROID790p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN100N
RECQL4GCPQASRATTHYROID790p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN100N
RECQL4GCPQASRATTHYROID790p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N100N
RECQL4GCPQASRATTHYROID790p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N100N
RECQL4GCPQASRATTHYROID790p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N100N
RECQL4GCPQASRATTHYROID790p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N100N
RECQL4GCPQASRATTHYROID790p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N100N
RECQL4GCPQASRATTHYROID790p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N100N
RECQL4GCPQASRATTHYROID790p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN100N
RECQL4GLCCIWGCPTHYROID784p.R766fsc.2296_2296delCFrame_Shift_Del674.348305CN100N
RECQL4GLCCIWGCPTHYROID784p.R766fsc.2296_2296delCFrame_Shift_Del674.348505CN100N
RECQL4GLCCIWGCPTHYROID784p.R766fsc.2296_2296delCFrame_Shift_Del674.34CAL62N100N
RECQL4GLCCIWGCPTHYROID784p.R766fsc.2296_2296delCFrame_Shift_Del674.34CGTHW1N100N
RECQL4GLCCIWGCPTHYROID784p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC133N100N
RECQL4GLCCIWGCPTHYROID784p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC238N100N
RECQL4GLCCIWGCPTHYROID784p.R766fsc.2296_2296delCFrame_Shift_Del674.34ML1N100N
RECQL4GLCCIWGCPTHYROID784p.R766fsc.2296_2296delCFrame_Shift_Del674.34SW579N100N
RECQL4GLCCIWGCPTHYROID784p.R766fsc.2296_2296delCFrame_Shift_Del674.34TTN100N
RECQL4GPGVTGSLPTHYROID804p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4GPGVTGSLPTHYROID804p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4GPGVTGSLPTHYROID804p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4GPGVTGSLPTHYROID804p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4GPGVTGSLPTHYROID804p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4GPGVTGSLPTHYROID804p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4GPGVTGSLPTHYROID804p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4GPGVTGSLPTHYROID804p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4GPGVTGSLPTHYROID804p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4GQLGWWWPRTHYROID763p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN700N
RECQL4GQLGWWWPRTHYROID763p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN700N
RECQL4GQLGWWWPRTHYROID763p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N700N
RECQL4GQLGWWWPRTHYROID763p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N700N
RECQL4GQLGWWWPRTHYROID763p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N700N
RECQL4GQLGWWWPRTHYROID763p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N700N
RECQL4GQLGWWWPRTHYROID763p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N700N
RECQL4GQLGWWWPRTHYROID763p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N700N
RECQL4GQLGWWWPRTHYROID763p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN700N
RECQL4GQMCGLCCITHYROID780p.R766fsc.2296_2296delCFrame_Shift_Del674.348305CN1000N
RECQL4GQMCGLCCITHYROID780p.R766fsc.2296_2296delCFrame_Shift_Del674.348505CN1000N
RECQL4GQMCGLCCITHYROID780p.R766fsc.2296_2296delCFrame_Shift_Del674.34CAL62N1000N
RECQL4GQMCGLCCITHYROID780p.R766fsc.2296_2296delCFrame_Shift_Del674.34CGTHW1N1000N
RECQL4GQMCGLCCITHYROID780p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC133N1000N
RECQL4GQMCGLCCITHYROID780p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC238N1000N
RECQL4GQMCGLCCITHYROID780p.R766fsc.2296_2296delCFrame_Shift_Del674.34ML1N1000N
RECQL4GQMCGLCCITHYROID780p.R766fsc.2296_2296delCFrame_Shift_Del674.34SW579N1000N
RECQL4GQMCGLCCITHYROID780p.R766fsc.2296_2296delCFrame_Shift_Del674.34TTN1000N
RECQL4GSLPTATSSTHYROID809p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4GSLPTATSSTHYROID809p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4GSLPTATSSTHYROID809p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4GSLPTATSSTHYROID809p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4GSLPTATSSTHYROID809p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4GSLPTATSSTHYROID809p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4GSLPTATSSTHYROID809p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4GSLPTATSSTHYROID809p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4GSLPTATSSTHYROID809p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4GVTGSLPTATHYROID806p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN100N
RECQL4GVTGSLPTATHYROID806p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN100N
RECQL4GVTGSLPTATHYROID806p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N100N
