Cancertope

In silico Platform for designing genome-based
Personalized immunotherapy or Vaccine against Cancer

Browse Results ...


The result page of search shows exclusive peptide/epitopes generated due to mutation [Neoepitope], the tissue of origin [Tissue], position of peptide in protein [Position], number of mismatches counted by aligning mutated and normal protein sequence [Num Mismatch, percentage of cell lines with this peptide over total number of cell lines [Promiscuity %]. The immune information include CTL epitopes (Yes/No), MHC I binders, MHC II binders (both given as number of alleles) and B cell epitopes (Yes/No). For more information, please click HERE


Result Reset Search:
ProteinNeoepitopesTissuePositionProt MutationcDNA MutationMutation TypeNum MismatchPromiscuity (%)Cell LineCTLMHC INHLApredMHC IIBcell
ABL1ADPAKSPKLSTOMACH673p.P681Lc.2042C>TMissense_Mutation10.11IM95N600Y
ABL1AKSPKLSNGSTOMACH676p.P681Lc.2042C>TMissense_Mutation10.11IM95N000N
ABL1DPAKSPKLSSTOMACH674p.P681Lc.2042C>TMissense_Mutation10.11IM95N300N
ABL1KLSNGAGVPSTOMACH680p.P681Lc.2042C>TMissense_Mutation10.11IM95N000N
ABL1KSPKLSNGASTOMACH677p.P681Lc.2042C>TMissense_Mutation10.11IM95N200N
ABL1LSNGAGVPNSTOMACH681p.P681Lc.2042C>TMissense_Mutation10.11IM95N000N
ABL1PAKSPKLSNSTOMACH675p.P681Lc.2042C>TMissense_Mutation10.11IM95N000N
ABL1PKLSNGAGVSTOMACH679p.P681Lc.2042C>TMissense_Mutation10.11IM95N200N
ABL1SPKLSNGAGSTOMACH678p.P681Lc.2042C>TMissense_Mutation10.11IM95N100N
ABL1GYNHSGEWCSTOMACH111p.N115Sc.344A>GMissense_Mutation10.22GSUN300N
ABL1HSGEWCEAQSTOMACH114p.N115Sc.344A>GMissense_Mutation10.22GSUN000N
ABL1LGYNHSGEWSTOMACH110p.N115Sc.344A>GMissense_Mutation10.22GSUN300N
ABL1LRVLGYNHSSTOMACH107p.N115Sc.344A>GMissense_Mutation10.22GSUN2033N
ABL1NHSGEWCEASTOMACH113p.N115Sc.344A>GMissense_Mutation10.22GSUN100N
ABL1RVLGYNHSGSTOMACH108p.N115Sc.344A>GMissense_Mutation10.22GSUN000N
ABL1SGEWCEAQTSTOMACH115p.N115Sc.344A>GMissense_Mutation10.22GSUN000Y
ABL1VLGYNHSGESTOMACH109p.N115Sc.344A>GMissense_Mutation10.22GSUN002N
ABL1YNHSGEWCESTOMACH112p.N115Sc.344A>GMissense_Mutation10.22GSUN300N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.862313287N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86AGSN000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86ECC10N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86ECC12N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86GCIYN000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86GSUN000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HGC27N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS746TN000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HUG1NN000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86IM95N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KATOIIIN000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86LMSUN000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MKN1N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MKN74N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MKN7N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NCCSTCK140N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NCIN87N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NUGC3N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NUGC4N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OCUM1N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86RERFGC1BN000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SH10TCN000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU1N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU216N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU520N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU601N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU620N000N
AKAP12AIEEDLEPESTOMACH1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TGBC11TKBN000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.862313287N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86AGSN000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86ECC10N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86ECC12N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86GCIYN000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86GSUN000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HGC27N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS746TN000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HUG1NN000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86IM95N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KATOIIIN000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86LMSUN000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MKN1N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MKN74N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MKN7N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NCCSTCK140N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NCIN87N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NUGC3N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NUGC4N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OCUM1N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86RERFGC1BN000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SH10TCN000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU1N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU216N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU520N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU601N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU620N000N
AKAP12EEDLEPENGSTOMACH1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TGBC11TKBN000N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.862313287N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86AGSN200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86ECC10N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86ECC12N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86GCIYN200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86GSUN200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HGC27N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS746TN200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HUG1NN200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86IM95N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KATOIIIN200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86LMSUN200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MKN1N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MKN74N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MKN7N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NCCSTCK140N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NCIN87N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NUGC3N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NUGC4N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OCUM1N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86RERFGC1BN200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SH10TCN200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU1N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU216N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU520N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU601N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU620N200N
AKAP12IEEDLEPENSTOMACH1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TGBC11TKBN200N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.862313287N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86AGSN000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86ECC10N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86ECC12N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86GCIYN000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86GSUN000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HGC27N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS746TN000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HUG1NN000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86IM95N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KATOIIIN000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86LMSUN000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MKN1N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MKN74N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MKN7N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NCCSTCK140N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NCIN87N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NUGC3N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NUGC4N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OCUM1N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86RERFGC1BN000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SH10TCN000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU1N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU216N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU520N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU601N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU620N000N
AKAP12KVSVAIEEDSTOMACH1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TGBC11TKBN000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.862313287N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86AGSN000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86ECC10N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86ECC12N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86GCIYN000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86GSUN000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HGC27N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS746TN000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HUG1NN000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86IM95N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KATOIIIN000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86LMSUN000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MKN1N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MKN74N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MKN7N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NCCSTCK140N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NCIN87N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NUGC3N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NUGC4N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OCUM1N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86RERFGC1BN000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SH10TCN000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU1N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU216N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU520N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU601N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU620N000N
AKAP12SVAIEEDLESTOMACH1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TGBC11TKBN000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.862313287N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86AGSN000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86ECC10N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86ECC12N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86GCIYN000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86GSUN000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HGC27N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS746TN000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HUG1NN000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86IM95N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KATOIIIN000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86LMSUN000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MKN1N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MKN74N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MKN7N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NCCSTCK140N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NCIN87N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NUGC3N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NUGC4N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OCUM1N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86RERFGC1BN000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SH10TCN000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU1N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU216N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU520N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU601N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU620N000N
AKAP12VAIEEDLEPSTOMACH1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TGBC11TKBN000N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.862313287N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86AGSN002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86ECC10N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86ECC12N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86GCIYN002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86GSUN002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HGC27N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS746TN002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HUG1NN002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86IM95N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KATOIIIN002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86LMSUN002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MKN1N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MKN74N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MKN7N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NCCSTCK140N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NCIN87N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NUGC3N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NUGC4N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OCUM1N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86RERFGC1BN002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SH10TCN002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU1N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU216N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU520N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU601N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU620N002N
AKAP12VKVSVAIEESTOMACH1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TGBC11TKBN002N
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.862313287N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86AGSN1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86ECC10N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86ECC12N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86GCIYN1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86GSUN1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HGC27N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS746TN1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HUG1NN1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86IM95N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KATOIIIN1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86LMSUN1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MKN1N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MKN74N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MKN7N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NCCSTCK140N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NCIN87N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NUGC3N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NUGC4N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OCUM1N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86RERFGC1BN1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SH10TCN1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU1N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU216N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU520N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU601N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU620N1500Y
AKAP12VSVAIEEDLSTOMACH1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TGBC11TKBN1500Y
AKAP12DEESGEHTRSTOMACH541p.Q549Rc.1646A>GMissense_Mutation10.112313287Y290N
AKAP12DSEDVSERDSTOMACH111p.K117Ec.348_349CA>TGMissense_Mutation10.11SNU1N000N
AKAP12DVSERDSDKSTOMACH114p.K117Ec.348_349CA>TGMissense_Mutation10.11SNU1N400N
AKAP12EDVSERDSDSTOMACH113p.K117Ec.348_349CA>TGMissense_Mutation10.11SNU1N000N
AKAP12EESGEHTRVSTOMACH542p.Q549Rc.1646A>GMissense_Mutation10.112313287N600N
AKAP12EHTRVPADSSTOMACH546p.Q549Rc.1646A>GMissense_Mutation10.112313287N100N
AKAP12ERDSDKEMASTOMACH117p.K117Ec.348_349CA>TGMissense_Mutation10.11SNU1N100Y
AKAP12ESGEHTRVPSTOMACH543p.Q549Rc.1646A>GMissense_Mutation10.112313287N000N
AKAP12FKKFSTQGWSTOMACH296p.F300Sc.899T>CMissense_Mutation10.11SNU1N408N
AKAP12FSTQGWAGWSTOMACH299p.F300Sc.899T>CMissense_Mutation10.11SNU1Y6100N
AKAP12GEHTRVPADSTOMACH545p.Q549Rc.1646A>GMissense_Mutation10.112313287N000N
AKAP12GSTFKKFSTSTOMACH293p.F300Sc.899T>CMissense_Mutation10.11SNU1N100N
AKAP12HTRVPADSPSTOMACH547p.Q549Rc.1646A>GMissense_Mutation10.112313287N000N
AKAP12KFSTQGWAGSTOMACH298p.F300Sc.899T>CMissense_Mutation10.11SNU1N000N
AKAP12KKFSTQGWASTOMACH297p.F300Sc.899T>CMissense_Mutation10.11SNU1N600N
AKAP12QRDSEDVSESTOMACH109p.K117Ec.348_349CA>TGMissense_Mutation10.11SNU1N100N
AKAP12RDSEDVSERSTOMACH110p.K117Ec.348_349CA>TGMissense_Mutation10.11SNU1N000N
AKAP12RVPADSPDSSTOMACH549p.Q549Rc.1646A>GMissense_Mutation10.112313287N000N
AKAP12SEDVSERDSSTOMACH112p.K117Ec.348_349CA>TGMissense_Mutation10.11SNU1N300N
AKAP12SERDSDKEMSTOMACH116p.K117Ec.348_349CA>TGMissense_Mutation10.11SNU1Y690N