RECQL4GVTGSLPTATHYROID806p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N100N
RECQL4GVTGSLPTATHYROID806p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N100N
RECQL4GVTGSLPTATHYROID806p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N100N
RECQL4GVTGSLPTATHYROID806p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N100N
RECQL4GVTGSLPTATHYROID806p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N100N
RECQL4GVTGSLPTATHYROID806p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN100N
RECQL4GWGWTGQMCTHYROID775p.R766fsc.2296_2296delCFrame_Shift_Del674.348305CN000N
RECQL4GWGWTGQMCTHYROID775p.R766fsc.2296_2296delCFrame_Shift_Del674.348505CN000N
RECQL4GWGWTGQMCTHYROID775p.R766fsc.2296_2296delCFrame_Shift_Del674.34CAL62N000N
RECQL4GWGWTGQMCTHYROID775p.R766fsc.2296_2296delCFrame_Shift_Del674.34CGTHW1N000N
RECQL4GWGWTGQMCTHYROID775p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC133N000N
RECQL4GWGWTGQMCTHYROID775p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC238N000N
RECQL4GWGWTGQMCTHYROID775p.R766fsc.2296_2296delCFrame_Shift_Del674.34ML1N000N
RECQL4GWGWTGQMCTHYROID775p.R766fsc.2296_2296delCFrame_Shift_Del674.34SW579N000N
RECQL4GWGWTGQMCTHYROID775p.R766fsc.2296_2296delCFrame_Shift_Del674.34TTN000N
RECQL4GWTGQMCGLTHYROID777p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN400N
RECQL4GWTGQMCGLTHYROID777p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN400N
RECQL4GWTGQMCGLTHYROID777p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N400N
RECQL4GWTGQMCGLTHYROID777p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N400N
RECQL4GWTGQMCGLTHYROID777p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N400N
RECQL4GWTGQMCGLTHYROID777p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N400N
RECQL4GWTGQMCGLTHYROID777p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N400N
RECQL4GWTGQMCGLTHYROID777p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N400N
RECQL4GWTGQMCGLTHYROID777p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN400N
RECQL4GWWWPRWPLTHYROID766p.R766fsc.2296_2296delCFrame_Shift_Del674.348305CY8120N
RECQL4GWWWPRWPLTHYROID766p.R766fsc.2296_2296delCFrame_Shift_Del674.348505CY8120N
RECQL4GWWWPRWPLTHYROID766p.R766fsc.2296_2296delCFrame_Shift_Del674.34CAL62Y8120N
RECQL4GWWWPRWPLTHYROID766p.R766fsc.2296_2296delCFrame_Shift_Del674.34CGTHW1Y8120N
RECQL4GWWWPRWPLTHYROID766p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC133Y8120N
RECQL4GWWWPRWPLTHYROID766p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC238Y8120N
RECQL4GWWWPRWPLTHYROID766p.R766fsc.2296_2296delCFrame_Shift_Del674.34ML1Y8120N
RECQL4GWWWPRWPLTHYROID766p.R766fsc.2296_2296delCFrame_Shift_Del674.34SW579Y8120N
RECQL4GWWWPRWPLTHYROID766p.R766fsc.2296_2296delCFrame_Shift_Del674.34TTY8120N
RECQL4IWGCPQASRTHYROID788p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN100N
RECQL4IWGCPQASRTHYROID788p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN100N
RECQL4IWGCPQASRTHYROID788p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N100N
RECQL4IWGCPQASRTHYROID788p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N100N
RECQL4IWGCPQASRTHYROID788p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N100N
RECQL4IWGCPQASRTHYROID788p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N100N
RECQL4IWGCPQASRTHYROID788p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N100N
RECQL4IWGCPQASRTHYROID788p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N100N
RECQL4IWGCPQASRTHYROID788p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN100N
RECQL4KTCESCADMTHYROID823p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CY490N
RECQL4KTCESCADMTHYROID823p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CY490N
RECQL4KTCESCADMTHYROID823p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62Y490N
RECQL4KTCESCADMTHYROID823p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1Y490N
RECQL4KTCESCADMTHYROID823p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133Y490N
RECQL4KTCESCADMTHYROID823p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238Y490N
RECQL4KTCESCADMTHYROID823p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1Y490N
RECQL4KTCESCADMTHYROID823p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579Y490N
RECQL4KTCESCADMTHYROID823p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTY490N