AKAP12SGEHTRVPASTOMACH544p.Q549Rc.1646A>GMissense_Mutation10.112313287N100N
AKAP12STFKKFSTQSTOMACH294p.F300Sc.899T>CMissense_Mutation10.11SNU1N000N
AKAP12STQGWAGWRSTOMACH300p.F300Sc.899T>CMissense_Mutation10.11SNU1N400N
AKAP12TFKKFSTQGSTOMACH295p.F300Sc.899T>CMissense_Mutation10.11SNU1N000N
AKAP12TGSTFKKFSSTOMACH292p.F300Sc.899T>CMissense_Mutation10.11SNU1N000N
AKAP12TRVPADSPDSTOMACH548p.Q549Rc.1646A>GMissense_Mutation10.112313287N100N
AKAP12VSERDSDKESTOMACH115p.K117Ec.348_349CA>TGMissense_Mutation10.11SNU1N000N
AKAP9AVNMMCQHTSTOMACH44p.K37fsc.109_109delAFrame_Shift_Del50.33TGBC11TKBN200N
AKAP9EKRQAVNMMSTOMACH40p.K37fsc.109_109delAFrame_Shift_Del40.33TGBC11TKBN200N
AKAP9KKQKKREKRSTOMACH34p.K37fsc.109_109delAFrame_Shift_Del30.33TGBC11TKBN100N
AKAP9KKREKRQAVSTOMACH37p.K37fsc.109_109delAFrame_Shift_Del40.33TGBC11TKBY3120N
AKAP9KQKKREKRQSTOMACH35p.K37fsc.109_109delAFrame_Shift_Del40.33TGBC11TKBN100N
AKAP9KREKRQAVNSTOMACH38p.K37fsc.109_109delAFrame_Shift_Del40.33TGBC11TKBN200N
AKAP9KRQAVNMMCSTOMACH41p.K37fsc.109_109delAFrame_Shift_Del50.33TGBC11TKBN200N
AKAP9NMMCQHTMISTOMACH46p.K37fsc.109_109delAFrame_Shift_Del60.33TGBC11TKBN800N
AKAP9PSKKQKKRESTOMACH32p.K37fsc.109_109delAFrame_Shift_Del20.33TGBC11TKBN000N
AKAP9QAVNMMCQHSTOMACH43p.K37fsc.109_109delAFrame_Shift_Del50.33TGBC11TKBN000N
AKAP9QKKREKRQASTOMACH36p.K37fsc.109_109delAFrame_Shift_Del40.33TGBC11TKBN200N
AKAP9REKRQAVNMSTOMACH39p.K37fsc.109_109delAFrame_Shift_Del40.33TGBC11TKBY8100N
AKAP9RQAVNMMCQSTOMACH42p.K37fsc.109_109delAFrame_Shift_Del60.33TGBC11TKBN000N
AKAP9SKKQKKREKSTOMACH33p.K37fsc.109_109delAFrame_Shift_Del20.33TGBC11TKBN100N
AKAP9SPSKKQKKRSTOMACH31p.K37fsc.109_109delAFrame_Shift_Del10.33TGBC11TKBN300N
AKAP9VNMMCQHTMSTOMACH45p.K37fsc.109_109delAFrame_Shift_Del50.33TGBC11TKBN3030N
AKAP9DLEKTKQLESTOMACH1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.272313287N000N
AKAP9DLEKTKQLESTOMACH1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27AGSN000N
AKAP9DLEKTKQLESTOMACH1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27GSSN000N
AKAP9DLEKTKQLESTOMACH1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27IM95N000N
AKAP9DLEKTKQLESTOMACH1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MKN1N000N
AKAP9DLEKTKQLESTOMACH1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MKN7N000N
AKAP9DLEKTKQLESTOMACH1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27NCIN87N000N
AKAP9DLEKTKQLESTOMACH1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU719N000N
AKAP9DLEKTKQLESTOMACH1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TGBC11TKBN000N
AKAP9EKTKQLEEQSTOMACH1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.272313287N000N
AKAP9EKTKQLEEQSTOMACH1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27AGSN000N
AKAP9EKTKQLEEQSTOMACH1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27GSSN000N
AKAP9EKTKQLEEQSTOMACH1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27IM95N000N
AKAP9EKTKQLEEQSTOMACH1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MKN1N000N
AKAP9EKTKQLEEQSTOMACH1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MKN7N000N
AKAP9EKTKQLEEQSTOMACH1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27NCIN87N000N
AKAP9EKTKQLEEQSTOMACH1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU719N000N
AKAP9EKTKQLEEQSTOMACH1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TGBC11TKBN000N
AKAP9KQLEEQVQESTOMACH1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.272313287N000N
AKAP9KQLEEQVQESTOMACH1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27AGSN000N
AKAP9KQLEEQVQESTOMACH1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27GSSN000N
AKAP9KQLEEQVQESTOMACH1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27IM95N000N
AKAP9KQLEEQVQESTOMACH1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MKN1N000N
AKAP9KQLEEQVQESTOMACH1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MKN7N000N
AKAP9KQLEEQVQESTOMACH1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27NCIN87N000N
AKAP9KQLEEQVQESTOMACH1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU719N000N
AKAP9KQLEEQVQESTOMACH1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TGBC11TKBN000N
AKAP9KTKQLEEQVSTOMACH1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.272313287N200N
AKAP9KTKQLEEQVSTOMACH1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27AGSN200N
AKAP9KTKQLEEQVSTOMACH1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27GSSN200N
AKAP9KTKQLEEQVSTOMACH1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27IM95N200N
AKAP9KTKQLEEQVSTOMACH1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27MKN1N200N
AKAP9KTKQLEEQVSTOMACH1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27MKN7N200N
AKAP9KTKQLEEQVSTOMACH1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27NCIN87N200N
AKAP9KTKQLEEQVSTOMACH1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SNU719N200N
AKAP9KTKQLEEQVSTOMACH1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27TGBC11TKBN200N
AKAP9LEKTKQLEESTOMACH1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.272313287N000N
AKAP9LEKTKQLEESTOMACH1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27AGSN000N
AKAP9LEKTKQLEESTOMACH1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27GSSN000N
AKAP9LEKTKQLEESTOMACH1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27IM95N000N
AKAP9LEKTKQLEESTOMACH1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MKN1N000N
AKAP9LEKTKQLEESTOMACH1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MKN7N000N
AKAP9LEKTKQLEESTOMACH1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27NCIN87N000N
AKAP9LEKTKQLEESTOMACH1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU719N000N
AKAP9LEKTKQLEESTOMACH1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TGBC11TKBN000N
AKAP9LQDLEKTKQSTOMACH1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.272313287N000N
AKAP9LQDLEKTKQSTOMACH1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27AGSN000N
AKAP9LQDLEKTKQSTOMACH1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27GSSN000N
AKAP9LQDLEKTKQSTOMACH1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27IM95N000N
AKAP9LQDLEKTKQSTOMACH1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MKN1N000N
AKAP9LQDLEKTKQSTOMACH1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MKN7N000N
AKAP9LQDLEKTKQSTOMACH1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27NCIN87N000N
AKAP9LQDLEKTKQSTOMACH1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SNU719N000N
AKAP9LQDLEKTKQSTOMACH1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27TGBC11TKBN000N
AKAP9QDLEKTKQLSTOMACH1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.272313287N900N
AKAP9QDLEKTKQLSTOMACH1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27AGSN900N
AKAP9QDLEKTKQLSTOMACH1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27GSSN900N
AKAP9QDLEKTKQLSTOMACH1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27IM95N900N
AKAP9QDLEKTKQLSTOMACH1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MKN1N900N
AKAP9QDLEKTKQLSTOMACH1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MKN7N900N
AKAP9QDLEKTKQLSTOMACH1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27NCIN87N900N
AKAP9QDLEKTKQLSTOMACH1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU719N900N
AKAP9QDLEKTKQLSTOMACH1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TGBC11TKBN900N
AKAP9QLEEQVQELSTOMACH1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.272313287N1200N
AKAP9QLEEQVQELSTOMACH1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27AGSN1200N
AKAP9QLEEQVQELSTOMACH1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27GSSN1200N
AKAP9QLEEQVQELSTOMACH1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27IM95N1200N
AKAP9QLEEQVQELSTOMACH1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MKN1N1200N
AKAP9QLEEQVQELSTOMACH1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MKN7N1200N
AKAP9QLEEQVQELSTOMACH1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27NCIN87N1200N
AKAP9QLEEQVQELSTOMACH1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SNU719N1200N
AKAP9QLEEQVQELSTOMACH1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27TGBC11TKBN1200N
AKAP9TKQLEEQVQSTOMACH1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.272313287N000N
AKAP9TKQLEEQVQSTOMACH1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27AGSN000N
AKAP9TKQLEEQVQSTOMACH1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27GSSN000N
AKAP9TKQLEEQVQSTOMACH1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27IM95N000N
AKAP9TKQLEEQVQSTOMACH1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MKN1N000N
AKAP9TKQLEEQVQSTOMACH1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MKN7N000N
AKAP9TKQLEEQVQSTOMACH1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27NCIN87N000N
AKAP9TKQLEEQVQSTOMACH1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU719N000N
AKAP9TKQLEEQVQSTOMACH1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TGBC11TKBN000N
AKAP9AAIKQRDGVSTOMACH198p.I206Vc.616A>GMissense_Mutation10.11SNU668N600Y
AKAP9AEAGPLEQQSTOMACH1985p.V1990Lc.5968G>CMissense_Mutation10.11ECC10N200N
AKAP9AELPGHISQSTOMACH3593p.T3596Pc.10786A>CMissense_Mutation10.11SNU719N200N
AKAP9AESFQKALISTOMACH3708p.R3712Qc.11135G>AMissense_Mutation10.11MKN7Y6110N
AKAP9AGPLEQQLLSTOMACH1987p.V1990Lc.5968G>CMissense_Mutation10.11ECC10N1100N
AKAP9AHSLSEQADSTOMACH2374p.E2380Qc.7138G>CMissense_Mutation10.11HGC27N000N
AKAP9AIDRKEKDISTOMACH2197p.E2204Dc.6612G>TMissense_Mutation10.11NUGC3Y2100N
AKAP9AIKQRDGVISTOMACH199p.I206Vc.616A>GMissense_Mutation10.11SNU668N300N
AKAP9AMKAEAGPLSTOMACH1982p.V1990Lc.5968G>CMissense_Mutation10.11ECC10N800N
AKAP9CQTEKVRDDSTOMACH2010p.A2012Tc.6034G>AMissense_Mutation10.11SNU1N000N
AKAP9DAIDRKEKDSTOMACH2196p.E2204Dc.6612G>TMissense_Mutation10.11NUGC3N000N
AKAP9DGVITQLTASTOMACH204p.I206Vc.616A>GMissense_Mutation10.11SNU668N300N
AKAP9DITNLEEQLSTOMACH2204p.E2204Dc.6612G>TMissense_Mutation10.11NUGC3N400N
AKAP9DKPELEVVRSTOMACH2461p.L2469Rc.7406T>GMissense_Mutation10.11NUGC3N100N
AKAP9DRKEKDITNSTOMACH2199p.E2204Dc.6612G>TMissense_Mutation10.11NUGC3N200N
AKAP9EAGPLEQQLSTOMACH1986p.V1990Lc.5968G>CMissense_Mutation10.11ECC10N1300N
AKAP9EFLSIHSQKSTOMACH1303p.M1311Kc.3932T>AMissense_Mutation10.11OCUM1N000N
AKAP9EKDITNLEESTOMACH2202p.E2204Dc.6612G>TMissense_Mutation10.11NUGC3N000N
AKAP9EKEKHAVLDSTOMACH604p.N608Hc.1822A>CMissense_Mutation10.11SNU620N000N
AKAP9EKHAVLDRMSTOMACH606p.N608Hc.1822A>CMissense_Mutation10.11SNU620N300N
AKAP9EKLEVQCQTSTOMACH2004p.A2012Tc.6034G>AMissense_Mutation10.11SNU1N100N
AKAP9ELEVVRTEDSTOMACH2464p.L2469Rc.7406T>GMissense_Mutation10.11NUGC3N000N
AKAP9ELKQEKNTESTOMACH2039p.E2041Kc.6121G>AMissense_Mutation10.11SNU520N000N
AKAP9ELPGHISQLSTOMACH3594p.T3596Pc.10786A>CMissense_Mutation10.11SNU719N1300N
AKAP9EMLEKEKHASTOMACH601p.N608Hc.1822A>CMissense_Mutation10.11SNU620N400N
AKAP9EQADSLKHQSTOMACH2379p.E2380Qc.7138G>CMissense_Mutation10.11HGC27N000N
AKAP9ESFQKALIYSTOMACH3709p.R3712Qc.11135G>AMissense_Mutation10.11MKN7N800N
AKAP9EVQCQTEKVSTOMACH2007p.A2012Tc.6034G>AMissense_Mutation10.11SNU1N200N
AKAP9EVVRTEDALSTOMACH2466p.L2469Rc.7406T>GMissense_Mutation10.11NUGC3Y8110N
AKAP9FIELKQEKNSTOMACH2037p.E2041Kc.6121G>AMissense_Mutation10.11SNU520N200N
AKAP9FLSIHSQKTSTOMACH1304p.M1311Kc.3932T>AMissense_Mutation10.11OCUM1N4011N
AKAP9FQKALIYQKSTOMACH3711p.R3712Qc.11135G>AMissense_Mutation10.11MKN7N705N
AKAP9GPLEQQLLQSTOMACH1988p.V1990Lc.5968G>CMissense_Mutation10.11ECC10N000N
AKAP9GVITQLTANSTOMACH205p.I206Vc.616A>GMissense_Mutation10.11SNU668N000N
AKAP9HAVLDRMAESTOMACH608p.N608Hc.1822A>CMissense_Mutation10.11SNU620N000N
AKAP9HSLSEQADSSTOMACH2375p.E2380Qc.7138G>CMissense_Mutation10.11HGC27N000N
AKAP9HSQKTNLEDSTOMACH1308p.M1311Kc.3932T>AMissense_Mutation10.11OCUM1N000N
AKAP9IDRKEKDITSTOMACH2198p.E2204Dc.6612G>TMissense_Mutation10.11NUGC3N100N
AKAP9IELKQEKNTSTOMACH2038p.E2041Kc.6121G>AMissense_Mutation10.11SNU520N500N
AKAP9IHSQKTNLESTOMACH1307p.M1311Kc.3932T>AMissense_Mutation10.11OCUM1N008N
AKAP9IKQRDGVITSTOMACH200p.I206Vc.616A>GMissense_Mutation10.11SNU668N100N
AKAP9KAEAGPLEQSTOMACH1984p.V1990Lc.5968G>CMissense_Mutation10.11ECC10N100N
AKAP9KDITNLEEQSTOMACH2203p.E2204Dc.6612G>TMissense_Mutation10.11NUGC3N000N
AKAP9KEKDITNLESTOMACH2201p.E2204Dc.6612G>TMissense_Mutation10.11NUGC3N000N
AKAP9KEKHAVLDRSTOMACH605p.N608Hc.1822A>CMissense_Mutation10.11SNU620N300N
AKAP9KHAVLDRMASTOMACH607p.N608Hc.1822A>CMissense_Mutation10.11SNU620N200N
AKAP9KLEVQCQTESTOMACH2005p.A2012Tc.6034G>AMissense_Mutation10.11SNU1N000N
AKAP9KPELEVVRTSTOMACH2462p.L2469Rc.7406T>GMissense_Mutation10.11NUGC3N300N
AKAP9KQEKNTELMSTOMACH2041p.E2041Kc.6121G>AMissense_Mutation10.11SNU520N500N
AKAP9KQRDGVITQSTOMACH201p.I206Vc.616A>GMissense_Mutation10.11SNU668N100Y
AKAP9KTNLEDIDVSTOMACH1311p.M1311Kc.3932T>AMissense_Mutation10.11OCUM1N400N
AKAP9KYLRAESFQSTOMACH3704p.R3712Qc.11135G>AMissense_Mutation10.11MKN7N000N
AKAP9LEKEKHAVLSTOMACH603p.N608Hc.1822A>CMissense_Mutation10.11SNU620N1100N
AKAP9LEMLEKEKHSTOMACH600p.N608Hc.1822A>CMissense_Mutation10.11SNU620N0015N
AKAP9LEQQLLQETSTOMACH1990p.V1990Lc.5968G>CMissense_Mutation10.11ECC10N500N
AKAP9LEVQCQTEKSTOMACH2006p.A2012Tc.6034G>AMissense_Mutation10.11SNU1N200N
AKAP9LEVVRTEDASTOMACH2465p.L2469Rc.7406T>GMissense_Mutation10.11NUGC3N603N
AKAP9LKQEKNTELSTOMACH2040p.E2041Kc.6121G>AMissense_Mutation10.11SNU520N703N
AKAP9LLRQNAELPSTOMACH3588p.T3596Pc.10786A>CMissense_Mutation10.11SNU719N000N
AKAP9LPGHISQLTSTOMACH3595p.T3596Pc.10786A>CMissense_Mutation10.11SNU719N501N
AKAP9LRAESFQKASTOMACH3706p.R3712Qc.11135G>AMissense_Mutation10.11MKN7N302N
AKAP9LRQNAELPGSTOMACH3589p.T3596Pc.10786A>CMissense_Mutation10.11SNU719N100Y
AKAP9LSEQADSLKSTOMACH2377p.E2380Qc.7138G>CMissense_Mutation10.11HGC27N200N
AKAP9LSIHSQKTNSTOMACH1305p.M1311Kc.3932T>AMissense_Mutation10.11OCUM1N001N
AKAP9MKAEAGPLESTOMACH1983p.V1990Lc.5968G>CMissense_Mutation10.11ECC10N000N
AKAP9MLEKEKHAVSTOMACH602p.N608Hc.1822A>CMissense_Mutation10.11SNU620N301N
AKAP9MNAHSLSEQSTOMACH2372p.E2380Qc.7138G>CMissense_Mutation10.11HGC27N004N
AKAP9NAELPGHISSTOMACH3592p.T3596Pc.10786A>CMissense_Mutation10.11SNU719N200N
AKAP9NAHSLSEQASTOMACH2373p.E2380Qc.7138G>CMissense_Mutation10.11HGC27N300N
AKAP9PELEVVRTESTOMACH2463p.L2469Rc.7406T>GMissense_Mutation10.11NUGC3N000N
AKAP9PGHISQLTESTOMACH3596p.T3596Pc.10786A>CMissense_Mutation10.11SNU719N000N
AKAP9PLEQQLLQESTOMACH1989p.V1990Lc.5968G>CMissense_Mutation10.11ECC10N000Y
AKAP9QADSLKHQLSTOMACH2380p.E2380Qc.7138G>CMissense_Mutation10.11HGC27Y10100N
AKAP9QCQTEKVRDSTOMACH2009p.A2012Tc.6034G>AMissense_Mutation10.11SNU1N000N
AKAP9QKALIYQKKSTOMACH3712p.R3712Qc.11135G>AMissense_Mutation10.11MKN7N100N
AKAP9QKTNLEDIDSTOMACH1310p.M1311Kc.3932T>AMissense_Mutation10.11OCUM1N000N
AKAP9QNAELPGHISTOMACH3591p.T3596Pc.10786A>CMissense_Mutation10.11SNU719N100N
AKAP9QRDGVITQLSTOMACH202p.I206Vc.616A>GMissense_Mutation10.11SNU668Y7100Y
AKAP9QTEKVRDDLSTOMACH2011p.A2012Tc.6034G>AMissense_Mutation10.11SNU1N600N
AKAP9QVSRFIELKSTOMACH2033p.E2041Kc.6121G>AMissense_Mutation10.11SNU520Y4100N
AKAP9RAESFQKALSTOMACH3707p.R3712Qc.11135G>AMissense_Mutation10.11MKN7N1300N
AKAP9RDGVITQLTSTOMACH203p.I206Vc.616A>GMissense_Mutation10.11SNU668N100N
AKAP9RFIELKQEKSTOMACH2036p.E2041Kc.6121G>AMissense_Mutation10.11SNU520N200N
AKAP9RKEKDITNLSTOMACH2200p.E2204Dc.6612G>TMissense_Mutation10.11NUGC3N400N
AKAP9RQNAELPGHSTOMACH3590p.T3596Pc.10786A>CMissense_Mutation10.11SNU719N200N
AKAP9RTEDALKSLSTOMACH2469p.L2469Rc.7406T>GMissense_Mutation10.11NUGC3Y9110N
AKAP9SEQADSLKHSTOMACH2378p.E2380Qc.7138G>CMissense_Mutation10.11HGC27N000N
AKAP9SFQKALIYQSTOMACH3710p.R3712Qc.11135G>AMissense_Mutation10.11MKN7N000N
AKAP9SIHSQKTNLSTOMACH1306p.M1311Kc.3932T>AMissense_Mutation10.11OCUM1N600N
AKAP9SLSEQADSLSTOMACH2376p.E2380Qc.7138G>CMissense_Mutation10.11HGC27Y14100N
AKAP9SQKTNLEDISTOMACH1309p.M1311Kc.3932T>AMissense_Mutation10.11OCUM1N700N
AKAP9SRFIELKQESTOMACH2035p.E2041Kc.6121G>AMissense_Mutation10.11SNU520N200N
AKAP9TEKVRDDLQSTOMACH2012p.A2012Tc.6034G>AMissense_Mutation10.11SNU1N000N
AKAP9VITQLTANLSTOMACH206p.I206Vc.616A>GMissense_Mutation10.11SNU668N807N
AKAP9VQCQTEKVRSTOMACH2008p.A2012Tc.6034G>AMissense_Mutation10.11SNU1N400N
AKAP9VRTEDALKSSTOMACH2468p.L2469Rc.7406T>GMissense_Mutation10.11NUGC3N2024N
AKAP9VSRFIELKQSTOMACH2034p.E2041Kc.6121G>AMissense_Mutation10.11SNU520N000N
AKAP9VVRTEDALKSTOMACH2467p.L2469Rc.7406T>GMissense_Mutation10.11NUGC3N302N
AKAP9YLRAESFQKSTOMACH3705p.R3712Qc.11135G>AMissense_Mutation10.11MKN7N707N
ALKENNSVLGLNSTOMACH862p.865_866SS>Sc.2595_2597delCTCIn_Frame_Del20.11HUG1NN000N
ALKERLENNSVLSTOMACH859p.865_866SS>Sc.2595_2597delCTCIn_Frame_Del20.11HUG1NN700N
ALKLENNSVLGLSTOMACH861p.865_866SS>Sc.2595_2597delCTCIn_Frame_Del30.11HUG1NN1009N
ALKNNSVLGLNGSTOMACH863p.865_866SS>Sc.2595_2597delCTCIn_Frame_Del10.11HUG1NN000N
ALKNSVLGLNGNSTOMACH864p.865_866SS>Sc.2595_2597delCTCIn_Frame_Del10.11HUG1NN000N
ALKPERLENNSVSTOMACH858p.865_866SS>Sc.2595_2597delCTCIn_Frame_Del10.11HUG1NN200N
ALKRLENNSVLGSTOMACH860p.865_866SS>Sc.2595_2597delCTCIn_Frame_Del30.11HUG1NN100N
ALKCPDNPFRVASTOMACH395p.R395Cc.1183C>TMissense_Mutation10.11SNU1N800N
ALKGCPDNPFRVSTOMACH394p.R395Cc.1183C>TMissense_Mutation10.11SNU1Y490N
ALKGRIGCPDNPSTOMACH391p.R395Cc.1183C>TMissense_Mutation10.11SNU1N100N
ALKIGCPDNPFRSTOMACH393p.R395Cc.1183C>TMissense_Mutation10.11SNU1N100N
ALKLQGRIGCPDSTOMACH389p.R395Cc.1183C>TMissense_Mutation10.11SNU1N003N
ALKQGRIGCPDNSTOMACH390p.R395Cc.1183C>TMissense_Mutation10.11SNU1N000N
ALKRIGCPDNPFSTOMACH392p.R395Cc.1183C>TMissense_Mutation10.11SNU1N600N
ALKTVLQGRIGCSTOMACH387p.R395Cc.1183C>TMissense_Mutation10.11SNU1N200N
ALKVLQGRIGCPSTOMACH388p.R395Cc.1183C>TMissense_Mutation10.11SNU1N000N