RECQL4LCCIWGCPQTHYROID785p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4LCCIWGCPQTHYROID785p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4LCCIWGCPQTHYROID785p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4LCCIWGCPQTHYROID785p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4LCCIWGCPQTHYROID785p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4LCCIWGCPQTHYROID785p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4LCCIWGCPQTHYROID785p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4LCCIWGCPQTHYROID785p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4LCCIWGCPQTHYROID785p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4LGWGWTGQMTHYROID774p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN1001N
RECQL4LGWGWTGQMTHYROID774p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN1001N
RECQL4LGWGWTGQMTHYROID774p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N1001N
RECQL4LGWGWTGQMTHYROID774p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N1001N
RECQL4LGWGWTGQMTHYROID774p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N1001N
RECQL4LGWGWTGQMTHYROID774p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N1001N
RECQL4LGWGWTGQMTHYROID774p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N1001N
RECQL4LGWGWTGQMTHYROID774p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N1001N
RECQL4LGWGWTGQMTHYROID774p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN1001N
RECQL4LGWWWPRWPTHYROID765p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN004N
RECQL4LGWWWPRWPTHYROID765p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN004N
RECQL4LGWWWPRWPTHYROID765p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N004N
RECQL4LGWWWPRWPTHYROID765p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N004N
RECQL4LGWWWPRWPTHYROID765p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N004N
RECQL4LGWWWPRWPTHYROID765p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N004N
RECQL4LGWWWPRWPTHYROID765p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N004N
RECQL4LGWWWPRWPTHYROID765p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N004N
RECQL4LGWWWPRWPTHYROID765p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN004N
RECQL4LPTATSSCSTHYROID811p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN501N
RECQL4LPTATSSCSTHYROID811p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN501N
RECQL4LPTATSSCSTHYROID811p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N501N
RECQL4LPTATSSCSTHYROID811p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N501N
RECQL4LPTATSSCSTHYROID811p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N501N
RECQL4LPTATSSCSTHYROID811p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N501N
RECQL4LPTATSSCSTHYROID811p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N501N
RECQL4LPTATSSCSTHYROID811p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N501N
RECQL4LPTATSSCSTHYROID811p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN501N
RECQL4MCGLCCIWGTHYROID782p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN001N
RECQL4MCGLCCIWGTHYROID782p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN001N
RECQL4MCGLCCIWGTHYROID782p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N001N
RECQL4MCGLCCIWGTHYROID782p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N001N
RECQL4MCGLCCIWGTHYROID782p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N001N
RECQL4MCGLCCIWGTHYROID782p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N001N
RECQL4MCGLCCIWGTHYROID782p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N001N
RECQL4MCGLCCIWGTHYROID782p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N001N
RECQL4MCGLCCIWGTHYROID782p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN001N
RECQL4MCTPTARTSTHYROID831p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000Y
RECQL4MCTPTARTSTHYROID831p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000Y
RECQL4MCTPTARTSTHYROID831p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000Y
RECQL4MCTPTARTSTHYROID831p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000Y
RECQL4MCTPTARTSTHYROID831p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000Y
RECQL4MCTPTARTSTHYROID831p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000Y
RECQL4MCTPTARTSTHYROID831p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000Y
RECQL4MCTPTARTSTHYROID831p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000Y
RECQL4MCTPTARTSTHYROID831p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000Y
RECQL4MQGQLGWWWTHYROID761p.R766fsc.2296_2296delCFrame_Shift_Del474.348305CN500N
RECQL4MQGQLGWWWTHYROID761p.R766fsc.2296_2296delCFrame_Shift_Del474.348505CN500N
RECQL4MQGQLGWWWTHYROID761p.R766fsc.2296_2296delCFrame_Shift_Del474.34CAL62N500N
RECQL4MQGQLGWWWTHYROID761p.R766fsc.2296_2296delCFrame_Shift_Del474.34CGTHW1N500N
RECQL4MQGQLGWWWTHYROID761p.R766fsc.2296_2296delCFrame_Shift_Del474.34FTC133N500N