ALKGGKNTMMQSSTOMACH746p.R753Qc.2258G>AMissense_Mutation10.33SNU520N000N
ALKGKNTMMQSHSTOMACH747p.R753Qc.2258G>AMissense_Mutation10.33SNU520N100N
ALKKGGKNTMMQSTOMACH745p.R753Qc.2258G>AMissense_Mutation10.33SNU520N000N
ALKKNTMMQSHGSTOMACH748p.R753Qc.2258G>AMissense_Mutation10.33SNU520N000N
ALKMMQSHGVSVSTOMACH751p.R753Qc.2258G>AMissense_Mutation10.33SNU520N603N
ALKMQSHGVSVLSTOMACH752p.R753Qc.2258G>AMissense_Mutation10.33SNU520Y121112N
ALKNTMMQSHGVSTOMACH749p.R753Qc.2258G>AMissense_Mutation10.33SNU520N300N
ALKQSHGVSVLGSTOMACH753p.R753Qc.2258G>AMissense_Mutation10.33SNU520N000N
ALKTMMQSHGVSSTOMACH750p.R753Qc.2258G>AMissense_Mutation10.33SNU520N000N
ALPK2AFKKFLTCPSTOMACH1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27AGSN000N
ALPK2DHTAFKKFLSTOMACH1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27AGSN600N
ALPK2HTAFKKFLTSTOMACH1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27AGSN100N
ALPK2KMDHTAFKKSTOMACH1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27AGSN600N
ALPK2LKMDHTAFKSTOMACH1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27AGSN1017N
ALPK2MDHTAFKKFSTOMACH1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27AGSN600N
ALPK2TAFKKFLTCSTOMACH1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27AGSN600N
ALPK2ATRETVTIASTOMACH1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.742313287Y1140N
ALPK2ATRETVTIASTOMACH1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74ECC12Y1140N
ALPK2ATRETVTIASTOMACH1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74FU97Y1140N
ALPK2ATRETVTIASTOMACH1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74GSUY1140N
ALPK2ATRETVTIASTOMACH1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HGC27Y1140N
ALPK2ATRETVTIASTOMACH1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74MKN1Y1140N
ALPK2ATRETVTIASTOMACH1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74MKN74Y1140N
ALPK2ATRETVTIASTOMACH1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74NCIN87Y1140N
ALPK2ATRETVTIASTOMACH1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74RERFGC1BY1140N
ALPK2ATRETVTIASTOMACH1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SNU1Y1140N
ALPK2ATRETVTIASTOMACH1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SNU601Y1140N
ALPK2CFQATRETVSTOMACH998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.742313287Y2110N
ALPK2CFQATRETVSTOMACH998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74ECC12Y2110N
ALPK2CFQATRETVSTOMACH998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74FU97Y2110N
ALPK2CFQATRETVSTOMACH998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74GSUY2110N
ALPK2CFQATRETVSTOMACH998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HGC27Y2110N
ALPK2CFQATRETVSTOMACH998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MKN1Y2110N
ALPK2CFQATRETVSTOMACH998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MKN74Y2110N
ALPK2CFQATRETVSTOMACH998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74NCIN87Y2110N
ALPK2CFQATRETVSTOMACH998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74RERFGC1BY2110N
ALPK2CFQATRETVSTOMACH998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SNU1Y2110N
ALPK2CFQATRETVSTOMACH998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SNU601Y2110N
ALPK2ETVTIATEVSTOMACH1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.742313287N400N
ALPK2ETVTIATEVSTOMACH1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74ECC12N400N
ALPK2ETVTIATEVSTOMACH1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74FU97N400N
ALPK2ETVTIATEVSTOMACH1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74GSUN400N
ALPK2ETVTIATEVSTOMACH1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HGC27N400N
ALPK2ETVTIATEVSTOMACH1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MKN1N400N
ALPK2ETVTIATEVSTOMACH1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MKN74N400N
ALPK2ETVTIATEVSTOMACH1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74NCIN87N400N
ALPK2ETVTIATEVSTOMACH1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74RERFGC1BN400N
ALPK2ETVTIATEVSTOMACH1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SNU1N400N
ALPK2ETVTIATEVSTOMACH1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SNU601N400N
ALPK2FQATRETVTSTOMACH999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.742313287N600N
ALPK2FQATRETVTSTOMACH999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74ECC12N600N
ALPK2FQATRETVTSTOMACH999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74FU97N600N
ALPK2FQATRETVTSTOMACH999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74GSUN600N
ALPK2FQATRETVTSTOMACH999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HGC27N600N
ALPK2FQATRETVTSTOMACH999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MKN1N600N
ALPK2FQATRETVTSTOMACH999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MKN74N600N
ALPK2FQATRETVTSTOMACH999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74NCIN87N600N
ALPK2FQATRETVTSTOMACH999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74RERFGC1BN600N
ALPK2FQATRETVTSTOMACH999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SNU1N600N
ALPK2FQATRETVTSTOMACH999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SNU601N600N
ALPK2QATRETVTISTOMACH1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.742313287N600N
ALPK2QATRETVTISTOMACH1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74ECC12N600N
ALPK2QATRETVTISTOMACH1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74FU97N600N
ALPK2QATRETVTISTOMACH1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74GSUN600N
ALPK2QATRETVTISTOMACH1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HGC27N600N
ALPK2QATRETVTISTOMACH1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MKN1N600N
ALPK2QATRETVTISTOMACH1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MKN74N600N
ALPK2QATRETVTISTOMACH1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74NCIN87N600N
ALPK2QATRETVTISTOMACH1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74RERFGC1BN600N
ALPK2QATRETVTISTOMACH1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SNU1N600N
ALPK2QATRETVTISTOMACH1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SNU601N600N
ALPK2RETVTIATESTOMACH1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.742313287N100N
ALPK2RETVTIATESTOMACH1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74ECC12N100N
ALPK2RETVTIATESTOMACH1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74FU97N100N
ALPK2RETVTIATESTOMACH1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74GSUN100N
ALPK2RETVTIATESTOMACH1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HGC27N100N
ALPK2RETVTIATESTOMACH1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MKN1N100N
ALPK2RETVTIATESTOMACH1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MKN74N100N
ALPK2RETVTIATESTOMACH1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74NCIN87N100N
ALPK2RETVTIATESTOMACH1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74RERFGC1BN100N
ALPK2RETVTIATESTOMACH1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SNU1N100N
ALPK2RETVTIATESTOMACH1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SNU601N100N
ALPK2TRETVTIATSTOMACH1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.742313287N200N
ALPK2TRETVTIATSTOMACH1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74ECC12N200N
ALPK2TRETVTIATSTOMACH1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74FU97N200N
ALPK2TRETVTIATSTOMACH1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74GSUN200N
ALPK2TRETVTIATSTOMACH1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HGC27N200N
ALPK2TRETVTIATSTOMACH1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MKN1N200N
ALPK2TRETVTIATSTOMACH1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MKN74N200N
ALPK2TRETVTIATSTOMACH1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74NCIN87N200N
ALPK2TRETVTIATSTOMACH1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74RERFGC1BN200N
ALPK2TRETVTIATSTOMACH1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SNU1N200N
ALPK2TRETVTIATSTOMACH1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SNU601N200N
ALPK2AHIYPGDSGSTOMACH281p.A289Gc.866C>GMissense_Mutation10.112313287N000N
ALPK2AKIYTAEAQSTOMACH1992p.A1996Tc.5986G>AMissense_Mutation10.112313287N000N
ALPK2ARYYAKIYTSTOMACH1988p.A1996Tc.5986G>AMissense_Mutation10.112313287N300Y
ALPK2DSGVANKQPSTOMACH287p.A289Gc.866C>GMissense_Mutation10.112313287N000N
ALPK2GDSGVANKQSTOMACH286p.A289Gc.866C>GMissense_Mutation10.112313287N000N
ALPK2GVANKQPSPSTOMACH289p.A289Gc.866C>GMissense_Mutation10.112313287N000N
ALPK2HIYPGDSGVSTOMACH282p.A289Gc.866C>GMissense_Mutation10.112313287Y6110N
ALPK2IYPGDSGVASTOMACH283p.A289Gc.866C>GMissense_Mutation10.112313287N300N
ALPK2IYTAEAQPLSTOMACH1994p.A1996Tc.5986G>AMissense_Mutation10.112313287N604N
ALPK2KIYTAEAQPSTOMACH1993p.A1996Tc.5986G>AMissense_Mutation10.112313287N000N
ALPK2PGDSGVANKSTOMACH285p.A289Gc.866C>GMissense_Mutation10.112313287N000N
ALPK2RYYAKIYTASTOMACH1989p.A1996Tc.5986G>AMissense_Mutation10.112313287Y590N
ALPK2SGVANKQPSSTOMACH288p.A289Gc.866C>GMissense_Mutation10.112313287N200N
ALPK2TAEAQPLEGSTOMACH1996p.A1996Tc.5986G>AMissense_Mutation10.112313287N100N
ALPK2YAKIYTAEASTOMACH1991p.A1996Tc.5986G>AMissense_Mutation10.112313287N6010N
ALPK2YPGDSGVANSTOMACH284p.A289Gc.866C>GMissense_Mutation10.112313287N700N
ALPK2YTAEAQPLESTOMACH1995p.A1996Tc.5986G>AMissense_Mutation10.112313287N200N
ALPK2YYAKIYTAESTOMACH1990p.A1996Tc.5986G>AMissense_Mutation10.112313287N200N
ATMDLRITQQKSSTOMACH1573p.Q1579fsc.4736_4736delAFrame_Shift_Del10.11SNU520N000N
ATMDPFHSWRKLSTOMACH1586p.Q1579fsc.4736_4736delAFrame_Shift_Del40.11SNU520Y1890N
ATMEDPFHSWRKSTOMACH1585p.Q1579fsc.4736_4736delAFrame_Shift_Del50.11SNU520N000N
ATMFHSWRKLTISTOMACH1588p.Q1579fsc.4736_4736delAFrame_Shift_Del40.11SNU520N6025N
ATMHSWRKLTIFSTOMACH1589p.Q1579fsc.4736_4736delAFrame_Shift_Del40.11SNU520N900N
ATMITQQKSNTVSTOMACH1576p.Q1579fsc.4736_4736delAFrame_Shift_Del40.11SNU520N500N
ATMKSNTVEDPFSTOMACH1580p.Q1579fsc.4736_4736delAFrame_Shift_Del60.11SNU520N700N
ATMLRITQQKSNSTOMACH1574p.Q1579fsc.4736_4736delAFrame_Shift_Del20.11SNU520N204N
ATMNTVEDPFHSSTOMACH1582p.Q1579fsc.4736_4736delAFrame_Shift_Del60.11SNU520N000N
ATMPFHSWRKLTSTOMACH1587p.Q1579fsc.4736_4736delAFrame_Shift_Del50.11SNU520N000N
ATMQKSNTVEDPSTOMACH1579p.Q1579fsc.4736_4736delAFrame_Shift_Del50.11SNU520N000N
ATMQQKSNTVEDSTOMACH1578p.Q1579fsc.4736_4736delAFrame_Shift_Del50.11SNU520N100N
ATMRITQQKSNTSTOMACH1575p.Q1579fsc.4736_4736delAFrame_Shift_Del30.11SNU520N000N
ATMSNTVEDPFHSTOMACH1581p.Q1579fsc.4736_4736delAFrame_Shift_Del60.11SNU520N000N
ATMSWRKLTIFSSTOMACH1590p.Q1579fsc.4736_4736delAFrame_Shift_Del40.11SNU520N000N
ATMTQQKSNTVESTOMACH1577p.Q1579fsc.4736_4736delAFrame_Shift_Del50.11SNU520N000N
ATMTVEDPFHSWSTOMACH1583p.Q1579fsc.4736_4736delAFrame_Shift_Del60.11SNU520N200N
ATMVEDPFHSWRSTOMACH1584p.Q1579fsc.4736_4736delAFrame_Shift_Del50.11SNU520N100N
ATMWRKLTIFSQSTOMACH1591p.Q1579fsc.4736_4736delAFrame_Shift_Del40.11SNU520N3037N
ATMDVDSCGFILSTOMACH1156p.V1153fsc.3457_3458insTFrame_Shift_Ins40.11SNU1N800N
ATMEIYNRKSVFSTOMACH1146p.V1153fsc.3457_3458insTFrame_Shift_Ins10.11SNU1N500N
ATMFTDVDSCGFSTOMACH1154p.V1153fsc.3457_3458insTFrame_Shift_Ins50.11SNU1N600N
ATMIYNRKSVFTSTOMACH1147p.V1153fsc.3457_3458insTFrame_Shift_Ins20.11SNU1N201N
ATMKSVFTDVDSSTOMACH1151p.V1153fsc.3457_3458insTFrame_Shift_Ins50.11SNU1N100N
ATMNRKSVFTDVSTOMACH1149p.V1153fsc.3457_3458insTFrame_Shift_Ins40.11SNU1Y390N
ATMRKSVFTDVDSTOMACH1150p.V1153fsc.3457_3458insTFrame_Shift_Ins50.11SNU1N000N
ATMSVFTDVDSCSTOMACH1152p.V1153fsc.3457_3458insTFrame_Shift_Ins50.11SNU1N100N
ATMTDVDSCGFISTOMACH1155p.V1153fsc.3457_3458insTFrame_Shift_Ins50.11SNU1N500N
ATMVFTDVDSCGSTOMACH1153p.V1153fsc.3457_3458insTFrame_Shift_Ins50.11SNU1N000N
ATMYNRKSVFTDSTOMACH1148p.V1153fsc.3457_3458insTFrame_Shift_Ins30.11SNU1N2011N
ATMARRIRITKNSTOMACH2578p.S2581Ic.7742G>TMissense_Mutation10.11KATOIIIN200N
ATMEIVVELLMMSTOMACH1342p.T1350Mc.4049C>TMissense_Mutation10.11TGBC11TKBN300N
ATMELLMMLHEPSTOMACH1346p.T1350Mc.4049C>TMissense_Mutation10.11TGBC11TKBN000N
ATMEVARRIRITSTOMACH2576p.S2581Ic.7742G>TMissense_Mutation10.11KATOIIIN300N
ATMGINISADQPSTOMACH2644p.P2648Sc.7942C>TMissense_Mutation10.11HGC27N000N
ATMINISADQPISTOMACH2645p.P2648Sc.7942C>TMissense_Mutation10.11HGC27N702N
ATMIRITKNVPKSTOMACH2581p.S2581Ic.7742G>TMissense_Mutation10.11KATOIIIN2012N
ATMISADQPITKSTOMACH2647p.P2648Sc.7942C>TMissense_Mutation10.11HGC27Y2105N
ATMIVVELLMMLSTOMACH1343p.T1350Mc.4049C>TMissense_Mutation10.11TGBC11TKBY1999N
ATMKGINISADQSTOMACH2643p.P2648Sc.7942C>TMissense_Mutation10.11HGC27N000N
ATMKPEVARRIRSTOMACH2574p.S2581Ic.7742G>TMissense_Mutation10.11KATOIIIY4100N
ATMLLMMLHEPASTOMACH1347p.T1350Mc.4049C>TMissense_Mutation10.11TGBC11TKBN5014N
ATMLMMLHEPANSTOMACH1348p.T1350Mc.4049C>TMissense_Mutation10.11TGBC11TKBN000N
ATMMLHEPANSSSTOMACH1350p.T1350Mc.4049C>TMissense_Mutation10.11TGBC11TKBN003N
ATMMMLHEPANSSTOMACH1349p.T1350Mc.4049C>TMissense_Mutation10.11TGBC11TKBN0033N
ATMNISADQPITSTOMACH2646p.P2648Sc.7942C>TMissense_Mutation10.11HGC27N000N
ATMPEVARRIRISTOMACH2575p.S2581Ic.7742G>TMissense_Mutation10.11KATOIIIY3110N
ATMQRKGINISASTOMACH2641p.P2648Sc.7942C>TMissense_Mutation10.11HGC27N200N
ATMRIRITKNVPSTOMACH2580p.S2581Ic.7742G>TMissense_Mutation10.11KATOIIIN100N
ATMRKGINISADSTOMACH2642p.P2648Sc.7942C>TMissense_Mutation10.11HGC27N100N
ATMRRIRITKNVSTOMACH2579p.S2581Ic.7742G>TMissense_Mutation10.11KATOIIIN500N
ATMSADQPITKLSTOMACH2648p.P2648Sc.7942C>TMissense_Mutation10.11HGC27Y1190N
ATMTKPEVARRISTOMACH2573p.S2581Ic.7742G>TMissense_Mutation10.11KATOIIIY4110N
ATMTQRKGINISSTOMACH2640p.P2648Sc.7942C>TMissense_Mutation10.11HGC27N100N
ATMVARRIRITKSTOMACH2577p.S2581Ic.7742G>TMissense_Mutation10.11KATOIIIY2124N
ATMVELLMMLHESTOMACH1345p.T1350Mc.4049C>TMissense_Mutation10.11TGBC11TKBN002N
ATMVVELLMMLHSTOMACH1344p.T1350Mc.4049C>TMissense_Mutation10.11TGBC11TKBN106N
ATMDSSRLEPTKSTOMACH932p.T935Rc.2804C>GMissense_Mutation10.44TGBC11TKBN200N
ATMIDSSRLEPTSTOMACH931p.T935Rc.2804C>GMissense_Mutation10.44TGBC11TKBN100N
ATMLIDSSRLEPSTOMACH930p.T935Rc.2804C>GMissense_Mutation10.44TGBC11TKBN000N
ATMLLMLIDSSRSTOMACH927p.T935Rc.2804C>GMissense_Mutation10.44TGBC11TKBN604N
ATMLMLIDSSRLSTOMACH928p.T935Rc.2804C>GMissense_Mutation10.44TGBC11TKBN15016N
ATMMLIDSSRLESTOMACH929p.T935Rc.2804C>GMissense_Mutation10.44TGBC11TKBN006N
ATMRLEPTKSLHSTOMACH935p.T935Rc.2804C>GMissense_Mutation10.44TGBC11TKBN100N
ATMSRLEPTKSLSTOMACH934p.T935Rc.2804C>GMissense_Mutation10.44TGBC11TKBN700N
ATMSSRLEPTKSSTOMACH933p.T935Rc.2804C>GMissense_Mutation10.44TGBC11TKBN100N
BRAFGGSTTGLSVSTOMACH392p.A400Vc.1199C>TMissense_Mutation10.11SNU1N700N
BRAFGLSVTPPASSTOMACH397p.A400Vc.1199C>TMissense_Mutation10.11SNU1N000N
BRAFGSTTGLSVTSTOMACH393p.A400Vc.1199C>TMissense_Mutation10.11SNU1N100N
BRAFLSVTPPASLSTOMACH398p.A400Vc.1199C>TMissense_Mutation10.11SNU1N1500N
BRAFSTTGLSVTPSTOMACH394p.A400Vc.1199C>TMissense_Mutation10.11SNU1N000N
BRAFSVTPPASLPSTOMACH399p.A400Vc.1199C>TMissense_Mutation10.11SNU1N000N
BRAFTGLSVTPPASTOMACH396p.A400Vc.1199C>TMissense_Mutation10.11SNU1N100N
BRAFTTGLSVTPPSTOMACH395p.A400Vc.1199C>TMissense_Mutation10.11SNU1N000N
BRAFVTPPASLPGSTOMACH400p.A400Vc.1199C>TMissense_Mutation10.11SNU1N100N
CARD10DVRGLLGRPSTOMACH953p.E953Dc.2859A>CMissense_Mutation10.11GSUN000N
CARD10EKNVRDVRGSTOMACH948p.E953Dc.2859A>CMissense_Mutation10.11GSUN000N
CARD10EVTEKNVRDSTOMACH945p.E953Dc.2859A>CMissense_Mutation10.11GSUN000N
CARD10KNVRDVRGLSTOMACH949p.E953Dc.2859A>CMissense_Mutation10.11GSUN1300N
CARD10NVRDVRGLLSTOMACH950p.E953Dc.2859A>CMissense_Mutation10.11GSUN700N
CARD10RDVRGLLGRSTOMACH952p.E953Dc.2859A>CMissense_Mutation10.11GSUN100N
CARD10TEKNVRDVRSTOMACH947p.E953Dc.2859A>CMissense_Mutation10.11GSUN000N
CARD10VRDVRGLLGSTOMACH951p.E953Dc.2859A>CMissense_Mutation10.11GSUN100N
CARD10VTEKNVRDVSTOMACH946p.E953Dc.2859A>CMissense_Mutation10.11GSUN200N
CBLAGGGSGSGASTOMACH11p.G18fsc.52_52delGFrame_Shift_Del10.112313287N000Y
CBLGGGSGSGARSTOMACH12p.G18fsc.52_52delGFrame_Shift_Del20.112313287N100Y
CBLGGSGSGARVSTOMACH13p.G18fsc.52_52delGFrame_Shift_Del30.112313287N600Y
CBLGSGARVRVASTOMACH16p.G18fsc.52_52delGFrame_Shift_Del50.112313287Y1110N
CBLGSGSGARVRSTOMACH14p.G18fsc.52_52delGFrame_Shift_Del40.112313287Y390N
CBLSGSGARVRVSTOMACH15p.G18fsc.52_52delGFrame_Shift_Del50.112313287Y4100N
CBLDISTASSSFSTOMACH792p.N795Tc.2384A>CMissense_Mutation10.11SNU719N200Y
CBLISTASSSFGSTOMACH793p.N795Tc.2384A>CMissense_Mutation10.11SNU719N000Y
CBLLSDISTASSSTOMACH790p.N795Tc.2384A>CMissense_Mutation10.11SNU719N102N
CBLRRTLSDISTSTOMACH787p.N795Tc.2384A>CMissense_Mutation10.11SNU719N200N
CBLRTLSDISTASTOMACH788p.N795Tc.2384A>CMissense_Mutation10.11SNU719Y3100N
CBLSDISTASSSSTOMACH791p.N795Tc.2384A>CMissense_Mutation10.11SNU719N300Y
CBLSTASSSFGWSTOMACH794p.N795Tc.2384A>CMissense_Mutation10.11SNU719N200N
CBLTASSSFGWLSTOMACH795p.N795Tc.2384A>CMissense_Mutation10.11SNU719N1200N
CBLTLSDISTASSTOMACH789p.N795Tc.2384A>CMissense_Mutation10.11SNU719N000N
CDH1GHHHRPRPISTOMACH120p.R124fsc.372_372delCFrame_Shift_Del20.22IM95N500N
CDH1HHHRPRPIRSTOMACH121p.R124fsc.372_372delCFrame_Shift_Del30.22IM95Y290N
CDH1HHRPRPIRPSTOMACH122p.R124fsc.372_372delCFrame_Shift_Del40.22IM95N100N
CDH1HRPRPIRPPSTOMACH123p.R124fsc.372_372delCFrame_Shift_Del50.22IM95N100N
CDH1RPRPIRPPFSTOMACH124p.R124fsc.372_372delCFrame_Shift_Del50.22IM95Y14120N
CDH1TVGHHHRPRSTOMACH118p.R124fsc.372_372delCFrame_Shift_Del10.22IM95Y390N
CDH1VGHHHRPRPSTOMACH119p.R124fsc.372_372delCFrame_Shift_Del10.22IM95N000N
CDH1AAQKMKKAHSTOMACH162p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N000N