RECQL4MQGQLGWWWTHYROID761p.R766fsc.2296_2296delCFrame_Shift_Del474.34FTC238N500N
RECQL4MQGQLGWWWTHYROID761p.R766fsc.2296_2296delCFrame_Shift_Del474.34ML1N500N
RECQL4MQGQLGWWWTHYROID761p.R766fsc.2296_2296delCFrame_Shift_Del474.34SW579N500N
RECQL4MQGQLGWWWTHYROID761p.R766fsc.2296_2296delCFrame_Shift_Del474.34TTN500N
RECQL4PGVTGSLPTTHYROID805p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4PGVTGSLPTTHYROID805p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4PGVTGSLPTTHYROID805p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4PGVTGSLPTTHYROID805p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4PGVTGSLPTTHYROID805p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4PGVTGSLPTTHYROID805p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4PGVTGSLPTTHYROID805p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4PGVTGSLPTTHYROID805p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4PGVTGSLPTTHYROID805p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4PLGWGWTGQTHYROID773p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4PLGWGWTGQTHYROID773p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4PLGWGWTGQTHYROID773p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4PLGWGWTGQTHYROID773p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4PLGWGWTGQTHYROID773p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4PLGWGWTGQTHYROID773p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4PLGWGWTGQTHYROID773p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4PLGWGWTGQTHYROID773p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4PLGWGWTGQTHYROID773p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4PQASRATCRTHYROID792p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CY090Y
RECQL4PQASRATCRTHYROID792p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CY090Y
RECQL4PQASRATCRTHYROID792p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62Y090Y
RECQL4PQASRATCRTHYROID792p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1Y090Y
RECQL4PQASRATCRTHYROID792p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133Y090Y
RECQL4PQASRATCRTHYROID792p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238Y090Y
RECQL4PQASRATCRTHYROID792p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1Y090Y
RECQL4PQASRATCRTHYROID792p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579Y090Y
RECQL4PQASRATCRTHYROID792p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTY090Y
RECQL4PRAKTCESCTHYROID820p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN100N
RECQL4PRAKTCESCTHYROID820p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN100N
RECQL4PRAKTCESCTHYROID820p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N100N
RECQL4PRAKTCESCTHYROID820p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N100N
RECQL4PRAKTCESCTHYROID820p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N100N
RECQL4PRAKTCESCTHYROID820p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N100N
RECQL4PRAKTCESCTHYROID820p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N100N
RECQL4PRAKTCESCTHYROID820p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N100N
RECQL4PRAKTCESCTHYROID820p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN100N
RECQL4PRWPLGWGWTHYROID770p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN300N
RECQL4PRWPLGWGWTHYROID770p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN300N
RECQL4PRWPLGWGWTHYROID770p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N300N
RECQL4PRWPLGWGWTHYROID770p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N300N
RECQL4PRWPLGWGWTHYROID770p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N300N
RECQL4PRWPLGWGWTHYROID770p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N300N
RECQL4PRWPLGWGWTHYROID770p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N300N
RECQL4PRWPLGWGWTHYROID770p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N300N
RECQL4PRWPLGWGWTHYROID770p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN300N
RECQL4PTATSSCSPTHYROID812p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4PTATSSCSPTHYROID812p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4PTATSSCSPTHYROID812p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4PTATSSCSPTHYROID812p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4PTATSSCSPTHYROID812p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4PTATSSCSPTHYROID812p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4PTATSSCSPTHYROID812p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4PTATSSCSPTHYROID812p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4PTATSSCSPTHYROID812p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4PWAGPGVTGTHYROID801p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4PWAGPGVTGTHYROID801p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4PWAGPGVTGTHYROID801p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4PWAGPGVTGTHYROID801p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4PWAGPGVTGTHYROID801p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4PWAGPGVTGTHYROID801p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4PWAGPGVTGTHYROID801p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4PWAGPGVTGTHYROID801p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4PWAGPGVTGTHYROID801p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4QASRATCRPTHYROID793p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4QASRATCRPTHYROID793p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4QASRATCRPTHYROID793p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4QASRATCRPTHYROID793p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4QASRATCRPTHYROID793p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4QASRATCRPTHYROID793p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4QASRATCRPTHYROID793p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4QASRATCRPTHYROID793p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4QASRATCRPTHYROID793p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4QGQLGWWWPTHYROID762p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4QGQLGWWWPTHYROID762p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4QGQLGWWWPTHYROID762p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4QGQLGWWWPTHYROID762p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4QGQLGWWWPTHYROID762p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4QGQLGWWWPTHYROID762p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4QGQLGWWWPTHYROID762p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4QGQLGWWWPTHYROID762p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4QGQLGWWWPTHYROID762p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4QLGWWWPRWTHYROID764p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN500N
RECQL4QLGWWWPRWTHYROID764p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN500N
RECQL4QLGWWWPRWTHYROID764p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N500N
RECQL4QLGWWWPRWTHYROID764p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N500N
RECQL4QLGWWWPRWTHYROID764p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N500N
RECQL4QLGWWWPRWTHYROID764p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N500N
RECQL4QLGWWWPRWTHYROID764p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N500N
RECQL4QLGWWWPRWTHYROID764p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N500N
RECQL4QLGWWWPRWTHYROID764p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN500N
RECQL4QMCGLCCIWTHYROID781p.R766fsc.2296_2296delCFrame_Shift_Del674.348305CN200N
RECQL4QMCGLCCIWTHYROID781p.R766fsc.2296_2296delCFrame_Shift_Del674.348505CN200N
RECQL4QMCGLCCIWTHYROID781p.R766fsc.2296_2296delCFrame_Shift_Del674.34CAL62N200N
RECQL4QMCGLCCIWTHYROID781p.R766fsc.2296_2296delCFrame_Shift_Del674.34CGTHW1N200N
RECQL4QMCGLCCIWTHYROID781p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC133N200N
RECQL4QMCGLCCIWTHYROID781p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC238N200N
RECQL4QMCGLCCIWTHYROID781p.R766fsc.2296_2296delCFrame_Shift_Del674.34ML1N200N
RECQL4QMCGLCCIWTHYROID781p.R766fsc.2296_2296delCFrame_Shift_Del674.34SW579N200N
RECQL4QMCGLCCIWTHYROID781p.R766fsc.2296_2296delCFrame_Shift_Del674.34TTN200N
RECQL4RAFMQGQLGTHYROID758p.R766fsc.2296_2296delCFrame_Shift_Del174.348305CN000N
RECQL4RAFMQGQLGTHYROID758p.R766fsc.2296_2296delCFrame_Shift_Del174.348505CN000N
RECQL4RAFMQGQLGTHYROID758p.R766fsc.2296_2296delCFrame_Shift_Del174.34CAL62N000N
RECQL4RAFMQGQLGTHYROID758p.R766fsc.2296_2296delCFrame_Shift_Del174.34CGTHW1N000N
RECQL4RAFMQGQLGTHYROID758p.R766fsc.2296_2296delCFrame_Shift_Del174.34FTC133N000N
RECQL4RAFMQGQLGTHYROID758p.R766fsc.2296_2296delCFrame_Shift_Del174.34FTC238N000N
RECQL4RAFMQGQLGTHYROID758p.R766fsc.2296_2296delCFrame_Shift_Del174.34ML1N000N
RECQL4RAFMQGQLGTHYROID758p.R766fsc.2296_2296delCFrame_Shift_Del174.34SW579N000N
RECQL4RAFMQGQLGTHYROID758p.R766fsc.2296_2296delCFrame_Shift_Del174.34TTN000N
RECQL4RAKTCESCATHYROID821p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN300N
RECQL4RAKTCESCATHYROID821p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN300N
RECQL4RAKTCESCATHYROID821p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N300N
RECQL4RAKTCESCATHYROID821p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N300N