CDH1AHFLKTWFRSTOMACH169p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N200N
CDH1AKELTHPLLSTOMACH194p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N400N
CDH1AQKMKKAHFSTOMACH163p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N700N
CDH1ARFSTASLASTOMACH186p.R124fsc.372_372delCFrame_Shift_Del60.33IM95Y590N
CDH1ASEDRRETGSTOMACH148p.R124fsc.372_372delCFrame_Shift_Del50.33IM95Y1110N
CDH1ASLAKELTHSTOMACH191p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N000N
CDH1CSHFPTPLLSTOMACH139p.R124fsc.372_372delCFrame_Shift_Del50.33IM95Y11100N
CDH1DRRETGLFLSTOMACH151p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N700N
CDH1EDRRETGLFSTOMACH150p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N200N
CDH1ELTHPLLVSSTOMACH196p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N000N
CDH1ESKQNCSHFSTOMACH134p.R124fsc.372_372delCFrame_Shift_Del60.33IM95Y490N
CDH1ETGLFLPSASTOMACH154p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N200N
CDH1FLESKQNCSSTOMACH132p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N400N
CDH1FLKTWFRSNSTOMACH171p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N300N
CDH1FLPSAAQKMSTOMACH158p.R124fsc.372_372delCFrame_Shift_Del60.33IM95Y1198N
CDH1FPTPLLASESTOMACH142p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N300N
CDH1FRSNPTKTKSTOMACH176p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N4020N
CDH1FSTASLAKESTOMACH188p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N100N
CDH1GLFLPSAAQSTOMACH156p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N200N
CDH1HFLKTWFRSSTOMACH170p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N000N
CDH1HFPTPLLASSTOMACH141p.R124fsc.372_372delCFrame_Shift_Del40.33IM95N000N
CDH1HPLLVSLLLSTOMACH199p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N2100N
CDH1IRPPFLESKSTOMACH128p.R124fsc.372_372delCFrame_Shift_Del60.33IM95Y2100N
CDH1KAHFLKTWFSTOMACH168p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N700N
CDH1KARFSTASLSTOMACH185p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N1200N
CDH1KELTHPLLVSTOMACH195p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N1200N
CDH1KKAHFLKTWSTOMACH167p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N300N
CDH1KKARFSTASSTOMACH184p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N100N
CDH1KMKKAHFLKSTOMACH165p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N600N
CDH1KQNCSHFPTSTOMACH136p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N600N
CDH1KTKKARFSTSTOMACH182p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N200N
CDH1KTWFRSNPTSTOMACH173p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N300N
CDH1LAKELTHPLSTOMACH193p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N1101N
CDH1LASEDRRETSTOMACH147p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N300N
CDH1LESKQNCSHSTOMACH133p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N004N
CDH1LFLPSAAQKSTOMACH157p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N100Y
CDH1LKTWFRSNPSTOMACH172p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N000N
CDH1LLASEDRRESTOMACH146p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N000N
CDH1LLLKEKQDGSTOMACH205p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N0017N
CDH1LLVSLLLKESTOMACH201p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N102N
CDH1LPSAAQKMKSTOMACH159p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N200N
CDH1LTHPLLVSLSTOMACH197p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N1100N
CDH1LVSLLLKEKSTOMACH202p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N2019N
CDH1MKKAHFLKTSTOMACH166p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N100N
CDH1NCSHFPTPLSTOMACH138p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N600N
CDH1NPTKTKKARSTOMACH179p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N300N
CDH1PFLESKQNCSTOMACH131p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N000N
CDH1PIRPPFLESSTOMACH127p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N000N
CDH1PLLASEDRRSTOMACH145p.R124fsc.372_372delCFrame_Shift_Del40.33IM95N200N
CDH1PLLVSLLLKSTOMACH200p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N100N
CDH1PPFLESKQNSTOMACH130p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N000N
CDH1PRPIRPPFLSTOMACH125p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N400N
CDH1PSAAQKMKKSTOMACH160p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N000N
CDH1PTKTKKARFSTOMACH180p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N200N
CDH1PTPLLASEDSTOMACH143p.R124fsc.372_372delCFrame_Shift_Del40.33IM95N000N
CDH1QKMKKAHFLSTOMACH164p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N700N
CDH1QNCSHFPTPSTOMACH137p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N000N
CDH1RETGLFLPSSTOMACH153p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N500N
CDH1RFSTASLAKSTOMACH187p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N200N
CDH1RPIRPPFLESTOMACH126p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N100N
CDH1RPPFLESKQSTOMACH129p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N000N
CDH1RRETGLFLPSTOMACH152p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N200N
CDH1RSNPTKTKKSTOMACH177p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N400N
CDH1SAAQKMKKASTOMACH161p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N500N
CDH1SEDRRETGLSTOMACH149p.R124fsc.372_372delCFrame_Shift_Del50.33IM95Y890N
CDH1SHFPTPLLASTOMACH140p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N200N
CDH1SKQNCSHFPSTOMACH135p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N000N
CDH1SLAKELTHPSTOMACH192p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N000N
CDH1SLLLKEKQDSTOMACH204p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N000N
CDH1SNPTKTKKASTOMACH178p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N100N
CDH1STASLAKELSTOMACH189p.R124fsc.372_372delCFrame_Shift_Del60.33IM95Y5110N
CDH1TASLAKELTSTOMACH190p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N300N
CDH1TGLFLPSAASTOMACH155p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N100N
CDH1THPLLVSLLSTOMACH198p.R124fsc.372_372delCFrame_Shift_Del40.33IM95Y1090N
CDH1TKKARFSTASTOMACH183p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N200N
CDH1TKTKKARFSSTOMACH181p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N100N
CDH1TPLLASEDRSTOMACH144p.R124fsc.372_372delCFrame_Shift_Del40.33IM95N400N
CDH1TWFRSNPTKSTOMACH174p.R124fsc.372_372delCFrame_Shift_Del60.33IM95N000N
CDH1VSLLLKEKQSTOMACH203p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N0013N
CDH1WFRSNPTKTSTOMACH175p.R124fsc.372_372delCFrame_Shift_Del50.33IM95N301N
CDH1ATGTRDTSASTOMACH575p.T578fsc.1732_1733insCFrame_Shift_Ins50.11AGSN100Y
CDH1GSPVATGTRSTOMACH571p.T578fsc.1732_1733insCFrame_Shift_Ins10.11AGSN300N
CDH1GTRDTSADPSTOMACH577p.T578fsc.1732_1733insCFrame_Shift_Ins60.11AGSN000Y
CDH1PVATGTRDTSTOMACH573p.T578fsc.1732_1733insCFrame_Shift_Ins30.11AGSN000Y
CDH1SPVATGTRDSTOMACH572p.T578fsc.1732_1733insCFrame_Shift_Ins20.11AGSN000N
CDH1TGTRDTSADSTOMACH576p.T578fsc.1732_1733insCFrame_Shift_Ins50.11AGSN000Y
CDH1TRDTSADPVSTOMACH578p.T578fsc.1732_1733insCFrame_Shift_Ins60.11AGSN400Y
CDH1VATGTRDTSSTOMACH574p.T578fsc.1732_1733insCFrame_Shift_Ins40.11AGSN100Y
CDH1AEKRVEVSESTOMACH483p.PIFVPP484delc.1448_1465delCCCCCATCTTTGTGCCTCIn_Frame_Del10.11NCCSTCK140N000N
CDH1DVLDVNEAESTOMACH476p.PIFVPP484delc.1448_1465delCCCCCATCTTTGTGCCTCIn_Frame_Del10.11NCCSTCK140N000N
CDH1DVNEAEKRVSTOMACH479p.PIFVPP484delc.1448_1465delCCCCCATCTTTGTGCCTCIn_Frame_Del30.11NCCSTCK140N400N
CDH1EAEKRVEVSSTOMACH482p.PIFVPP484delc.1448_1465delCCCCCATCTTTGTGCCTCIn_Frame_Del20.11NCCSTCK140N200N
CDH1LDVNEAEKRSTOMACH478p.PIFVPP484delc.1448_1465delCCCCCATCTTTGTGCCTCIn_Frame_Del30.11NCCSTCK140N000N
CDH1NEAEKRVEVSTOMACH481p.PIFVPP484delc.1448_1465delCCCCCATCTTTGTGCCTCIn_Frame_Del30.11NCCSTCK140Y8120N
CDH1VLDVNEAEKSTOMACH477p.PIFVPP484delc.1448_1465delCCCCCATCTTTGTGCCTCIn_Frame_Del20.11NCCSTCK140Y5140N
CDH1VNEAEKRVESTOMACH480p.PIFVPP484delc.1448_1465delCCCCCATCTTTGTGCCTCIn_Frame_Del40.11NCCSTCK140N001N
CDH1ADMYGGGKDSTOMACH873p.E880Kc.2638G>AMissense_Mutation10.11LMSUN000N
CDH1DMYGGGKDDSTOMACH874p.E880Kc.2638G>AMissense_Mutation10.11LMSUN000N
CDH1DPMEILNTVSTOMACH244p.I250Nc.749T>AMissense_Mutation10.11RERFGC1BY1490N
CDH1DQNVNKPEFSTOMACH254p.D257Vc.770A>TMissense_Mutation10.11NUGC4N500N
CDH1EDPMEILNTSTOMACH243p.I250Nc.749T>AMissense_Mutation10.11RERFGC1BN200N
CDH1EILNTVTDQSTOMACH247p.I250Nc.749T>AMissense_Mutation10.11RERFGC1BN100N
CDH1ERETEWLKVSTOMACH208p.G212Ec.635G>AMissense_Mutation10.11OCUM1N300N
CDH1ETEWLKVTESTOMACH210p.G212Ec.635G>AMissense_Mutation10.11OCUM1N000N
CDH1EWLKVTEPLSTOMACH212p.G212Ec.635G>AMissense_Mutation10.11OCUM1N900Y
CDH1FIIERETEWSTOMACH205p.G212Ec.635G>AMissense_Mutation10.11OCUM1N400N
CDH1GLRRQKTDWSTOMACH148p.R154Tc.461G>CMissense_Mutation10.11KATOIIIN400N
CDH1IERETEWLKSTOMACH207p.G212Ec.635G>AMissense_Mutation10.11OCUM1Y1140N
CDH1IIERETEWLSTOMACH206p.G212Ec.635G>AMissense_Mutation10.11OCUM1Y5100Y
CDH1IINADLPPNSTOMACH614p.D616Nc.1846G>AMissense_Mutation10.112313287N000Y
CDH1ILNTVTDQNSTOMACH248p.I250Nc.749T>AMissense_Mutation10.11RERFGC1BN000N
CDH1INADLPPNTSTOMACH615p.D616Nc.1846G>AMissense_Mutation10.112313287N004Y
CDH1INIINADLPSTOMACH612p.D616Nc.1846G>AMissense_Mutation10.112313287N000N
CDH1ITVTDQNVNSTOMACH250p.D257Vc.770A>TMissense_Mutation10.11NUGC4N000Y
CDH1KPQVINIINSTOMACH608p.D616Nc.1846G>AMissense_Mutation10.112313287N300N
CDH1KTDWVIPPISTOMACH153p.R154Tc.461G>CMissense_Mutation10.11KATOIIIY6100N
CDH1LADMYGGGKSTOMACH872p.E880Kc.2638G>AMissense_Mutation10.11LMSUN202N
CDH1LITVTDQNVSTOMACH249p.D257Vc.770A>TMissense_Mutation10.11NUGC4N400N
CDH1LNTVTDQNDSTOMACH249p.I250Nc.749T>AMissense_Mutation10.11RERFGC1BN000N
CDH1LRRQKTDWVSTOMACH149p.R154Tc.461G>CMissense_Mutation10.11KATOIIIN4023N
CDH1MEILNTVTDSTOMACH246p.I250Nc.749T>AMissense_Mutation10.11RERFGC1BN3012N
CDH1NADLPPNTSSTOMACH616p.D616Nc.1846G>AMissense_Mutation10.112313287N100Y
CDH1NIINADLPPSTOMACH613p.D616Nc.1846G>AMissense_Mutation10.112313287N000Y
CDH1NTVTDQNDNSTOMACH250p.I250Nc.749T>AMissense_Mutation10.11RERFGC1BN000Y
CDH1NVNKPEFTQSTOMACH256p.D257Vc.770A>TMissense_Mutation10.11NUGC4N000N
CDH1PGLRRQKTDSTOMACH147p.R154Tc.461G>CMissense_Mutation10.11KATOIIIN000N
CDH1PMEILNTVTSTOMACH245p.I250Nc.749T>AMissense_Mutation10.11RERFGC1BN000N
CDH1PQVINIINASTOMACH609p.D616Nc.1846G>AMissense_Mutation10.112313287Y1120N
CDH1QKTDWVIPPSTOMACH152p.R154Tc.461G>CMissense_Mutation10.11KATOIIIN000N
CDH1QNVNKPEFTSTOMACH255p.D257Vc.770A>TMissense_Mutation10.11NUGC4N000N
CDH1QVINIINADSTOMACH610p.D616Nc.1846G>AMissense_Mutation10.112313287N000N
CDH1RETEWLKVTSTOMACH209p.G212Ec.635G>AMissense_Mutation10.11OCUM1N500N
CDH1RQKTDWVIPSTOMACH151p.R154Tc.461G>CMissense_Mutation10.11KATOIIIN100N
CDH1RRQKTDWVISTOMACH150p.R154Tc.461G>CMissense_Mutation10.11KATOIIIN400N
CDH1SPGLRRQKTSTOMACH146p.R154Tc.461G>CMissense_Mutation10.11KATOIIIN500Y
CDH1TDQNVNKPESTOMACH253p.D257Vc.770A>TMissense_Mutation10.11NUGC4N000N
CDH1TDWVIPPISSTOMACH154p.R154Tc.461G>CMissense_Mutation10.11KATOIIIN100N
CDH1TEWLKVTEPSTOMACH211p.G212Ec.635G>AMissense_Mutation10.11OCUM1N100N
CDH1TVTDQNVNKSTOMACH251p.D257Vc.770A>TMissense_Mutation10.11NUGC4Y3170Y
CDH1VEDPMEILNSTOMACH242p.I250Nc.749T>AMissense_Mutation10.11RERFGC1BN600N
CDH1VFIIERETESTOMACH204p.G212Ec.635G>AMissense_Mutation10.11OCUM1N008N
CDH1VINIINADLSTOMACH611p.D616Nc.1846G>AMissense_Mutation10.112313287N9015N
CDH1VNKPEFTQESTOMACH257p.D257Vc.770A>TMissense_Mutation10.11NUGC4N000N
CDH1VTDQNVNKPSTOMACH252p.D257Vc.770A>TMissense_Mutation10.11NUGC4N000N
CHD1DQRSYGSRSSTOMACH1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86AGSN100N
CHD1DQRSYGSRSSTOMACH1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86GCIYN100N
CHD1DQRSYGSRSSTOMACH1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HS746TN100N
CHD1DQRSYGSRSSTOMACH1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86MKN7N100N
CHD1DQRSYGSRSSTOMACH1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SNU1N100N
CHD1LDQRSYGSRSTOMACH1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86AGSN000N
CHD1LDQRSYGSRSTOMACH1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86GCIYN000N
CHD1LDQRSYGSRSTOMACH1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HS746TN000N
CHD1LDQRSYGSRSTOMACH1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86MKN7N000N
CHD1LDQRSYGSRSTOMACH1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SNU1N000N
CHD1PLDQRSYGSSTOMACH1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86AGSN000N
CHD1PLDQRSYGSSTOMACH1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86GCIYN000N
CHD1PLDQRSYGSSTOMACH1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HS746TN000N
CHD1PLDQRSYGSSTOMACH1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86MKN7N000N
CHD1PLDQRSYGSSTOMACH1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SNU1N000N
CHD1QRSYGSRSPSTOMACH1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86AGSN000N
CHD1QRSYGSRSPSTOMACH1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86GCIYN000N
CHD1QRSYGSRSPSTOMACH1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HS746TN000N
CHD1QRSYGSRSPSTOMACH1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86MKN7N000N
CHD1QRSYGSRSPSTOMACH1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SNU1N000N
CHD1RSPLDQRSYSTOMACH1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86AGSN600N
CHD1RSPLDQRSYSTOMACH1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86GCIYN600N
CHD1RSPLDQRSYSTOMACH1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HS746TN600N
CHD1RSPLDQRSYSTOMACH1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86MKN7N600N
CHD1RSPLDQRSYSTOMACH1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SNU1N600N
CHD1RSYGSRSPFSTOMACH1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86AGSN900N
CHD1RSYGSRSPFSTOMACH1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86GCIYN900N
CHD1RSYGSRSPFSTOMACH1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HS746TN900N
CHD1RSYGSRSPFSTOMACH1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86MKN7N900N
CHD1RSYGSRSPFSTOMACH1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SNU1N900N
CHD1SPLDQRSYGSTOMACH1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86AGSN000N
CHD1SPLDQRSYGSTOMACH1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86GCIYN000N
CHD1SPLDQRSYGSTOMACH1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HS746TN000N
CHD1SPLDQRSYGSTOMACH1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86MKN7N000N
CHD1SPLDQRSYGSTOMACH1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SNU1N000N
CHD1SYGSRSPFESTOMACH1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86AGSN000N
CHD1SYGSRSPFESTOMACH1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86GCIYN000N
CHD1SYGSRSPFESTOMACH1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HS746TN000N
CHD1SYGSRSPFESTOMACH1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86MKN7N000N
CHD1SYGSRSPFESTOMACH1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SNU1N000N
CHD1CKWQGRPYSSTOMACH411p.L416Rc.1247T>GMissense_Mutation10.11GSSN100N
CHD1DYYCKWQGRSTOMACH408p.L416Rc.1247T>GMissense_Mutation10.11GSSY290N
CHD1GRPYSECSWSTOMACH415p.L416Rc.1247T>GMissense_Mutation10.11GSSN200N
CHD1KWQGRPYSESTOMACH412p.L416Rc.1247T>GMissense_Mutation10.11GSSN000N
CHD1QGRPYSECSSTOMACH414p.L416Rc.1247T>GMissense_Mutation10.11GSSN100N
CHD1RPYSECSWESTOMACH416p.L416Rc.1247T>GMissense_Mutation10.11GSSN200Y
CHD1WQGRPYSECSTOMACH413p.L416Rc.1247T>GMissense_Mutation10.11GSSN702N
CHD1YCKWQGRPYSTOMACH410p.L416Rc.1247T>GMissense_Mutation10.11GSSY8110N
CHD1YYCKWQGRPSTOMACH409p.L416Rc.1247T>GMissense_Mutation10.11GSSN201N
CREB3L2ARSLGPSRPSTOMACH86p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N100N
CREB3L2ASMTMRWKVSTOMACH103p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74N400N
CREB3L2ATPCARSLGSTOMACH82p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N000N
CREB3L2CARSLGPSRSTOMACH85p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74N300N
CREB3L2CLQTSLQHPSTOMACH116p.A74fsc.220_220delGFrame_Shift_Del40.11MKN74N000Y
CREB3L2EPSPTSPRLSTOMACH67p.A74fsc.220_220delGFrame_Shift_Del20.11MKN74N1500N
CREB3L2GPSRPSPTLSTOMACH90p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N1700Y
CREB3L2GTCLQTSLQSTOMACH114p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N000N
CREB3L2HPQDSFRLSSTOMACH134p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74N500N
CREB3L2HPSRQSQLQSTOMACH123p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74N100Y
CREB3L2KVRNGTCLQSTOMACH110p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N000N
CREB3L2LGPSRPSPTSTOMACH89p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N100Y
CREB3L2LPPVTASMTSTOMACH98p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N600N
CREB3L2LQHPSRQSQSTOMACH121p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N000N
CREB3L2LQTNHPQDSSTOMACH130p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N0012N
CREB3L2LQTSLQHPSSTOMACH117p.A74fsc.220_220delGFrame_Shift_Del40.11MKN74N004Y
CREB3L2LSSRLSTATSTOMACH75p.A74fsc.220_220delGFrame_Shift_Del40.11MKN74N100N
CREB3L2LSTATPCARSTOMACH79p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N300N
CREB3L2MRWKVRNGTSTOMACH107p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74N3017N
CREB3L2MTMRWKVRNSTOMACH105p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74N007N
CREB3L2NGTCLQTSLSTOMACH113p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N800N
CREB3L2NHPQDSFRLSTOMACH133p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74N600N
CREB3L2PCARSLGPSSTOMACH84p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N000N
CREB3L2PPVTASMTMSTOMACH99p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N700N