RECQL4RAKTCESCATHYROID821p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N300N
RECQL4RAKTCESCATHYROID821p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N300N
RECQL4RAKTCESCATHYROID821p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N300N
RECQL4RAKTCESCATHYROID821p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N300N
RECQL4RAKTCESCATHYROID821p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN300N
RECQL4RATCRPWAGTHYROID796p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4RATCRPWAGTHYROID796p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4RATCRPWAGTHYROID796p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4RATCRPWAGTHYROID796p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4RATCRPWAGTHYROID796p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4RATCRPWAGTHYROID796p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4RATCRPWAGTHYROID796p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4RATCRPWAGTHYROID796p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4RATCRPWAGTHYROID796p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4RPWAGPGVTTHYROID800p.R766fsc.2296_2296delCFrame_Shift_Del674.348305CN800N
RECQL4RPWAGPGVTTHYROID800p.R766fsc.2296_2296delCFrame_Shift_Del674.348505CN800N
RECQL4RPWAGPGVTTHYROID800p.R766fsc.2296_2296delCFrame_Shift_Del674.34CAL62N800N
RECQL4RPWAGPGVTTHYROID800p.R766fsc.2296_2296delCFrame_Shift_Del674.34CGTHW1N800N
RECQL4RPWAGPGVTTHYROID800p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC133N800N
RECQL4RPWAGPGVTTHYROID800p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC238N800N
RECQL4RPWAGPGVTTHYROID800p.R766fsc.2296_2296delCFrame_Shift_Del674.34ML1N800N
RECQL4RPWAGPGVTTHYROID800p.R766fsc.2296_2296delCFrame_Shift_Del674.34SW579N800N
RECQL4RPWAGPGVTTHYROID800p.R766fsc.2296_2296delCFrame_Shift_Del674.34TTN800N
RECQL4RWPLGWGWTTHYROID771p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4RWPLGWGWTTHYROID771p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4RWPLGWGWTTHYROID771p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4RWPLGWGWTTHYROID771p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4RWPLGWGWTTHYROID771p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4RWPLGWGWTTHYROID771p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4RWPLGWGWTTHYROID771p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4RWPLGWGWTTHYROID771p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4RWPLGWGWTTHYROID771p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4SCADMCTPTTHYROID827p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4SCADMCTPTTHYROID827p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4SCADMCTPTTHYROID827p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4SCADMCTPTTHYROID827p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4SCADMCTPTTHYROID827p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4SCADMCTPTTHYROID827p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4SCADMCTPTTHYROID827p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4SCADMCTPTTHYROID827p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4SCADMCTPTTHYROID827p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4SCSPRAKTCTHYROID817p.R766fsc.2296_2296delCFrame_Shift_Del674.348305CN100N
RECQL4SCSPRAKTCTHYROID817p.R766fsc.2296_2296delCFrame_Shift_Del674.348505CN100N
RECQL4SCSPRAKTCTHYROID817p.R766fsc.2296_2296delCFrame_Shift_Del674.34CAL62N100N
RECQL4SCSPRAKTCTHYROID817p.R766fsc.2296_2296delCFrame_Shift_Del674.34CGTHW1N100N
RECQL4SCSPRAKTCTHYROID817p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC133N100N
RECQL4SCSPRAKTCTHYROID817p.R766fsc.2296_2296delCFrame_Shift_Del674.34FTC238N100N
RECQL4SCSPRAKTCTHYROID817p.R766fsc.2296_2296delCFrame_Shift_Del674.34ML1N100N
RECQL4SCSPRAKTCTHYROID817p.R766fsc.2296_2296delCFrame_Shift_Del674.34SW579N100N
RECQL4SCSPRAKTCTHYROID817p.R766fsc.2296_2296delCFrame_Shift_Del674.34TTN100N
RECQL4SLPTATSSCTHYROID810p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN300N
RECQL4SLPTATSSCTHYROID810p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN300N
RECQL4SLPTATSSCTHYROID810p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N300N
RECQL4SLPTATSSCTHYROID810p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N300N
RECQL4SLPTATSSCTHYROID810p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N300N
RECQL4SLPTATSSCTHYROID810p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N300N
RECQL4SLPTATSSCTHYROID810p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N300N
RECQL4SLPTATSSCTHYROID810p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N300N
RECQL4SLPTATSSCTHYROID810p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN300N