CREB3L2PQDSFRLSLSTOMACH135p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N300N
CREB3L2PRLSSRLSTSTOMACH73p.A74fsc.220_220delGFrame_Shift_Del40.11MKN74N100N
CREB3L2PSPTLPPVTSTOMACH94p.A74fsc.220_220delGFrame_Shift_Del40.11MKN74N000N
CREB3L2PSPTSPRLSSTOMACH68p.A74fsc.220_220delGFrame_Shift_Del30.11MKN74N000N
CREB3L2PSRPSPTLPSTOMACH91p.A74fsc.220_220delGFrame_Shift_Del40.11MKN74N000Y
CREB3L2PSRQSQLQTSTOMACH124p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74N000N
CREB3L2PTLPPVTASSTOMACH96p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N000N
CREB3L2PTSPRLSSRSTOMACH70p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N100N
CREB3L2PVTASMTMRSTOMACH100p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N300N
CREB3L2QHPSRQSQLSTOMACH122p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74N700Y
CREB3L2QLQTNHPQDSTOMACH129p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74N100Y
CREB3L2QSQLQTNHPSTOMACH127p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N000Y
CREB3L2QTNHPQDSFSTOMACH131p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74N300N
CREB3L2QTSLQHPSRSTOMACH118p.A74fsc.220_220delGFrame_Shift_Del40.11MKN74N400N
CREB3L2RLSSRLSTASTOMACH74p.A74fsc.220_220delGFrame_Shift_Del40.11MKN74Y5100N
CREB3L2RLSTATPCASTOMACH78p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N500N
CREB3L2RNGTCLQTSSTOMACH112p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N000N
CREB3L2RPSPTLPPVSTOMACH93p.A74fsc.220_220delGFrame_Shift_Del40.11MKN74N1300N
CREB3L2RQSQLQTNHSTOMACH126p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74N200N
CREB3L2RSLGPSRPSSTOMACH87p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N200N
CREB3L2RWKVRNGTCSTOMACH108p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74N100N
CREB3L2SLGPSRPSPSTOMACH88p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N000N
CREB3L2SLQHPSRQSSTOMACH120p.A74fsc.220_220delGFrame_Shift_Del40.11MKN74N000N
CREB3L2SMTMRWKVRSTOMACH104p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74N400N
CREB3L2SPRLSSRLSSTOMACH72p.A74fsc.220_220delGFrame_Shift_Del40.11MKN74N500N
CREB3L2SPTLPPVTASTOMACH95p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N800N
CREB3L2SPTSPRLSSSTOMACH69p.A74fsc.220_220delGFrame_Shift_Del40.11MKN74N200N
CREB3L2SQLQTNHPQSTOMACH128p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N000Y
CREB3L2SRLSTATPCSTOMACH77p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N300N
CREB3L2SRPSPTLPPSTOMACH92p.A74fsc.220_220delGFrame_Shift_Del40.11MKN74N100Y
CREB3L2SRQSQLQTNSTOMACH125p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74N200N
CREB3L2SSRLSTATPSTOMACH76p.A74fsc.220_220delGFrame_Shift_Del40.11MKN74N000N
CREB3L2STATPCARSSTOMACH80p.A74fsc.220_220delGFrame_Shift_Del40.11MKN74N000N
CREB3L2TASMTMRWKSTOMACH102p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74Y0100N
CREB3L2TATPCARSLSTOMACH81p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74Y12100N
CREB3L2TCLQTSLQHSTOMACH115p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N000Y
CREB3L2TLPPVTASMSTOMACH97p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74Y8110N
CREB3L2TMRWKVRNGSTOMACH106p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74Y0100N
CREB3L2TNHPQDSFRSTOMACH132p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74N200N
CREB3L2TPCARSLGPSTOMACH83p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N000N
CREB3L2TSLQHPSRQSTOMACH119p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N000Y
CREB3L2TSPRLSSRLSTOMACH71p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74Y1290N
CREB3L2VEPSPTSPRSTOMACH66p.A74fsc.220_220delGFrame_Shift_Del10.11MKN74N001N
CREB3L2VRNGTCLQTSTOMACH111p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N2011N
CREB3L2VTASMTMRWSTOMACH101p.A74fsc.220_220delGFrame_Shift_Del60.11MKN74Y3111N
CREB3L2WKVRNGTCLSTOMACH109p.A74fsc.220_220delGFrame_Shift_Del50.11MKN74N1103N
CREB3L2FTHITSDSFSTOMACH95p.T100delc.299_301delCCAIn_Frame_Del444.47AGSN801N
CREB3L2FTHITSDSFSTOMACH95p.T100delc.299_301delCCAIn_Frame_Del444.47ECC12N801N
CREB3L2FTHITSDSFSTOMACH95p.T100delc.299_301delCCAIn_Frame_Del444.47FU97N801N
CREB3L2FTHITSDSFSTOMACH95p.T100delc.299_301delCCAIn_Frame_Del444.47HS746TN801N
CREB3L2FTHITSDSFSTOMACH95p.T100delc.299_301delCCAIn_Frame_Del444.47HUG1NN801N
CREB3L2FTHITSDSFSTOMACH95p.T100delc.299_301delCCAIn_Frame_Del444.47IM95N801N
CREB3L2FTHITSDSFSTOMACH95p.T100delc.299_301delCCAIn_Frame_Del444.47KATOIIIN801N
CREB3L2FTHITSDSFSTOMACH95p.T100delc.299_301delCCAIn_Frame_Del444.47MKN1N801N
CREB3L2FTHITSDSFSTOMACH95p.T100delc.299_301delCCAIn_Frame_Del444.47MKN7N801N
CREB3L2FTHITSDSFSTOMACH95p.T100delc.299_301delCCAIn_Frame_Del444.47NCIN87N801N
CREB3L2FTHITSDSFSTOMACH95p.T100delc.299_301delCCAIn_Frame_Del444.47NUGC3N801N
CREB3L2FTHITSDSFSTOMACH95p.T100delc.299_301delCCAIn_Frame_Del444.47OCUM1N801N
CREB3L2FTHITSDSFSTOMACH95p.T100delc.299_301delCCAIn_Frame_Del444.47SH10TCN801N
CREB3L2FTHITSDSFSTOMACH95p.T100delc.299_301delCCAIn_Frame_Del444.47SNU1N801N
CREB3L2FTHITSDSFSTOMACH95p.T100delc.299_301delCCAIn_Frame_Del444.47SNU601N801N
CREB3L2HITSDSFNDSTOMACH97p.T100delc.299_301delCCAIn_Frame_Del244.47AGSN000N
CREB3L2HITSDSFNDSTOMACH97p.T100delc.299_301delCCAIn_Frame_Del244.47ECC12N000N
CREB3L2HITSDSFNDSTOMACH97p.T100delc.299_301delCCAIn_Frame_Del244.47FU97N000N
CREB3L2HITSDSFNDSTOMACH97p.T100delc.299_301delCCAIn_Frame_Del244.47HS746TN000N
CREB3L2HITSDSFNDSTOMACH97p.T100delc.299_301delCCAIn_Frame_Del244.47HUG1NN000N
CREB3L2HITSDSFNDSTOMACH97p.T100delc.299_301delCCAIn_Frame_Del244.47IM95N000N
CREB3L2HITSDSFNDSTOMACH97p.T100delc.299_301delCCAIn_Frame_Del244.47KATOIIIN000N
CREB3L2HITSDSFNDSTOMACH97p.T100delc.299_301delCCAIn_Frame_Del244.47MKN1N000N
CREB3L2HITSDSFNDSTOMACH97p.T100delc.299_301delCCAIn_Frame_Del244.47MKN7N000N
CREB3L2HITSDSFNDSTOMACH97p.T100delc.299_301delCCAIn_Frame_Del244.47NCIN87N000N
CREB3L2HITSDSFNDSTOMACH97p.T100delc.299_301delCCAIn_Frame_Del244.47NUGC3N000N
CREB3L2HITSDSFNDSTOMACH97p.T100delc.299_301delCCAIn_Frame_Del244.47OCUM1N000N
CREB3L2HITSDSFNDSTOMACH97p.T100delc.299_301delCCAIn_Frame_Del244.47SH10TCN000N
CREB3L2HITSDSFNDSTOMACH97p.T100delc.299_301delCCAIn_Frame_Del244.47SNU1N000N
CREB3L2HITSDSFNDSTOMACH97p.T100delc.299_301delCCAIn_Frame_Del244.47SNU601N000N
CREB3L2ITSDSFNDDSTOMACH98p.T100delc.299_301delCCAIn_Frame_Del144.47AGSN000N
CREB3L2ITSDSFNDDSTOMACH98p.T100delc.299_301delCCAIn_Frame_Del144.47ECC12N000N
CREB3L2ITSDSFNDDSTOMACH98p.T100delc.299_301delCCAIn_Frame_Del144.47FU97N000N
CREB3L2ITSDSFNDDSTOMACH98p.T100delc.299_301delCCAIn_Frame_Del144.47HS746TN000N
CREB3L2ITSDSFNDDSTOMACH98p.T100delc.299_301delCCAIn_Frame_Del144.47HUG1NN000N
CREB3L2ITSDSFNDDSTOMACH98p.T100delc.299_301delCCAIn_Frame_Del144.47IM95N000N
CREB3L2ITSDSFNDDSTOMACH98p.T100delc.299_301delCCAIn_Frame_Del144.47KATOIIIN000N
CREB3L2ITSDSFNDDSTOMACH98p.T100delc.299_301delCCAIn_Frame_Del144.47MKN1N000N
CREB3L2ITSDSFNDDSTOMACH98p.T100delc.299_301delCCAIn_Frame_Del144.47MKN7N000N
CREB3L2ITSDSFNDDSTOMACH98p.T100delc.299_301delCCAIn_Frame_Del144.47NCIN87N000N
CREB3L2ITSDSFNDDSTOMACH98p.T100delc.299_301delCCAIn_Frame_Del144.47NUGC3N000N
CREB3L2ITSDSFNDDSTOMACH98p.T100delc.299_301delCCAIn_Frame_Del144.47OCUM1N000N
CREB3L2ITSDSFNDDSTOMACH98p.T100delc.299_301delCCAIn_Frame_Del144.47SH10TCN000N
CREB3L2ITSDSFNDDSTOMACH98p.T100delc.299_301delCCAIn_Frame_Del144.47SNU1N000N
CREB3L2ITSDSFNDDSTOMACH98p.T100delc.299_301delCCAIn_Frame_Del144.47SNU601N000N
CREB3L2PFTHITSDSSTOMACH94p.T100delc.299_301delCCAIn_Frame_Del344.47AGSN000N
CREB3L2PFTHITSDSSTOMACH94p.T100delc.299_301delCCAIn_Frame_Del344.47ECC12N000N
CREB3L2PFTHITSDSSTOMACH94p.T100delc.299_301delCCAIn_Frame_Del344.47FU97N000N
CREB3L2PFTHITSDSSTOMACH94p.T100delc.299_301delCCAIn_Frame_Del344.47HS746TN000N
CREB3L2PFTHITSDSSTOMACH94p.T100delc.299_301delCCAIn_Frame_Del344.47HUG1NN000N
CREB3L2PFTHITSDSSTOMACH94p.T100delc.299_301delCCAIn_Frame_Del344.47IM95N000N
CREB3L2PFTHITSDSSTOMACH94p.T100delc.299_301delCCAIn_Frame_Del344.47KATOIIIN000N
CREB3L2PFTHITSDSSTOMACH94p.T100delc.299_301delCCAIn_Frame_Del344.47MKN1N000N
CREB3L2PFTHITSDSSTOMACH94p.T100delc.299_301delCCAIn_Frame_Del344.47MKN7N000N
CREB3L2PFTHITSDSSTOMACH94p.T100delc.299_301delCCAIn_Frame_Del344.47NCIN87N000N
CREB3L2PFTHITSDSSTOMACH94p.T100delc.299_301delCCAIn_Frame_Del344.47NUGC3N000N
CREB3L2PFTHITSDSSTOMACH94p.T100delc.299_301delCCAIn_Frame_Del344.47OCUM1N000N
CREB3L2PFTHITSDSSTOMACH94p.T100delc.299_301delCCAIn_Frame_Del344.47SH10TCN000N
CREB3L2PFTHITSDSSTOMACH94p.T100delc.299_301delCCAIn_Frame_Del344.47SNU1N000N
CREB3L2PFTHITSDSSTOMACH94p.T100delc.299_301delCCAIn_Frame_Del344.47SNU601N000N
CREB3L2QSPFTHITSSTOMACH92p.T100delc.299_301delCCAIn_Frame_Del144.47AGSN000N
CREB3L2QSPFTHITSSTOMACH92p.T100delc.299_301delCCAIn_Frame_Del144.47ECC12N000N
CREB3L2QSPFTHITSSTOMACH92p.T100delc.299_301delCCAIn_Frame_Del144.47FU97N000N
CREB3L2QSPFTHITSSTOMACH92p.T100delc.299_301delCCAIn_Frame_Del144.47HS746TN000N
CREB3L2QSPFTHITSSTOMACH92p.T100delc.299_301delCCAIn_Frame_Del144.47HUG1NN000N
CREB3L2QSPFTHITSSTOMACH92p.T100delc.299_301delCCAIn_Frame_Del144.47IM95N000N
CREB3L2QSPFTHITSSTOMACH92p.T100delc.299_301delCCAIn_Frame_Del144.47KATOIIIN000N
CREB3L2QSPFTHITSSTOMACH92p.T100delc.299_301delCCAIn_Frame_Del144.47MKN1N000N
CREB3L2QSPFTHITSSTOMACH92p.T100delc.299_301delCCAIn_Frame_Del144.47MKN7N000N
CREB3L2QSPFTHITSSTOMACH92p.T100delc.299_301delCCAIn_Frame_Del144.47NCIN87N000N
CREB3L2QSPFTHITSSTOMACH92p.T100delc.299_301delCCAIn_Frame_Del144.47NUGC3N000N
CREB3L2QSPFTHITSSTOMACH92p.T100delc.299_301delCCAIn_Frame_Del144.47OCUM1N000N
CREB3L2QSPFTHITSSTOMACH92p.T100delc.299_301delCCAIn_Frame_Del144.47SH10TCN000N
CREB3L2QSPFTHITSSTOMACH92p.T100delc.299_301delCCAIn_Frame_Del144.47SNU1N000N
CREB3L2QSPFTHITSSTOMACH92p.T100delc.299_301delCCAIn_Frame_Del144.47SNU601N000N
CREB3L2SPFTHITSDSTOMACH93p.T100delc.299_301delCCAIn_Frame_Del244.47AGSN100N
CREB3L2SPFTHITSDSTOMACH93p.T100delc.299_301delCCAIn_Frame_Del244.47ECC12N100N
CREB3L2SPFTHITSDSTOMACH93p.T100delc.299_301delCCAIn_Frame_Del244.47FU97N100N
CREB3L2SPFTHITSDSTOMACH93p.T100delc.299_301delCCAIn_Frame_Del244.47HS746TN100N
CREB3L2SPFTHITSDSTOMACH93p.T100delc.299_301delCCAIn_Frame_Del244.47HUG1NN100N
CREB3L2SPFTHITSDSTOMACH93p.T100delc.299_301delCCAIn_Frame_Del244.47IM95N100N
CREB3L2SPFTHITSDSTOMACH93p.T100delc.299_301delCCAIn_Frame_Del244.47KATOIIIN100N
CREB3L2SPFTHITSDSTOMACH93p.T100delc.299_301delCCAIn_Frame_Del244.47MKN1N100N
CREB3L2SPFTHITSDSTOMACH93p.T100delc.299_301delCCAIn_Frame_Del244.47MKN7N100N
CREB3L2SPFTHITSDSTOMACH93p.T100delc.299_301delCCAIn_Frame_Del244.47NCIN87N100N
CREB3L2SPFTHITSDSTOMACH93p.T100delc.299_301delCCAIn_Frame_Del244.47NUGC3N100N
CREB3L2SPFTHITSDSTOMACH93p.T100delc.299_301delCCAIn_Frame_Del244.47OCUM1N100N
CREB3L2SPFTHITSDSTOMACH93p.T100delc.299_301delCCAIn_Frame_Del244.47SH10TCN100N
CREB3L2SPFTHITSDSTOMACH93p.T100delc.299_301delCCAIn_Frame_Del244.47SNU1N100N
CREB3L2SPFTHITSDSTOMACH93p.T100delc.299_301delCCAIn_Frame_Del244.47SNU601N100N
CREB3L2THITSDSFNSTOMACH96p.T100delc.299_301delCCAIn_Frame_Del344.47AGSN100N
CREB3L2THITSDSFNSTOMACH96p.T100delc.299_301delCCAIn_Frame_Del344.47ECC12N100N
CREB3L2THITSDSFNSTOMACH96p.T100delc.299_301delCCAIn_Frame_Del344.47FU97N100N
CREB3L2THITSDSFNSTOMACH96p.T100delc.299_301delCCAIn_Frame_Del344.47HS746TN100N
CREB3L2THITSDSFNSTOMACH96p.T100delc.299_301delCCAIn_Frame_Del344.47HUG1NN100N
CREB3L2THITSDSFNSTOMACH96p.T100delc.299_301delCCAIn_Frame_Del344.47IM95N100N
CREB3L2THITSDSFNSTOMACH96p.T100delc.299_301delCCAIn_Frame_Del344.47KATOIIIN100N
CREB3L2THITSDSFNSTOMACH96p.T100delc.299_301delCCAIn_Frame_Del344.47MKN1N100N
CREB3L2THITSDSFNSTOMACH96p.T100delc.299_301delCCAIn_Frame_Del344.47MKN7N100N
CREB3L2THITSDSFNSTOMACH96p.T100delc.299_301delCCAIn_Frame_Del344.47NCIN87N100N
CREB3L2THITSDSFNSTOMACH96p.T100delc.299_301delCCAIn_Frame_Del344.47NUGC3N100N
CREB3L2THITSDSFNSTOMACH96p.T100delc.299_301delCCAIn_Frame_Del344.47OCUM1N100N
CREB3L2THITSDSFNSTOMACH96p.T100delc.299_301delCCAIn_Frame_Del344.47SH10TCN100N
CREB3L2THITSDSFNSTOMACH96p.T100delc.299_301delCCAIn_Frame_Del344.47SNU1N100N
CREB3L2THITSDSFNSTOMACH96p.T100delc.299_301delCCAIn_Frame_Del344.47SNU601N100N
CREB3L2DQFLNFSPESTOMACH185p.K193Ec.577A>GMissense_Mutation10.11SNU719N000N
CREB3L2EEAPVDHLHSTOMACH193p.K193Ec.577A>GMissense_Mutation10.11SNU719N200N
CREB3L2FLNFSPEEASTOMACH187p.K193Ec.577A>GMissense_Mutation10.11SNU719N506N
CREB3L2FSPEEAPVDSTOMACH190p.K193Ec.577A>GMissense_Mutation10.11SNU719N200Y
CREB3L2LNFSPEEAPSTOMACH188p.K193Ec.577A>GMissense_Mutation10.11SNU719N000N
CREB3L2NFSPEEAPVSTOMACH189p.K193Ec.577A>GMissense_Mutation10.11SNU719N200N
CREB3L2PEEAPVDHLSTOMACH192p.K193Ec.577A>GMissense_Mutation10.11SNU719N200N
CREB3L2QFLNFSPEESTOMACH186p.K193Ec.577A>GMissense_Mutation10.11SNU719N000N
CREB3L2SPEEAPVDHSTOMACH191p.K193Ec.577A>GMissense_Mutation10.11SNU719N000Y
CTBP2APSPNQPTNSTOMACH966p.K974fsc.2922_2922delAFrame_Shift_Del124.34ECC10N300N
CTBP2APSPNQPTNSTOMACH966p.K974fsc.2922_2922delAFrame_Shift_Del124.34ECC12N300N
CTBP2APSPNQPTNSTOMACH966p.K974fsc.2922_2922delAFrame_Shift_Del124.34IM95N300N
CTBP2APSPNQPTNSTOMACH966p.K974fsc.2922_2922delAFrame_Shift_Del124.34KE39N300N
CTBP2APSPNQPTNSTOMACH966p.K974fsc.2922_2922delAFrame_Shift_Del124.34LMSUN300N
CTBP2APSPNQPTNSTOMACH966p.K974fsc.2922_2922delAFrame_Shift_Del124.34NCCSTCK140N300N
CTBP2APSPNQPTNSTOMACH966p.K974fsc.2922_2922delAFrame_Shift_Del124.34OCUM1N300N
CTBP2APSPNQPTNSTOMACH966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SNU216N300N
CTBP2APSPNQPTNSTOMACH966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SNU520N300N
CTBP2APSPNQPTNSTOMACH966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SNU620N300N
CTBP2APSPNQPTNSTOMACH966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SNU719N300N
CTBP2GTIESTPTSSTOMACH976p.K974fsc.2922_2922delAFrame_Shift_Del524.34ECC10N100N
CTBP2GTIESTPTSSTOMACH976p.K974fsc.2922_2922delAFrame_Shift_Del524.34ECC12N100N
CTBP2GTIESTPTSSTOMACH976p.K974fsc.2922_2922delAFrame_Shift_Del524.34IM95N100N
CTBP2GTIESTPTSSTOMACH976p.K974fsc.2922_2922delAFrame_Shift_Del524.34KE39N100N
CTBP2GTIESTPTSSTOMACH976p.K974fsc.2922_2922delAFrame_Shift_Del524.34LMSUN100N
CTBP2GTIESTPTSSTOMACH976p.K974fsc.2922_2922delAFrame_Shift_Del524.34NCCSTCK140N100N
CTBP2GTIESTPTSSTOMACH976p.K974fsc.2922_2922delAFrame_Shift_Del524.34OCUM1N100N
CTBP2GTIESTPTSSTOMACH976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU216N100N
CTBP2GTIESTPTSSTOMACH976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU520N100N
CTBP2GTIESTPTSSTOMACH976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU620N100N
CTBP2GTIESTPTSSTOMACH976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU719N100N
CTBP2NQPTNTGTISTOMACH970p.K974fsc.2922_2922delAFrame_Shift_Del424.34ECC10N1000N
CTBP2NQPTNTGTISTOMACH970p.K974fsc.2922_2922delAFrame_Shift_Del424.34ECC12N1000N
CTBP2NQPTNTGTISTOMACH970p.K974fsc.2922_2922delAFrame_Shift_Del424.34IM95N1000N
CTBP2NQPTNTGTISTOMACH970p.K974fsc.2922_2922delAFrame_Shift_Del424.34KE39N1000N
CTBP2NQPTNTGTISTOMACH970p.K974fsc.2922_2922delAFrame_Shift_Del424.34LMSUN1000N
CTBP2NQPTNTGTISTOMACH970p.K974fsc.2922_2922delAFrame_Shift_Del424.34NCCSTCK140N1000N
CTBP2NQPTNTGTISTOMACH970p.K974fsc.2922_2922delAFrame_Shift_Del424.34OCUM1N1000N
CTBP2NQPTNTGTISTOMACH970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SNU216N1000N
CTBP2NQPTNTGTISTOMACH970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SNU520N1000N
CTBP2NQPTNTGTISTOMACH970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SNU620N1000N
CTBP2NQPTNTGTISTOMACH970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SNU719N1000N
CTBP2NTGTIESTPSTOMACH974p.K974fsc.2922_2922delAFrame_Shift_Del524.34ECC10N000N
CTBP2NTGTIESTPSTOMACH974p.K974fsc.2922_2922delAFrame_Shift_Del524.34ECC12N000N
CTBP2NTGTIESTPSTOMACH974p.K974fsc.2922_2922delAFrame_Shift_Del524.34IM95N000N
CTBP2NTGTIESTPSTOMACH974p.K974fsc.2922_2922delAFrame_Shift_Del524.34KE39N000N
CTBP2NTGTIESTPSTOMACH974p.K974fsc.2922_2922delAFrame_Shift_Del524.34LMSUN000N
CTBP2NTGTIESTPSTOMACH974p.K974fsc.2922_2922delAFrame_Shift_Del524.34NCCSTCK140N000N
CTBP2NTGTIESTPSTOMACH974p.K974fsc.2922_2922delAFrame_Shift_Del524.34OCUM1N000N
CTBP2NTGTIESTPSTOMACH974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU216N000N
CTBP2NTGTIESTPSTOMACH974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU520N000N
CTBP2NTGTIESTPSTOMACH974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU620N000N
CTBP2NTGTIESTPSTOMACH974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU719N000N
CTBP2PNQPTNTGTSTOMACH969p.K974fsc.2922_2922delAFrame_Shift_Del324.34ECC10N000N
CTBP2PNQPTNTGTSTOMACH969p.K974fsc.2922_2922delAFrame_Shift_Del324.34ECC12N000N
CTBP2PNQPTNTGTSTOMACH969p.K974fsc.2922_2922delAFrame_Shift_Del324.34IM95N000N
CTBP2PNQPTNTGTSTOMACH969p.K974fsc.2922_2922delAFrame_Shift_Del324.34KE39N000N
CTBP2PNQPTNTGTSTOMACH969p.K974fsc.2922_2922delAFrame_Shift_Del324.34LMSUN000N
CTBP2PNQPTNTGTSTOMACH969p.K974fsc.2922_2922delAFrame_Shift_Del324.34NCCSTCK140N000N
CTBP2PNQPTNTGTSTOMACH969p.K974fsc.2922_2922delAFrame_Shift_Del324.34OCUM1N000N
CTBP2PNQPTNTGTSTOMACH969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SNU216N000N
CTBP2PNQPTNTGTSTOMACH969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SNU520N000N
CTBP2PNQPTNTGTSTOMACH969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SNU620N000N
CTBP2PNQPTNTGTSTOMACH969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SNU719N000N
CTBP2PSPNQPTNTSTOMACH967p.K974fsc.2922_2922delAFrame_Shift_Del224.34ECC10N000N
CTBP2PSPNQPTNTSTOMACH967p.K974fsc.2922_2922delAFrame_Shift_Del224.34ECC12N000N
CTBP2PSPNQPTNTSTOMACH967p.K974fsc.2922_2922delAFrame_Shift_Del224.34IM95N000N
CTBP2PSPNQPTNTSTOMACH967p.K974fsc.2922_2922delAFrame_Shift_Del224.34KE39N000N
CTBP2PSPNQPTNTSTOMACH967p.K974fsc.2922_2922delAFrame_Shift_Del224.34LMSUN000N
CTBP2PSPNQPTNTSTOMACH967p.K974fsc.2922_2922delAFrame_Shift_Del224.34NCCSTCK140N000N
CTBP2PSPNQPTNTSTOMACH967p.K974fsc.2922_2922delAFrame_Shift_Del224.34OCUM1N000N
CTBP2PSPNQPTNTSTOMACH967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU216N000N
CTBP2PSPNQPTNTSTOMACH967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU520N000N
CTBP2PSPNQPTNTSTOMACH967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU620N000N
CTBP2PSPNQPTNTSTOMACH967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU719N000N
CTBP2PTNTGTIESSTOMACH972p.K974fsc.2922_2922delAFrame_Shift_Del524.34ECC10N000N
CTBP2PTNTGTIESSTOMACH972p.K974fsc.2922_2922delAFrame_Shift_Del524.34ECC12N000N
CTBP2PTNTGTIESSTOMACH972p.K974fsc.2922_2922delAFrame_Shift_Del524.34IM95N000N
CTBP2PTNTGTIESSTOMACH972p.K974fsc.2922_2922delAFrame_Shift_Del524.34KE39N000N
CTBP2PTNTGTIESSTOMACH972p.K974fsc.2922_2922delAFrame_Shift_Del524.34LMSUN000N
CTBP2PTNTGTIESSTOMACH972p.K974fsc.2922_2922delAFrame_Shift_Del524.34NCCSTCK140N000N
CTBP2PTNTGTIESSTOMACH972p.K974fsc.2922_2922delAFrame_Shift_Del524.34OCUM1N000N
CTBP2PTNTGTIESSTOMACH972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU216N000N
CTBP2PTNTGTIESSTOMACH972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU520N000N
CTBP2PTNTGTIESSTOMACH972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU620N000N
CTBP2PTNTGTIESSTOMACH972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU719N000N
CTBP2QPTNTGTIESTOMACH971p.K974fsc.2922_2922delAFrame_Shift_Del524.34ECC10N000N
CTBP2QPTNTGTIESTOMACH971p.K974fsc.2922_2922delAFrame_Shift_Del524.34ECC12N000N
CTBP2QPTNTGTIESTOMACH971p.K974fsc.2922_2922delAFrame_Shift_Del524.34IM95N000N
CTBP2QPTNTGTIESTOMACH971p.K974fsc.2922_2922delAFrame_Shift_Del524.34KE39N000N
CTBP2QPTNTGTIESTOMACH971p.K974fsc.2922_2922delAFrame_Shift_Del524.34LMSUN000N
CTBP2QPTNTGTIESTOMACH971p.K974fsc.2922_2922delAFrame_Shift_Del524.34NCCSTCK140N000N
CTBP2QPTNTGTIESTOMACH971p.K974fsc.2922_2922delAFrame_Shift_Del524.34OCUM1N000N
CTBP2QPTNTGTIESTOMACH971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU216N000N
CTBP2QPTNTGTIESTOMACH971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU520N000N
CTBP2QPTNTGTIESTOMACH971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU620N000N
CTBP2QPTNTGTIESTOMACH971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU719N000N
CTBP2SPNQPTNTGSTOMACH968p.K974fsc.2922_2922delAFrame_Shift_Del224.34ECC10N000N
CTBP2SPNQPTNTGSTOMACH968p.K974fsc.2922_2922delAFrame_Shift_Del224.34ECC12N000N
CTBP2SPNQPTNTGSTOMACH968p.K974fsc.2922_2922delAFrame_Shift_Del224.34IM95N000N
CTBP2SPNQPTNTGSTOMACH968p.K974fsc.2922_2922delAFrame_Shift_Del224.34KE39N000N
CTBP2SPNQPTNTGSTOMACH968p.K974fsc.2922_2922delAFrame_Shift_Del224.34LMSUN000N
CTBP2SPNQPTNTGSTOMACH968p.K974fsc.2922_2922delAFrame_Shift_Del224.34NCCSTCK140N000N
CTBP2SPNQPTNTGSTOMACH968p.K974fsc.2922_2922delAFrame_Shift_Del224.34OCUM1N000N
CTBP2SPNQPTNTGSTOMACH968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU216N000N
CTBP2SPNQPTNTGSTOMACH968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU520N000N
CTBP2SPNQPTNTGSTOMACH968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU620N000N
CTBP2SPNQPTNTGSTOMACH968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU719N000N
CTBP2TGTIESTPTSTOMACH975p.K974fsc.2922_2922delAFrame_Shift_Del524.34ECC10N000N
CTBP2TGTIESTPTSTOMACH975p.K974fsc.2922_2922delAFrame_Shift_Del524.34ECC12N000N
CTBP2TGTIESTPTSTOMACH975p.K974fsc.2922_2922delAFrame_Shift_Del524.34IM95N000N
CTBP2TGTIESTPTSTOMACH975p.K974fsc.2922_2922delAFrame_Shift_Del524.34KE39N000N
CTBP2TGTIESTPTSTOMACH975p.K974fsc.2922_2922delAFrame_Shift_Del524.34LMSUN000N
CTBP2TGTIESTPTSTOMACH975p.K974fsc.2922_2922delAFrame_Shift_Del524.34NCCSTCK140N000N
CTBP2TGTIESTPTSTOMACH975p.K974fsc.2922_2922delAFrame_Shift_Del524.34OCUM1N000N
CTBP2TGTIESTPTSTOMACH975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU216N000N
CTBP2TGTIESTPTSTOMACH975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU520N000N
CTBP2TGTIESTPTSTOMACH975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU620N000N
CTBP2TGTIESTPTSTOMACH975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU719N000N
CTBP2TIESTPTSNSTOMACH977p.K974fsc.2922_2922delAFrame_Shift_Del524.34ECC10N100N
CTBP2TIESTPTSNSTOMACH977p.K974fsc.2922_2922delAFrame_Shift_Del524.34ECC12N100N
CTBP2TIESTPTSNSTOMACH977p.K974fsc.2922_2922delAFrame_Shift_Del524.34IM95N100N
CTBP2TIESTPTSNSTOMACH977p.K974fsc.2922_2922delAFrame_Shift_Del524.34KE39N100N
CTBP2TIESTPTSNSTOMACH977p.K974fsc.2922_2922delAFrame_Shift_Del524.34LMSUN100N
CTBP2TIESTPTSNSTOMACH977p.K974fsc.2922_2922delAFrame_Shift_Del524.34NCCSTCK140N100N
CTBP2TIESTPTSNSTOMACH977p.K974fsc.2922_2922delAFrame_Shift_Del524.34OCUM1N100N
CTBP2TIESTPTSNSTOMACH977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU216N100N
CTBP2TIESTPTSNSTOMACH977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU520N100N
CTBP2TIESTPTSNSTOMACH977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU620N100N
CTBP2TIESTPTSNSTOMACH977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU719N100N
CTBP2TNTGTIESTSTOMACH973p.K974fsc.2922_2922delAFrame_Shift_Del524.34ECC10N000N
CTBP2TNTGTIESTSTOMACH973p.K974fsc.2922_2922delAFrame_Shift_Del524.34ECC12N000N
CTBP2TNTGTIESTSTOMACH973p.K974fsc.2922_2922delAFrame_Shift_Del524.34IM95N000N
CTBP2TNTGTIESTSTOMACH973p.K974fsc.2922_2922delAFrame_Shift_Del524.34KE39N000N
CTBP2TNTGTIESTSTOMACH973p.K974fsc.2922_2922delAFrame_Shift_Del524.34LMSUN000N
CTBP2TNTGTIESTSTOMACH973p.K974fsc.2922_2922delAFrame_Shift_Del524.34NCCSTCK140N000N
CTBP2TNTGTIESTSTOMACH973p.K974fsc.2922_2922delAFrame_Shift_Del524.34OCUM1N000N
CTBP2TNTGTIESTSTOMACH973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU216N000N
CTBP2TNTGTIESTSTOMACH973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU520N000N
CTBP2TNTGTIESTSTOMACH973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU620N000N
CTBP2TNTGTIESTSTOMACH973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU719N000N
CTBP2ATTYSAPGVSTOMACH418p.A419Tc.1255G>AMissense_Mutation10.22HUG1NN200N
CTBP2ETATTYSAPSTOMACH416p.A419Tc.1255G>AMissense_Mutation10.22HUG1NN000N
CTBP2HLLETATTYSTOMACH413p.A419Tc.1255G>AMissense_Mutation10.22HUG1NN600N
CTBP2LETATTYSASTOMACH415p.A419Tc.1255G>AMissense_Mutation10.22HUG1NN703N
CTBP2LLETATTYSSTOMACH414p.A419Tc.1255G>AMissense_Mutation10.22HUG1NN106N
CTBP2QHLLETATTSTOMACH412p.A419Tc.1255G>AMissense_Mutation10.22HUG1NN100N
CTBP2SQHLLETATSTOMACH411p.A419Tc.1255G>AMissense_Mutation10.22HUG1NN200N
CTBP2TATTYSAPGSTOMACH417p.A419Tc.1255G>AMissense_Mutation10.22HUG1NN000N
CTBP2TTYSAPGVGSTOMACH419p.A419Tc.1255G>AMissense_Mutation10.22HUG1NN000Y
CTBP2AARIPKEPPSTOMACH117p.V120Ic.358G>AMissense_Mutation10.33GSSN000N
CTBP2ARIPKEPPLSTOMACH118p.V120Ic.358G>AMissense_Mutation10.33GSSN800N
CTBP2DPSGAARIPSTOMACH113p.V120Ic.358G>AMissense_Mutation10.33GSSN000N
CTBP2GAARIPKEPSTOMACH116p.V120Ic.358G>AMissense_Mutation10.33GSSN000N
CTBP2IPKEPPLYRSTOMACH120p.V120Ic.358G>AMissense_Mutation10.33GSSY6100Y
CTBP2PSGAARIPKSTOMACH114p.V120Ic.358G>AMissense_Mutation10.33GSSN000N
CTBP2RIPKEPPLYSTOMACH119p.V120Ic.358G>AMissense_Mutation10.33GSSN300N
CTBP2SDPSGAARISTOMACH112p.V120Ic.358G>AMissense_Mutation10.33GSSY590N
CTBP2SGAARIPKESTOMACH115p.V120Ic.358G>AMissense_Mutation10.33GSSN000N
CTNNB1APCLSGKGNSTOMACH43p.S45Cc.134C>GMissense_Mutation10.11OCUM1N300N
CTNNB1ATTTAPCLSSTOMACH39p.S45Cc.134C>GMissense_Mutation10.11OCUM1N000N
CTNNB1CLSGKGNPESTOMACH45p.S45Cc.134C>GMissense_Mutation10.11OCUM1N000N
CTNNB1DSEIHSGATSTOMACH32p.G34Ec.101G>AMissense_Mutation10.11AGSN200N
CTNNB1EIHSGATTTSTOMACH34p.G34Ec.101G>AMissense_Mutation10.11AGSN100N
CTNNB1GATTTAPCLSTOMACH38p.S45Cc.134C>GMissense_Mutation10.11OCUM1N1000N
CTNNB1HWQQQSYLNSTOMACH24p.D32Nc.94G>AMissense_Mutation10.11KE39N000N
CTNNB1LDSEIHSGASTOMACH31p.G34Ec.101G>AMissense_Mutation10.11AGSN400N
CTNNB1LNSGIHSGASTOMACH31p.D32Nc.94G>AMissense_Mutation10.11KE39N100N
CTNNB1NSGIHSGATSTOMACH32p.D32Nc.94G>AMissense_Mutation10.11KE39N100N
CTNNB1PCLSGKGNPSTOMACH44p.S45Cc.134C>GMissense_Mutation10.11OCUM1N000N
CTNNB1QQQSYLDSESTOMACH26p.G34Ec.101G>AMissense_Mutation10.11AGSN000N
CTNNB1QQQSYLNSGSTOMACH26p.D32Nc.94G>AMissense_Mutation10.11KE39N000N
CTNNB1QQSYLDSEISTOMACH27p.G34Ec.101G>AMissense_Mutation10.11AGSN500N
CTNNB1QQSYLNSGISTOMACH27p.D32Nc.94G>AMissense_Mutation10.11KE39N600N
CTNNB1QSYLDSEIHSTOMACH28p.G34Ec.101G>AMissense_Mutation10.11AGSN000N
CTNNB1QSYLNSGIHSTOMACH28p.D32Nc.94G>AMissense_Mutation10.11KE39N100N
CTNNB1SEIHSGATTSTOMACH33p.G34Ec.101G>AMissense_Mutation10.11AGSN500N
CTNNB1SGATTTAPCSTOMACH37p.S45Cc.134C>GMissense_Mutation10.11OCUM1N100N
CTNNB1SYLDSEIHSSTOMACH29p.G34Ec.101G>AMissense_Mutation10.11AGSN200N
CTNNB1SYLNSGIHSSTOMACH29p.D32Nc.94G>AMissense_Mutation10.11KE39N200N
CTNNB1TAPCLSGKGSTOMACH42p.S45Cc.134C>GMissense_Mutation10.11OCUM1N000N
CTNNB1TTAPCLSGKSTOMACH41p.S45Cc.134C>GMissense_Mutation10.11OCUM1N300N
CTNNB1TTTAPCLSGSTOMACH40p.S45Cc.134C>GMissense_Mutation10.11OCUM1N000N
CTNNB1WQQQSYLNSSTOMACH25p.D32Nc.94G>AMissense_Mutation10.11KE39N306N
CTNNB1YLDSEIHSGSTOMACH30p.G34Ec.101G>AMissense_Mutation10.11AGSN300N
CTNNB1YLNSGIHSGSTOMACH30p.D32Nc.94G>AMissense_Mutation10.11KE39Y3114N
CTNNB1DSVIHSGATSTOMACH32p.G34Vc.101G>TMissense_Mutation10.22SNU719N100N
CTNNB1LDSVIHSGASTOMACH31p.G34Vc.101G>TMissense_Mutation10.22SNU719N400N
CTNNB1QQQSYLDSVSTOMACH26p.G34Vc.101G>TMissense_Mutation10.22SNU719N800N
CTNNB1QQSYLDSVISTOMACH27p.G34Vc.101G>TMissense_Mutation10.22SNU719N500N
CTNNB1QSYLDSVIHSTOMACH28p.G34Vc.101G>TMissense_Mutation10.22SNU719N000N
CTNNB1SVIHSGATTSTOMACH33p.G34Vc.101G>TMissense_Mutation10.22SNU719N200N
CTNNB1SYLDSVIHSSTOMACH29p.G34Vc.101G>TMissense_Mutation10.22SNU719Y2100N
CTNNB1VIHSGATTTSTOMACH34p.G34Vc.101G>TMissense_Mutation10.22SNU719N100N
CTNNB1YLDSVIHSGSTOMACH30p.G34Vc.101G>TMissense_Mutation10.22SNU719N300N
ERBB2AIKVSRENTSTOMACH751p.L755Sc.2264T>CMissense_Mutation10.33ECC10N000N
ERBB2IKVSRENTSSTOMACH752p.L755Sc.2264T>CMissense_Mutation10.33ECC10N204N
ERBB2IPVAIKVSRSTOMACH748p.L755Sc.2264T>CMissense_Mutation10.33ECC10N700N
ERBB2KIPVAIKVSSTOMACH747p.L755Sc.2264T>CMissense_Mutation10.33ECC10N100N
ERBB2KVSRENTSPSTOMACH753p.L755Sc.2264T>CMissense_Mutation10.33ECC10N000N
ERBB2PVAIKVSRESTOMACH749p.L755Sc.2264T>CMissense_Mutation10.33ECC10N000N
ERBB2SRENTSPKASTOMACH755p.L755Sc.2264T>CMissense_Mutation10.33ECC10N200N
ERBB2VAIKVSRENSTOMACH750p.L755Sc.2264T>CMissense_Mutation10.33ECC10N2012N
ERBB2VSRENTSPKSTOMACH754p.L755Sc.2264T>CMissense_Mutation10.33ECC10N103N
FBXW7CSGPEKLLASTOMACH244p.W244Cc.732G>TMissense_Mutation10.11TGBC11TKBN200N
FBXW7DLKTGEFIQSTOMACH650p.R658Qc.1973G>AMissense_Mutation10.11GSSN000N
FBXW7EFIQNLVTLSTOMACH655p.R658Qc.1973G>AMissense_Mutation10.11GSSY8130N
FBXW7EWLKMFQSCSTOMACH236p.W244Cc.732G>TMissense_Mutation10.11TGBC11TKBN000N
FBXW7FIQNLVTLESTOMACH656p.R658Qc.1973G>AMissense_Mutation10.11GSSN203N
FBXW7FQSCSGPEKSTOMACH241p.W244Cc.732G>TMissense_Mutation10.11TGBC11TKBN402Y
FBXW7GEFIQNLVTSTOMACH654p.R658Qc.1973G>AMissense_Mutation10.11GSSN600N
FBXW7IQNLVTLESSTOMACH657p.R658Qc.1973G>AMissense_Mutation10.11GSSN1046N
FBXW7KMFQSCSGPSTOMACH239p.W244Cc.732G>TMissense_Mutation10.11TGBC11TKBN000N
FBXW7KTGEFIQNLSTOMACH652p.R658Qc.1973G>AMissense_Mutation10.11GSSY16100N
FBXW7LKMFQSCSGSTOMACH238p.W244Cc.732G>TMissense_Mutation10.11TGBC11TKBN0026N
FBXW7LKTGEFIQNSTOMACH651p.R658Qc.1973G>AMissense_Mutation10.11GSSN100N
FBXW7MFQSCSGPESTOMACH240p.W244Cc.732G>TMissense_Mutation10.11TGBC11TKBN000Y
FBXW7QNLVTLESGSTOMACH658p.R658Qc.1973G>AMissense_Mutation10.11GSSN000N
FBXW7QSCSGPEKLSTOMACH242p.W244Cc.732G>TMissense_Mutation10.11TGBC11TKBN700Y
FBXW7SCSGPEKLLSTOMACH243p.W244Cc.732G>TMissense_Mutation10.11TGBC11TKBN600Y
FBXW7TGEFIQNLVSTOMACH653p.R658Qc.1973G>AMissense_Mutation10.11GSSN600N
FBXW7WLKMFQSCSSTOMACH237p.W244Cc.732G>TMissense_Mutation10.11TGBC11TKBN408N
FBXW7AAVCCVQYDSTOMACH502p.R505Cc.1513C>TMissense_Mutation10.55IM95N000N
FBXW7AVCCVQYDGSTOMACH503p.R505Cc.1513C>TMissense_Mutation10.55IM95N000N
FBXW7CCVQYDGRRSTOMACH505p.R505Cc.1513C>TMissense_Mutation10.55IM95N400N
FBXW7GHVAAVCCVSTOMACH499p.R505Cc.1513C>TMissense_Mutation10.55IM95N200N
FBXW7HVAAVCCVQSTOMACH500p.R505Cc.1513C>TMissense_Mutation10.55IM95N000N
FBXW7LMGHVAAVCSTOMACH497p.R505Cc.1513C>TMissense_Mutation10.55IM95N0010N
FBXW7MGHVAAVCCSTOMACH498p.R505Cc.1513C>TMissense_Mutation10.55IM95N202N
FBXW7VAAVCCVQYSTOMACH501p.R505Cc.1513C>TMissense_Mutation10.55IM95N700N
FBXW7VCCVQYDGRSTOMACH504p.R505Cc.1513C>TMissense_Mutation10.55IM95N300N
FBXW7CCMHLHEKRSTOMACH465p.R465Cc.1393C>TMissense_Mutation10.77MKN1N400N
FBXW7GHTSTVCCMSTOMACH459p.R465Cc.1393C>TMissense_Mutation10.77MKN1Y290N
FBXW7HTSTVCCMHSTOMACH460p.R465Cc.1393C>TMissense_Mutation10.77MKN1N000N
FBXW7LYGHTSTVCSTOMACH457p.R465Cc.1393C>TMissense_Mutation10.77MKN1N203N
FBXW7STVCCMHLHSTOMACH462p.R465Cc.1393C>TMissense_Mutation10.77MKN1N000N
FBXW7TSTVCCMHLSTOMACH461p.R465Cc.1393C>TMissense_Mutation10.77MKN1Y790N
FBXW7TVCCMHLHESTOMACH463p.R465Cc.1393C>TMissense_Mutation10.77MKN1N000N
FBXW7VCCMHLHEKSTOMACH464p.R465Cc.1393C>TMissense_Mutation10.77MKN1N102N
FBXW7YGHTSTVCCSTOMACH458p.R465Cc.1393C>TMissense_Mutation10.77MKN1N404N
FGFR2CQMKNTTKKSTOMACH399p.R400Qc.1199G>AMissense_Mutation10.11MKN74N600N
FGFR2ILCQMKNTTSTOMACH397p.R400Qc.1199G>AMissense_Mutation10.11MKN74N204N
FGFR2LCQMKNTTKSTOMACH398p.R400Qc.1199G>AMissense_Mutation10.11MKN74N105N
FGFR2MVVTVILCQSTOMACH392p.R400Qc.1199G>AMissense_Mutation10.11MKN74N0035N
FGFR2QMKNTTKKPSTOMACH400p.R400Qc.1199G>AMissense_Mutation10.11MKN74N000N
FGFR2TVILCQMKNSTOMACH395p.R400Qc.1199G>AMissense_Mutation10.11MKN74N000N
FGFR2VILCQMKNTSTOMACH396p.R400Qc.1199G>AMissense_Mutation10.11MKN74N200N
FGFR2VTVILCQMKSTOMACH394p.R400Qc.1199G>AMissense_Mutation10.11MKN74N302N
FGFR2VVTVILCQMSTOMACH393p.R400Qc.1199G>AMissense_Mutation10.11MKN74N5014N
FGFR3CHYSVRVTDSTOMACH119p.F121Yc.362T>AMissense_Mutation10.11SNU601N000N
FGFR3HYSVRVTDASTOMACH120p.F121Yc.362T>AMissense_Mutation10.11SNU601N200N
FGFR3LCHYSVRVTSTOMACH118p.F121Yc.362T>AMissense_Mutation10.11SNU601N006N
FGFR3LTQRVLCHYSTOMACH113p.F121Yc.362T>AMissense_Mutation10.11SNU601N801N
FGFR3QRVLCHYSVSTOMACH115p.F121Yc.362T>AMissense_Mutation10.11SNU601Y4100N
FGFR3RVLCHYSVRSTOMACH116p.F121Yc.362T>AMissense_Mutation10.11SNU601Y690N
FGFR3TQRVLCHYSSTOMACH114p.F121Yc.362T>AMissense_Mutation10.11SNU601N100N
FGFR3VLCHYSVRVSTOMACH117p.F121Yc.362T>AMissense_Mutation10.11SNU601Y81111N
FGFR3YSVRVTDAPSTOMACH121p.F121Yc.362T>AMissense_Mutation10.11SNU601N200N
FMN2LPPLPGAAISTOMACH934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03FU97N1401N
FMN2LPPLPGAAISTOMACH934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03GSSN1401N
FMN2LPPLPGAAISTOMACH934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03RERFGC1BN1401N
FMN2PLPPLPGAASTOMACH933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03FU97N000N
FMN2PLPPLPGAASTOMACH933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03GSSN000N
FMN2PLPPLPGAASTOMACH933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03RERFGC1BN000N
FMN2GIPPPPLPGSTOMACH1106p.P1116delc.3334_3336delCCTIn_Frame_Del20.44NCIN87N000N
FMN2GVGIPPPPLSTOMACH1104p.P1116delc.3334_3336delCCTIn_Frame_Del10.44NCIN87Y5120Y
FMN2IPPPPLPGASTOMACH1107p.P1116delc.3334_3336delCCTIn_Frame_Del10.44NCIN87N900N
FMN2VGIPPPPLPSTOMACH1105p.P1116delc.3334_3336delCCTIn_Frame_Del20.44NCIN87N000N
FMN2AGLPPPPPLSTOMACH1171p.P1173Sc.3517C>TMissense_Mutation10.33SH10TCN1400N
FMN2GAGLPPPPPSTOMACH1170p.P1173Sc.3517C>TMissense_Mutation10.33SH10TCN000N
FMN2GLPPPPPLPSTOMACH1172p.P1173Sc.3517C>TMissense_Mutation10.33SH10TCN000N
FMN2LPGAGLPPPSTOMACH1168p.P1173Sc.3517C>TMissense_Mutation10.33SH10TCN100N
FMN2LPPPPPLPGSTOMACH1173p.P1173Sc.3517C>TMissense_Mutation10.33SH10TCN100N
FMN2PGAGLPPPPSTOMACH1169p.P1173Sc.3517C>TMissense_Mutation10.33SH10TCN000N
FMN2PLPGAGLPPSTOMACH1167p.P1173Sc.3517C>TMissense_Mutation10.33SH10TCN000N
FMN2PPLPGAGLPSTOMACH1166p.P1173Sc.3517C>TMissense_Mutation10.33SH10TCN000N
FMN2PPPLPGAGLSTOMACH1165p.P1173Sc.3517C>TMissense_Mutation10.33SH10TCN900N
GATA1AGLAYGKTGSTOMACH94p.W96Lc.287G>TMissense_Mutation10.11GSUN000N
GATA1GGSPYAGLASTOMACH89p.W96Lc.287G>TMissense_Mutation10.11GSUN100N
GATA1GLAYGKTGLSTOMACH95p.W96Lc.287G>TMissense_Mutation10.11GSUN800N
GATA1GSPYAGLAYSTOMACH90p.W96Lc.287G>TMissense_Mutation10.11GSUN600N
GATA1LAYGKTGLYSTOMACH96p.W96Lc.287G>TMissense_Mutation10.11GSUN1100N
GATA1PGGSPYAGLSTOMACH88p.W96Lc.287G>TMissense_Mutation10.11GSUN200N
GATA1PYAGLAYGKSTOMACH92p.W96Lc.287G>TMissense_Mutation10.11GSUN000N
GATA1SPYAGLAYGSTOMACH91p.W96Lc.287G>TMissense_Mutation10.11GSUY1100N
GATA1YAGLAYGKTSTOMACH93p.W96Lc.287G>TMissense_Mutation10.11GSUN700N
GATA1AEAYRRSPVSTOMACH66p.H71Rc.212A>GMissense_Mutation10.22SNU520N700N
GATA1AYRRSPVFQSTOMACH68p.H71Rc.212A>GMissense_Mutation10.22SNU520Y0100N
GATA1DAEAYRRSPSTOMACH65p.H71Rc.212A>GMissense_Mutation10.22SNU520N000N
GATA1EAYRRSPVFSTOMACH67p.H71Rc.212A>GMissense_Mutation10.22SNU520N1200N
GATA1RDAEAYRRSSTOMACH64p.H71Rc.212A>GMissense_Mutation10.22SNU520N300N
GATA1RRSPVFQVYSTOMACH70p.H71Rc.212A>GMissense_Mutation10.22SNU520Y4110N
GATA1RSPVFQVYPSTOMACH71p.H71Rc.212A>GMissense_Mutation10.22SNU520N100N
GATA1YRDAEAYRRSTOMACH63p.H71Rc.212A>GMissense_Mutation10.22SNU520Y593N
GATA1YRRSPVFQVSTOMACH69p.H71Rc.212A>GMissense_Mutation10.22SNU520Y7939N
GPR112DFLEEVTHMSTOMACH34p.D34fsc.102_102delTFrame_Shift_Del50.222313287Y390N
GPR112GKKLDFLEESTOMACH30p.D34fsc.102_102delTFrame_Shift_Del30.222313287N000N