RECQL4SPRAKTCESTHYROID819p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN400N
RECQL4SPRAKTCESTHYROID819p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN400N
RECQL4SPRAKTCESTHYROID819p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N400N
RECQL4SPRAKTCESTHYROID819p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N400N
RECQL4SPRAKTCESTHYROID819p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N400N
RECQL4SPRAKTCESTHYROID819p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N400N
RECQL4SPRAKTCESTHYROID819p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N400N
RECQL4SPRAKTCESTHYROID819p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N400N
RECQL4SPRAKTCESTHYROID819p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN400N
RECQL4SRATCRPWATHYROID795p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN300N
RECQL4SRATCRPWATHYROID795p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN300N
RECQL4SRATCRPWATHYROID795p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N300N
RECQL4SRATCRPWATHYROID795p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N300N
RECQL4SRATCRPWATHYROID795p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N300N
RECQL4SRATCRPWATHYROID795p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N300N
RECQL4SRATCRPWATHYROID795p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N300N
RECQL4SRATCRPWATHYROID795p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N300N
RECQL4SRATCRPWATHYROID795p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN300N
RECQL4SSCSPRAKTTHYROID816p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN100N
RECQL4SSCSPRAKTTHYROID816p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN100N
RECQL4SSCSPRAKTTHYROID816p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N100N
RECQL4SSCSPRAKTTHYROID816p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N100N
RECQL4SSCSPRAKTTHYROID816p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N100N
RECQL4SSCSPRAKTTHYROID816p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N100N
RECQL4SSCSPRAKTTHYROID816p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N100N
RECQL4SSCSPRAKTTHYROID816p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N100N
RECQL4SSCSPRAKTTHYROID816p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN100N
RECQL4TATSSCSPRTHYROID813p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN300N
RECQL4TATSSCSPRTHYROID813p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN300N
RECQL4TATSSCSPRTHYROID813p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N300N
RECQL4TATSSCSPRTHYROID813p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N300N
RECQL4TATSSCSPRTHYROID813p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N300N
RECQL4TATSSCSPRTHYROID813p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N300N
RECQL4TATSSCSPRTHYROID813p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N300N
RECQL4TATSSCSPRTHYROID813p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N300N
RECQL4TATSSCSPRTHYROID813p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN300N
RECQL4TCESCADMCTHYROID824p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN100N
RECQL4TCESCADMCTHYROID824p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN100N
RECQL4TCESCADMCTHYROID824p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N100N
RECQL4TCESCADMCTHYROID824p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N100N
RECQL4TCESCADMCTHYROID824p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N100N
RECQL4TCESCADMCTHYROID824p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N100N
RECQL4TCESCADMCTHYROID824p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N100N
RECQL4TCESCADMCTHYROID824p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N100N
RECQL4TCESCADMCTHYROID824p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN100N
RECQL4TCRPWAGPGTHYROID798p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4TCRPWAGPGTHYROID798p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4TCRPWAGPGTHYROID798p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4TCRPWAGPGTHYROID798p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4TCRPWAGPGTHYROID798p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4TCRPWAGPGTHYROID798p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4TCRPWAGPGTHYROID798p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4TCRPWAGPGTHYROID798p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4TCRPWAGPGTHYROID798p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4TGQMCGLCCTHYROID779p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN100N