GPR112KGKKLDFLESTOMACH29p.D34fsc.102_102delTFrame_Shift_Del20.222313287N000Y
GPR112KKLDFLEEVSTOMACH31p.D34fsc.102_102delTFrame_Shift_Del40.222313287N700N
GPR112KLDFLEEVTSTOMACH32p.D34fsc.102_102delTFrame_Shift_Del50.222313287N000N
GPR112LDFLEEVTHSTOMACH33p.D34fsc.102_102delTFrame_Shift_Del50.222313287N000N
GPR112LKGKKLDFLSTOMACH28p.D34fsc.102_102delTFrame_Shift_Del10.222313287N700Y
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.72313287N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7AGSN000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7ECC10N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7ECC12N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7FU97N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7GCIYN000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7GSSN000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7GSUN000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HGC27N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7IM95N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KATOIIIN000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KE39N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7LMSUN000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7MKN1N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7MKN74N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7MKN7N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7NCCSTCK140N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7NCIN87N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7NUGC3N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7NUGC4N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SH10TCN000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU1N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU216N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU520N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU5N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU601N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU620N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU668N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU719N000N
GPR112ASISDMFIQSTOMACH2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TGBC11TKBN000N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.72313287Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7AGSY11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7ECC10Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7ECC12Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7FU97Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7GCIYY11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7GSSY11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7GSUY11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HGC27Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7IM95Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KATOIIIY11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KE39Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7LMSUY11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7MKN1Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7MKN74Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7MKN7Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7NCCSTCK140Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7NCIN87Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7NUGC3Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7NUGC4Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SH10TCY11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU1Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU216Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU520Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU5Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU601Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU620Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU668Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU719Y11100N
GPR112ISDMFIQNLSTOMACH2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TGBC11TKBY11100N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.72313287N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7AGSN700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7ECC10N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7ECC12N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7FU97N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7GCIYN700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7GSSN700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7GSUN700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HGC27N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7IM95N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KATOIIIN700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KE39N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7LMSUN700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7MKN1N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7MKN74N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7MKN7N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7NCCSTCK140N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7NCIN87N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7NUGC3N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7NUGC4N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SH10TCN700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU1N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU216N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU520N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU5N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU601N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU620N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU668N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU719N700N
GPR112SASISDMFISTOMACH2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TGBC11TKBN700N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.72313287N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7AGSN400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7ECC10N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7ECC12N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7FU97N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7GCIYN400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7GSSN400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7GSUN400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HGC27N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7IM95N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KATOIIIN400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KE39N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7LMSUN400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7MKN1N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7MKN74N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7MKN7N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7NCCSTCK140N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7NCIN87N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7NUGC3N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7NUGC4N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SH10TCN400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU1N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU216N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU520N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU5N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU601N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU620N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU668N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU719N400N
GPR112SDMFIQNLASTOMACH2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TGBC11TKBN400N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.72313287N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7AGSN000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7ECC10N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7ECC12N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7FU97N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7GCIYN000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7GSSN000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7GSUN000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HGC27N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7IM95N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KATOIIIN000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KE39N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7LMSUN000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7MKN1N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7MKN74N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7MKN7N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7NCCSTCK140N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7NCIN87N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7NUGC3N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7NUGC4N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SH10TCN000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU1N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU216N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU520N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU5N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU601N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU620N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU668N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU719N000N
GPR112SISDMFIQNSTOMACH2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TGBC11TKBN000N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.72313287N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7AGSN900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7ECC10N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7ECC12N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7FU97N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7GCIYN900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7GSSN900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7GSUN900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HGC27N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7IM95N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KATOIIIN900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KE39N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7LMSUN900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7MKN1N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7MKN74N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7MKN7N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7NCCSTCK140N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7NCIN87N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7NUGC3N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7NUGC4N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SH10TCN900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU1N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU216N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU520N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU5N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU601N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU620N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU668N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU719N900N
GPR112VSASISDMFSTOMACH2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TGBC11TKBN900N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.72313287N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7AGSN5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7ECC10N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7ECC12N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7FU97N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7GCIYN5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7GSSN5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7GSUN5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HGC27N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7IM95N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KATOIIIN5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KE39N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7LMSUN5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7MKN1N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7MKN74N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7MKN7N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7NCCSTCK140N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7NCIN87N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7NUGC3N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7NUGC4N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SH10TCN5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU1N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU216N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU520N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU5N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU601N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU620N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU668N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU719N5020N
GPR112VVSASISDMSTOMACH2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TGBC11TKBN5020N
GPR112AGDPQQLILSTOMACH93p.H96Pc.287A>CMissense_Mutation10.11AGSN1100N
GPR112CSISINMGKSTOMACH2426p.T2432Mc.7295C>TMissense_Mutation10.11SNU520N300N
GPR112DLGLAGDPQSTOMACH89p.H96Pc.287A>CMissense_Mutation10.11AGSN000N
GPR112DPQQLILYRSTOMACH95p.H96Pc.287A>CMissense_Mutation10.11AGSN400N
GPR112DVSEEEMVMSTOMACH2297p.I2298Vc.6892A>GMissense_Mutation10.11MKN7N400N
GPR112ETQIKSRDVSTOMACH2290p.I2298Vc.6892A>GMissense_Mutation10.11MKN7N200N
GPR112FCSISINMGSTOMACH2425p.T2432Mc.7295C>TMissense_Mutation10.11SNU520N201N
GPR112FSRKTMSLSSTOMACH2126p.P2133Lc.6398C>TMissense_Mutation10.112313287N202Y
GPR112GDPQQLILYSTOMACH94p.H96Pc.287A>CMissense_Mutation10.11AGSN400Y
GPR112GLAGDPQQLSTOMACH91p.H96Pc.287A>CMissense_Mutation10.11AGSN1000N
GPR112IDLGLAGDPSTOMACH88p.H96Pc.287A>CMissense_Mutation10.11AGSN000N
GPR112IKSRDVSEESTOMACH2293p.I2298Vc.6892A>GMissense_Mutation10.11MKN7N006N
GPR112INMGKSQWESTOMACH2430p.T2432Mc.7295C>TMissense_Mutation10.11SNU520N001N
GPR112ISINMGKSQSTOMACH2428p.T2432Mc.7295C>TMissense_Mutation10.11SNU520N000N
GPR112KSRDVSEEESTOMACH2294p.I2298Vc.6892A>GMissense_Mutation10.11MKN7N100N
GPR112KTMSLSTTDSTOMACH2129p.P2133Lc.6398C>TMissense_Mutation10.112313287N100N
GPR112LAGDPQQLISTOMACH92p.H96Pc.287A>CMissense_Mutation10.11AGSN900N
GPR112LGLAGDPQQSTOMACH90p.H96Pc.287A>CMissense_Mutation10.11AGSN000N
GPR112LSTTDHTLSSTOMACH2133p.P2133Lc.6398C>TMissense_Mutation10.112313287N000N
GPR112MGKSQWEKPSTOMACH2432p.T2432Mc.7295C>TMissense_Mutation10.11SNU520N000N
GPR112MSLSTTDHTSTOMACH2131p.P2133Lc.6398C>TMissense_Mutation10.112313287N100N
GPR112NMGKSQWEKSTOMACH2431p.T2432Mc.7295C>TMissense_Mutation10.11SNU520N500N
GPR112PQQLILYRLSTOMACH96p.H96Pc.287A>CMissense_Mutation10.11AGSN100N
GPR112QIKSRDVSESTOMACH2292p.I2298Vc.6892A>GMissense_Mutation10.11MKN7N000N
GPR112RDVSEEEMVSTOMACH2296p.I2298Vc.6892A>GMissense_Mutation10.11MKN7N500N
GPR112RFCSISINMSTOMACH2424p.T2432Mc.7295C>TMissense_Mutation10.11SNU520Y490N
GPR112RKTMSLSTTSTOMACH2128p.P2133Lc.6398C>TMissense_Mutation10.112313287N100N
GPR112SFSRKTMSLSTOMACH2125p.P2133Lc.6398C>TMissense_Mutation10.112313287Y790Y
GPR112SINMGKSQWSTOMACH2429p.T2432Mc.7295C>TMissense_Mutation10.11SNU520N000N
GPR112SISINMGKSSTOMACH2427p.T2432Mc.7295C>TMissense_Mutation10.11SNU520N000N
GPR112SLSTTDHTLSTOMACH2132p.P2133Lc.6398C>TMissense_Mutation10.112313287Y890N
GPR112SRDVSEEEMSTOMACH2295p.I2298Vc.6892A>GMissense_Mutation10.11MKN7Y490N
GPR112SRKTMSLSTSTOMACH2127p.P2133Lc.6398C>TMissense_Mutation10.112313287N200Y
GPR112TMSLSTTDHSTOMACH2130p.P2133Lc.6398C>TMissense_Mutation10.112313287N000N
GPR112TQIKSRDVSSTOMACH2291p.I2298Vc.6892A>GMissense_Mutation10.11MKN7N000N
GPR112VSEEEMVMDSTOMACH2298p.I2298Vc.6892A>GMissense_Mutation10.11MKN7N000N
GPR112IYQMSSLSVSTOMACH1510p.P1517Sc.4549C>TMissense_Mutation10.55LMSUN5022N
GPR112IYQMSSLSVSTOMACH1510p.P1517Sc.4549C>TMissense_Mutation10.55SNU620N5022N
GPR112LSVNVTAFTSTOMACH1516p.P1517Sc.4549C>TMissense_Mutation10.55LMSUN100N
GPR112LSVNVTAFTSTOMACH1516p.P1517Sc.4549C>TMissense_Mutation10.55SNU620N100N
GPR112MSSLSVNVTSTOMACH1513p.P1517Sc.4549C>TMissense_Mutation10.55LMSUN100N
GPR112MSSLSVNVTSTOMACH1513p.P1517Sc.4549C>TMissense_Mutation10.55SNU620N100N
GPR112PIYQMSSLSSTOMACH1509p.P1517Sc.4549C>TMissense_Mutation10.55LMSUN000N
GPR112PIYQMSSLSSTOMACH1509p.P1517Sc.4549C>TMissense_Mutation10.55SNU620N000N
GPR112QMSSLSVNVSTOMACH1512p.P1517Sc.4549C>TMissense_Mutation10.55LMSUY4130N
GPR112QMSSLSVNVSTOMACH1512p.P1517Sc.4549C>TMissense_Mutation10.55SNU620Y4130N
GPR112SLSVNVTAFSTOMACH1515p.P1517Sc.4549C>TMissense_Mutation10.55LMSUY4100N
GPR112SLSVNVTAFSTOMACH1515p.P1517Sc.4549C>TMissense_Mutation10.55SNU620Y4100N
GPR112SSLSVNVTASTOMACH1514p.P1517Sc.4549C>TMissense_Mutation10.55LMSUN400N
GPR112SSLSVNVTASTOMACH1514p.P1517Sc.4549C>TMissense_Mutation10.55SNU620N400N
GPR112SVNVTAFTSSTOMACH1517p.P1517Sc.4549C>TMissense_Mutation10.55LMSUN000N
GPR112SVNVTAFTSSTOMACH1517p.P1517Sc.4549C>TMissense_Mutation10.55SNU620N000N
GPR112YQMSSLSVNSTOMACH1511p.P1517Sc.4549C>TMissense_Mutation10.55LMSUN202N
GPR112YQMSSLSVNSTOMACH1511p.P1517Sc.4549C>TMissense_Mutation10.55SNU620N202N
HSP90B1DEEETAKESSTOMACH787p.E791delc.2362_2364delGAAIn_Frame_Del121.79AGSN300N
HSP90B1DEEETAKESSTOMACH787p.E791delc.2362_2364delGAAIn_Frame_Del121.79GCIYN300N