RECQL4TGQMCGLCCTHYROID779p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN100N
RECQL4TGQMCGLCCTHYROID779p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N100N
RECQL4TGQMCGLCCTHYROID779p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N100N
RECQL4TGQMCGLCCTHYROID779p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N100N
RECQL4TGQMCGLCCTHYROID779p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N100N
RECQL4TGQMCGLCCTHYROID779p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N100N
RECQL4TGQMCGLCCTHYROID779p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N100N
RECQL4TGQMCGLCCTHYROID779p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN100N
RECQL4TGSLPTATSTHYROID808p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN000N
RECQL4TGSLPTATSTHYROID808p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN000N
RECQL4TGSLPTATSTHYROID808p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N000N
RECQL4TGSLPTATSTHYROID808p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N000N
RECQL4TGSLPTATSTHYROID808p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N000N
RECQL4TGSLPTATSTHYROID808p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N000N
RECQL4TGSLPTATSTHYROID808p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N000N
RECQL4TGSLPTATSTHYROID808p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N000N
RECQL4TGSLPTATSTHYROID808p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN000N
RECQL4TPTARTSWLTHYROID833p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CY18100N
RECQL4TPTARTSWLTHYROID833p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CY18100N
RECQL4TPTARTSWLTHYROID833p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62Y18100N
RECQL4TPTARTSWLTHYROID833p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1Y18100N
RECQL4TPTARTSWLTHYROID833p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133Y18100N
RECQL4TPTARTSWLTHYROID833p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238Y18100N
RECQL4TPTARTSWLTHYROID833p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1Y18100N
RECQL4TPTARTSWLTHYROID833p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579Y18100N
RECQL4TPTARTSWLTHYROID833p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTY18100N
RECQL4TSSCSPRAKTHYROID815p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CY1120N
RECQL4TSSCSPRAKTHYROID815p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CY1120N
RECQL4TSSCSPRAKTHYROID815p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62Y1120N
RECQL4TSSCSPRAKTHYROID815p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1Y1120N
RECQL4TSSCSPRAKTHYROID815p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133Y1120N
RECQL4TSSCSPRAKTHYROID815p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238Y1120N
RECQL4TSSCSPRAKTHYROID815p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1Y1120N
RECQL4TSSCSPRAKTHYROID815p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579Y1120N
RECQL4TSSCSPRAKTHYROID815p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTY1120N
RECQL4VTGSLPTATTHYROID807p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN100N
RECQL4VTGSLPTATTHYROID807p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN100N
RECQL4VTGSLPTATTHYROID807p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N100N
RECQL4VTGSLPTATTHYROID807p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N100N
RECQL4VTGSLPTATTHYROID807p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N100N
RECQL4VTGSLPTATTHYROID807p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N100N
RECQL4VTGSLPTATTHYROID807p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N100N
RECQL4VTGSLPTATTHYROID807p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N100N
RECQL4VTGSLPTATTHYROID807p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN100N
RECQL4WAGPGVTGSTHYROID802p.R766fsc.2296_2296delCFrame_Shift_Del574.348305CN200N
RECQL4WAGPGVTGSTHYROID802p.R766fsc.2296_2296delCFrame_Shift_Del574.348505CN200N
RECQL4WAGPGVTGSTHYROID802p.R766fsc.2296_2296delCFrame_Shift_Del574.34CAL62N200N
RECQL4WAGPGVTGSTHYROID802p.R766fsc.2296_2296delCFrame_Shift_Del574.34CGTHW1N200N
RECQL4WAGPGVTGSTHYROID802p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC133N200N
RECQL4WAGPGVTGSTHYROID802p.R766fsc.2296_2296delCFrame_Shift_Del574.34FTC238N200N
RECQL4WAGPGVTGSTHYROID802p.R766fsc.2296_2296delCFrame_Shift_Del574.34ML1N200N
RECQL4WAGPGVTGSTHYROID802p.R766fsc.2296_2296delCFrame_Shift_Del574.34SW579N200N
RECQL4WAGPGVTGSTHYROID802p.R766fsc.2296_2296delCFrame_Shift_Del574.34TTN200N
RECQL4WGCPQASRATHYROID789p.R766fsc.2296_2296delCFrame_Shift_Del574.34