HSP90B1DEEETAKESSTOMACH787p.E791delc.2362_2364delGAAIn_Frame_Del121.79HUG1NN300N
HSP90B1DEEETAKESSTOMACH787p.E791delc.2362_2364delGAAIn_Frame_Del121.79IM95N300N
HSP90B1DEEETAKESSTOMACH787p.E791delc.2362_2364delGAAIn_Frame_Del121.79LMSUN300N
HSP90B1DEEETAKESSTOMACH787p.E791delc.2362_2364delGAAIn_Frame_Del121.79NCCSTCK140N300N
HSP90B1DEEETAKESSTOMACH787p.E791delc.2362_2364delGAAIn_Frame_Del121.79RERFGC1BN300N
HSP90B1DEEETAKESSTOMACH787p.E791delc.2362_2364delGAAIn_Frame_Del121.79SH10TCN300N
HSP90B1DEEETAKESSTOMACH787p.E791delc.2362_2364delGAAIn_Frame_Del121.79SNU1N300N
HSP90B1DEEETAKESSTOMACH787p.E791delc.2362_2364delGAAIn_Frame_Del121.79SNU520N300N
HSP90B1DEEETAKESSTOMACH787p.E791delc.2362_2364delGAAIn_Frame_Del121.79SNU5N300N
HSP90B1DVGTDEEETSTOMACH783p.E791delc.2362_2364delGAAIn_Frame_Del121.79AGSN200N
HSP90B1DVGTDEEETSTOMACH783p.E791delc.2362_2364delGAAIn_Frame_Del121.79GCIYN200N
HSP90B1DVGTDEEETSTOMACH783p.E791delc.2362_2364delGAAIn_Frame_Del121.79HUG1NN200N
HSP90B1DVGTDEEETSTOMACH783p.E791delc.2362_2364delGAAIn_Frame_Del121.79IM95N200N
HSP90B1DVGTDEEETSTOMACH783p.E791delc.2362_2364delGAAIn_Frame_Del121.79LMSUN200N
HSP90B1DVGTDEEETSTOMACH783p.E791delc.2362_2364delGAAIn_Frame_Del121.79NCCSTCK140N200N
HSP90B1DVGTDEEETSTOMACH783p.E791delc.2362_2364delGAAIn_Frame_Del121.79RERFGC1BN200N
HSP90B1DVGTDEEETSTOMACH783p.E791delc.2362_2364delGAAIn_Frame_Del121.79SH10TCN200N
HSP90B1DVGTDEEETSTOMACH783p.E791delc.2362_2364delGAAIn_Frame_Del121.79SNU1N200N
HSP90B1DVGTDEEETSTOMACH783p.E791delc.2362_2364delGAAIn_Frame_Del121.79SNU520N200N
HSP90B1DVGTDEEETSTOMACH783p.E791delc.2362_2364delGAAIn_Frame_Del121.79SNU5N200N
HSP90B1GTDEEETAKSTOMACH785p.E791delc.2362_2364delGAAIn_Frame_Del321.79AGSN400N
HSP90B1GTDEEETAKSTOMACH785p.E791delc.2362_2364delGAAIn_Frame_Del321.79GCIYN400N
HSP90B1GTDEEETAKSTOMACH785p.E791delc.2362_2364delGAAIn_Frame_Del321.79HUG1NN400N
HSP90B1GTDEEETAKSTOMACH785p.E791delc.2362_2364delGAAIn_Frame_Del321.79IM95N400N
HSP90B1GTDEEETAKSTOMACH785p.E791delc.2362_2364delGAAIn_Frame_Del321.79LMSUN400N
HSP90B1GTDEEETAKSTOMACH785p.E791delc.2362_2364delGAAIn_Frame_Del321.79NCCSTCK140N400N
HSP90B1GTDEEETAKSTOMACH785p.E791delc.2362_2364delGAAIn_Frame_Del321.79RERFGC1BN400N
HSP90B1GTDEEETAKSTOMACH785p.E791delc.2362_2364delGAAIn_Frame_Del321.79SH10TCN400N
HSP90B1GTDEEETAKSTOMACH785p.E791delc.2362_2364delGAAIn_Frame_Del321.79SNU1N400N
HSP90B1GTDEEETAKSTOMACH785p.E791delc.2362_2364delGAAIn_Frame_Del321.79SNU520N400N
HSP90B1GTDEEETAKSTOMACH785p.E791delc.2362_2364delGAAIn_Frame_Del321.79SNU5N400N
HSP90B1TDEEETAKESTOMACH786p.E791delc.2362_2364delGAAIn_Frame_Del221.79AGSN000N
HSP90B1TDEEETAKESTOMACH786p.E791delc.2362_2364delGAAIn_Frame_Del221.79GCIYN000N
HSP90B1TDEEETAKESTOMACH786p.E791delc.2362_2364delGAAIn_Frame_Del221.79HUG1NN000N
HSP90B1TDEEETAKESTOMACH786p.E791delc.2362_2364delGAAIn_Frame_Del221.79IM95N000N
HSP90B1TDEEETAKESTOMACH786p.E791delc.2362_2364delGAAIn_Frame_Del221.79LMSUN000N
HSP90B1TDEEETAKESTOMACH786p.E791delc.2362_2364delGAAIn_Frame_Del221.79NCCSTCK140N000N
HSP90B1TDEEETAKESTOMACH786p.E791delc.2362_2364delGAAIn_Frame_Del221.79RERFGC1BN000N
HSP90B1TDEEETAKESTOMACH786p.E791delc.2362_2364delGAAIn_Frame_Del221.79SH10TCN000N
HSP90B1TDEEETAKESTOMACH786p.E791delc.2362_2364delGAAIn_Frame_Del221.79SNU1N000N
HSP90B1TDEEETAKESTOMACH786p.E791delc.2362_2364delGAAIn_Frame_Del221.79SNU520N000N
HSP90B1TDEEETAKESTOMACH786p.E791delc.2362_2364delGAAIn_Frame_Del221.79SNU5N000N
HSP90B1VGTDEEETASTOMACH784p.E791delc.2362_2364delGAAIn_Frame_Del221.79AGSN100N
HSP90B1VGTDEEETASTOMACH784p.E791delc.2362_2364delGAAIn_Frame_Del221.79GCIYN100N
HSP90B1VGTDEEETASTOMACH784p.E791delc.2362_2364delGAAIn_Frame_Del221.79HUG1NN100N
HSP90B1VGTDEEETASTOMACH784p.E791delc.2362_2364delGAAIn_Frame_Del221.79IM95N100N
HSP90B1VGTDEEETASTOMACH784p.E791delc.2362_2364delGAAIn_Frame_Del221.79LMSUN100N
HSP90B1VGTDEEETASTOMACH784p.E791delc.2362_2364delGAAIn_Frame_Del221.79NCCSTCK140N100N
HSP90B1VGTDEEETASTOMACH784p.E791delc.2362_2364delGAAIn_Frame_Del221.79RERFGC1BN100N
HSP90B1VGTDEEETASTOMACH784p.E791delc.2362_2364delGAAIn_Frame_Del221.79SH10TCN100N
HSP90B1VGTDEEETASTOMACH784p.E791delc.2362_2364delGAAIn_Frame_Del221.79SNU1N100N
HSP90B1VGTDEEETASTOMACH784p.E791delc.2362_2364delGAAIn_Frame_Del221.79SNU520N100N
HSP90B1VGTDEEETASTOMACH784p.E791delc.2362_2364delGAAIn_Frame_Del221.79SNU5N100N
KITAYGLIKSNASTOMACH608p.D615Nc.1843G>AMissense_Mutation10.11LMSUY390N
KITCQGKHLPKDSTOMACH151p.P155Hc.464C>AMissense_Mutation10.11SNU1N000N
KITGCQGKHLPKSTOMACH150p.P155Hc.464C>AMissense_Mutation10.11SNU1N200N
KITGKHLPKDLRSTOMACH153p.P155Hc.464C>AMissense_Mutation10.11SNU1N100N
KITGLIKSNAAMSTOMACH610p.D615Nc.1843G>AMissense_Mutation10.11LMSUN700N
KITHLPKDLRFISTOMACH155p.P155Hc.464C>AMissense_Mutation10.11SNU1N900N
KITIKSNAAMTVSTOMACH612p.D615Nc.1843G>AMissense_Mutation10.11LMSUN404N
KITKGCQGKHLPSTOMACH149p.P155Hc.464C>AMissense_Mutation10.11SNU1N000N
KITKHLPKDLRFSTOMACH154p.P155Hc.464C>AMissense_Mutation10.11SNU1N500N
KITKSNAAMTVASTOMACH613p.D615Nc.1843G>AMissense_Mutation10.11LMSUY290N
KITLIKSNAAMTSTOMACH611p.D615Nc.1843G>AMissense_Mutation10.11LMSUN000N
KITLKGCQGKHLSTOMACH148p.P155Hc.464C>AMissense_Mutation10.11SNU1N302N
KITNAAMTVAVKSTOMACH615p.D615Nc.1843G>AMissense_Mutation10.11LMSUN300N
KITQGKHLPKDLSTOMACH152p.P155Hc.464C>AMissense_Mutation10.11SNU1N900N
KITSLKGCQGKHSTOMACH147p.P155Hc.464C>AMissense_Mutation10.11SNU1N000N
KITSNAAMTVAVSTOMACH614p.D615Nc.1843G>AMissense_Mutation10.11LMSUY2160N
KITTAYGLIKSNSTOMACH607p.D615Nc.1843G>AMissense_Mutation10.11LMSUN300N
KITYGLIKSNAASTOMACH609p.D615Nc.1843G>AMissense_Mutation10.11LMSUN5019N
MAML2AGGLGGGLWSTOMACH11p.A17fsc.49_50insGFrame_Shift_Ins30.11IM95N100Y
MAML2APAGGLGGGSTOMACH9p.A17fsc.49_50insGFrame_Shift_Ins10.11IM95N000Y
MAML2APPGSDRCLSTOMACH39p.A17fsc.49_50insGFrame_Shift_Ins40.11IM95Y18100N
MAML2APWRGLSHPSTOMACH22p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N100N
MAML2AQCYRGAPPSTOMACH33p.A17fsc.49_50insGFrame_Shift_Ins60.11IM95N000N
MAML2CLPPTPPELSTOMACH46p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95Y1590N
MAML2CYRGAPPGSSTOMACH35p.A17fsc.49_50insGFrame_Shift_Ins60.11IM95N000N
MAML2DRCLPPTPPSTOMACH44p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N000N
MAML2ESAQCYRGASTOMACH31p.A17fsc.49_50insGFrame_Shift_Ins60.11IM95N200N
MAML2GAPPGSDRCSTOMACH38p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N500N
MAML2GAPWRGLSHSTOMACH21p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N000N
MAML2GGAPWRGLSSTOMACH20p.A17fsc.49_50insGFrame_Shift_Ins40.11IM95N000N
MAML2GGGLWGGAPSTOMACH15p.A17fsc.49_50insGFrame_Shift_Ins40.11IM95N000N
MAML2GGLGGGLWGSTOMACH12p.A17fsc.49_50insGFrame_Shift_Ins40.11IM95N000Y
MAML2GGLWGGAPWSTOMACH16p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N200N
MAML2GLGGGLWGGSTOMACH13p.A17fsc.49_50insGFrame_Shift_Ins40.11IM95N000Y
MAML2GLSHPESAQSTOMACH26p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N000N
MAML2GLWGGAPWRSTOMACH17p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N800N
MAML2GSDRCLPPTSTOMACH42p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N100N
MAML2HPESAQCYRSTOMACH29p.A17fsc.49_50insGFrame_Shift_Ins60.11IM95N500N
MAML2LGGGLWGGASTOMACH14p.A17fsc.49_50insGFrame_Shift_Ins40.11IM95N100Y
MAML2LSHPESAQCSTOMACH27p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N100N
MAML2LWGGAPWRGSTOMACH18p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N000N
MAML2PAGGLGGGLSTOMACH10p.A17fsc.49_50insGFrame_Shift_Ins20.11IM95N100Y
MAML2PESAQCYRGSTOMACH30p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N000N
MAML2PGSDRCLPPSTOMACH41p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N000N
MAML2PPGSDRCLPSTOMACH40p.A17fsc.49_50insGFrame_Shift_Ins40.11IM95N000N
MAML2PWRGLSHPESTOMACH23p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N000N
MAML2QCYRGAPPGSTOMACH34p.A17fsc.49_50insGFrame_Shift_Ins60.11IM95N000N
MAML2RCLPPTPPESTOMACH45p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N000N
MAML2RGAPPGSDRSTOMACH37p.A17fsc.49_50insGFrame_Shift_Ins40.11IM95N000N
MAML2RGLSHPESASTOMACH25p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N300N
MAML2SAQCYRGAPSTOMACH32p.A17fsc.49_50insGFrame_Shift_Ins60.11IM95N000N
MAML2SDRCLPPTPSTOMACH43p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N000N
MAML2SHPESAQCYSTOMACH28p.A17fsc.49_50insGFrame_Shift_Ins60.11IM95N300N
MAML2WGGAPWRGLSTOMACH19p.A17fsc.49_50insGFrame_Shift_Ins40.11IM95N1000N
MAML2WRGLSHPESSTOMACH24p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N3027N
MAML2YRGAPPGSDSTOMACH36p.A17fsc.49_50insGFrame_Shift_Ins50.11IM95N307N
MAML2DLGRQSQRSSTOMACH343p.Q346Rc.1037A>GMissense_Mutation10.11NUGC4N000N
MAML2DPFNIDLGRSTOMACH338p.Q346Rc.1037A>GMissense_Mutation10.11NUGC4N500N
MAML2FNIDLGRQSSTOMACH340p.Q346Rc.1037A>GMissense_Mutation10.11NUGC4N2014N
MAML2GQSKVMVNYSTOMACH505p.A511Vc.1532C>TMissense_Mutation10.11GSUY7120N
MAML2GRQSQRSTPSTOMACH345p.Q346Rc.1037A>GMissense_Mutation10.11NUGC4N100N
MAML2GSGQSKVMVSTOMACH503p.A511Vc.1532C>TMissense_Mutation10.11GSUN400N
MAML2IDLGRQSQRSTOMACH342p.Q346Rc.1037A>GMissense_Mutation10.11NUGC4N000N
MAML2IREQKQQLLSTOMACH764p.M765Rc.2294T>GMissense_Mutation10.11SNU601Y990N
MAML2KQTLQRQIRSTOMACH757p.M765Rc.2294T>GMissense_Mutation10.11SNU601N600Y
MAML2KVMVNYMYKSTOMACH508p.A511Vc.1532C>TMissense_Mutation10.11GSUY6150Y
MAML2LGRQSQRSTSTOMACH344p.Q346Rc.1037A>GMissense_Mutation10.11NUGC4N100N
MAML2LQRQIREQKSTOMACH760p.M765Rc.2294T>GMissense_Mutation10.11SNU601N308N
MAML2MVNYMYKAGSTOMACH510p.A511Vc.1532C>TMissense_Mutation10.11GSUN006N
MAML2NIDLGRQSQSTOMACH341p.Q346Rc.1037A>GMissense_Mutation10.11NUGC4N000N
MAML2PFNIDLGRQSTOMACH339p.Q346Rc.1037A>GMissense_Mutation10.11NUGC4N000N
MAML2QIREQKQQLSTOMACH763p.M765Rc.2294T>GMissense_Mutation10.11SNU601N400N
MAML2QRQIREQKQSTOMACH761p.M765Rc.2294T>GMissense_Mutation10.11SNU601N100N
MAML2QSKVMVNYMSTOMACH506p.A511Vc.1532C>TMissense_Mutation10.11GSUY3100N
MAML2QTLQRQIRESTOMACH758p.M765Rc.2294T>GMissense_Mutation10.11SNU601N000Y
MAML2REQKQQLLLSTOMACH765p.M765Rc.2294T>GMissense_Mutation10.11SNU601N1100N
MAML2RQIREQKQQSTOMACH762p.M765Rc.2294T>GMissense_Mutation10.11SNU601N000N
MAML2RQSQRSTPRSTOMACH346p.Q346Rc.1037A>GMissense_Mutation10.11NUGC4N700N
MAML2SGQSKVMVNSTOMACH504p.A511Vc.1532C>TMissense_Mutation10.11GSUN100N
MAML2SKVMVNYMYSTOMACH507p.A511Vc.1532C>TMissense_Mutation10.11GSUN500N
MAML2TLQRQIREQSTOMACH759p.M765Rc.2294T>GMissense_Mutation10.11SNU601N000Y
MAML2VMVNYMYKASTOMACH509p.A511Vc.1532C>TMissense_Mutation10.11GSUN800Y
MAML2VNYMYKAGPSTOMACH511p.A511Vc.1532C>TMissense_Mutation10.11GSUN0023N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.442313287N000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44AGSN000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44ECC12N000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44GCIYN000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44GSUN000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HGC27N000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HS746TN000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HUG1NN000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44IM95N000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KE39N000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44MKN1N000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44MKN7N000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44NCCSTCK140N000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44NUGC3N000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44NUGC4N000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44RERFGC1BN000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SH10TCN000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SNU216N000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SNU520N000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SNU5N000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SNU620N000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SNU668N000N
MAP3K1STTTTTTTESTOMACH941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SNU719N000N
MAP3K1CYVWSVGCASTOMACH1430p.D1431Yc.4291G>TMissense_Mutation10.11NUGC3N300N
MAP3K1GQQYGRSCYSTOMACH1423p.D1431Yc.4291G>TMissense_Mutation10.11NUGC3N600N
MAP3K1GRSCYVWSVSTOMACH1427p.D1431Yc.4291G>TMissense_Mutation10.11NUGC3Y6110N
MAP3K1QQYGRSCYVSTOMACH1424p.D1431Yc.4291G>TMissense_Mutation10.11NUGC3Y11110N
MAP3K1QYGRSCYVWSTOMACH1425p.D1431Yc.4291G>TMissense_Mutation10.11NUGC3N200N
MAP3K1RSCYVWSVGSTOMACH1428p.D1431Yc.4291G>TMissense_Mutation10.11NUGC3N100N
MAP3K1SCYVWSVGCSTOMACH1429p.D1431Yc.4291G>TMissense_Mutation10.11NUGC3N000N
MAP3K1YGRSCYVWSSTOMACH1426p.D1431Yc.4291G>TMissense_Mutation10.11NUGC3N300N
MAP3K1YVWSVGCAISTOMACH1431p.D1431Yc.4291G>TMissense_Mutation10.11NUGC3Y15118N
MAP3K4EYHKEVVWGSTOMACH1045p.V1050fsc.3150_3160delTGTTCGTTTGAFrame_Shift_Del20.11SNU601N000N
MAP3K4FEYHKEVVWSTOMACH1044p.V1050fsc.3150_3160delTGTTCGTTTGAFrame_Shift_Del10.11SNU601N800N
MAP3K4YHKEVVWGVSTOMACH1046p.V1050fsc.3150_3160delTGTTCGTTTGAFrame_Shift_Del30.11SNU601Y5130N
MAP3K4AAAAAAAASSTOMACH1194p.V1200delc.3597_3599delTGTIn_Frame_Del10.11SNU520N100Y
MAP3K4AAAAAAASRSTOMACH1195p.V1200delc.3597_3599delTGTIn_Frame_Del10.11SNU520N300N
MAP3K4AAAAAASRPSTOMACH1196p.V1200delc.3597_3599delTGTIn_Frame_Del10.11SNU520N000N
MAP3K4AAAAASRPSSTOMACH1197p.V1200delc.3597_3599delTGTIn_Frame_Del10.11SNU520N100N
MAP3K4AAAASRPSPSTOMACH1198p.V1200delc.3597_3599delTGTIn_Frame_Del10.11SNU520N000N
MAP3K4AAASRPSPSSTOMACH1199p.V1200delc.3597_3599delTGTIn_Frame_Del10.11SNU520N100N
MAP3K4AIHRNSPHPSTOMACH1143p.R1150Hc.3449G>AMissense_Mutation10.11SNU520N000N
MAP3K4ARRWMNYVLSTOMACH1070p.K1072Rc.3215A>GMissense_Mutation10.11SNU520Y5100N
MAP3K4DKYISFARRSTOMACH1064p.K1072Rc.3215A>GMissense_Mutation10.11SNU520N100N
MAP3K4DNILLVVMQSTOMACH943p.L945Ic.2833C>AMissense_Mutation10.11KE39N000N
MAP3K4FARRWMNYVSTOMACH1069p.K1072Rc.3215A>GMissense_Mutation10.11SNU520Y1191N
MAP3K4GYSNAKLPVSTOMACH192p.C193Yc.578G>AMissense_Mutation10.11FU97N400N
MAP3K4HPMKVPRCHSTOMACH1150p.R1150Hc.3449G>AMissense_Mutation10.11SNU520N100N
MAP3K4HRNSPHPMKSTOMACH1145p.R1150Hc.3449G>AMissense_Mutation10.11SNU520Y2110N
MAP3K4IHRNSPHPMSTOMACH1144p.R1150Hc.3449G>AMissense_Mutation10.11SNU520N4012N
MAP3K4ILLVVMQSASTOMACH945p.L945Ic.2833C>AMissense_Mutation10.11KE39N700N
MAP3K4ISFARRWMNSTOMACH1067p.K1072Rc.3215A>GMissense_Mutation10.11SNU520N000N
MAP3K4KPYLSLGYSSTOMACH186p.C193Yc.578G>AMissense_Mutation10.11FU97N800N
MAP3K4KYISFARRWSTOMACH1065p.K1072Rc.3215A>GMissense_Mutation10.11SNU520Y5100N
MAP3K4LAIHRNSPHSTOMACH1142p.R1150Hc.3449G>AMissense_Mutation10.11SNU520N009N
MAP3K4LGYSNAKLPSTOMACH191p.C193Yc.578G>AMissense_Mutation10.11FU97N000N
MAP3K4LRSMQVDNISTOMACH937p.L945Ic.2833C>AMissense_Mutation10.11KE39Y51434N
MAP3K4LSLGYSNAKSTOMACH189p.C193Yc.578G>AMissense_Mutation10.11FU97N200N
MAP3K4MQVDNILLVSTOMACH940p.L945Ic.2833C>AMissense_Mutation10.11KE39Y12913N
MAP3K4NILLVVMQSSTOMACH944p.L945Ic.2833C>AMissense_Mutation10.11KE39N000N
MAP3K4NKPYLSLGYSTOMACH185p.C193Yc.578G>AMissense_Mutation10.11FU97N200N
MAP3K4NSPHPMKVPSTOMACH1147p.R1150Hc.3449G>AMissense_Mutation10.11SNU520N000N
MAP3K4PHPMKVPRCSTOMACH1149p.R1150Hc.3449G>AMissense_Mutation10.11SNU520N000N
MAP3K4PYLSLGYSNSTOMACH187p.C193Yc.578G>AMissense_Mutation10.11FU97N000N
MAP3K4QVDNILLVVSTOMACH941p.L945Ic.2833C>AMissense_Mutation10.11KE39N500N
MAP3K4RNSPHPMKVSTOMACH1146p.R1150Hc.3449G>AMissense_Mutation10.11SNU520N200N
MAP3K4RRWMNYVLTSTOMACH1071p.K1072Rc.3215A>GMissense_Mutation10.11SNU520N300N
MAP3K4RSMQVDNILSTOMACH938p.L945Ic.2833C>AMissense_Mutation10.11KE39Y13100N
MAP3K4RWMNYVLTKSTOMACH1072p.K1072Rc.3215A>GMissense_Mutation10.11SNU520N300N
MAP3K4SFARRWMNYSTOMACH1068p.K1072Rc.3215A>GMissense_Mutation10.11SNU520Y1120N
MAP3K4SLGYSNAKLSTOMACH190p.C193Yc.578G>AMissense_Mutation10.11FU97N900N
MAP3K4SMQVDNILLSTOMACH939p.L945Ic.2833C>AMissense_Mutation10.11KE39N1300N
MAP3K4SPHPMKVPRSTOMACH1148p.R1150Hc.3449G>AMissense_Mutation10.11SNU520N400N
MAP3K4VDNILLVVMSTOMACH942p.L945Ic.2833C>AMissense_Mutation10.11KE39N700N
MAP3K4YISFARRWMSTOMACH1066p.K1072Rc.3215A>GMissense_Mutation10.11SNU520Y5922N
MAP3K4YLSLGYSNASTOMACH188p.C193Yc.578G>AMissense_Mutation10.11FU97Y8101N
MAP3K4YSNAKLPVSSTOMACH193p.C193Yc.578G>AMissense_Mutation10.11FU97N201N
METANLGHQRVASTOMACH453p.G456fsc.1366_1366delGFrame_Shift_Del50.11MKN74N100N
METASCRLWFLDSTOMACH461p.G456fsc.1366_1366delGFrame_Shift_Del60.11MKN74N000N
METCRLWFLDQDSTOMACH463p.G456fsc.1366_1366delGFrame_Shift_Del60.11MKN74N100N
METDLTIANLGHSTOMACH449p.G456fsc.1366_1366delGFrame_Shift_Del10.11MKN74N000N
METFLDQDHQPLSTOMACH467p.G456fsc.1366_1366delGFrame_Shift_Del60.11MKN74N1400N
METGHQRVASCRSTOMACH456p.G456fsc.1366_1366delGFrame_Shift_Del60.11MKN74N100N
METHQRVASCRLSTOMACH457p.G456fsc.1366_1366delGFrame_Shift_Del60.11MKN74N800N
METIANLGHQRVSTOMACH452p.G456fsc.1366_1366delGFrame_Shift_Del40.11MKN74N500N
METLDQDHQPLMSTOMACH468p.G456fsc.1366_1366delGFrame_Shift_Del60.11MKN74N500N
METLGHQRVASCSTOMACH455p.G456fsc.1366_1366delGFrame_Shift_Del50.11MKN74N105N
METLTIANLGHQSTOMACH450p.G456fsc.1366_1366delGFrame_Shift_Del20.11MKN74N004N
METLWFLDQDHQSTOMACH465p.G456fsc.1366_1366delGFrame_Shift_Del60.11MKN74N000N
METNLGHQRVASSTOMACH454p.G456fsc.1366_1366delGFrame_Shift_Del50.11MKN74N000N
METQRVASCRLWSTOMACH458p.G456fsc.1366_1366delGFrame_Shift_Del60.11MKN74N200N
METRLWFLDQDHSTOMACH464p.G456fsc.1366_1366delGFrame_Shift_Del60.11MKN74N200N
METRVASCRLWFSTOMACH459p.G456fsc.1366_1366delGFrame_Shift_Del60.11MKN74Y5100N
METSCRLWFLDQSTOMACH462p.G456fsc.1366_1366delGFrame_Shift_Del60.11MKN74N000N
METTIANLGHQRSTOMACH451p.G456fsc.1366_1366delGFrame_Shift_Del30.11MKN74N400N
METVASCRLWFLSTOMACH460p.G456fsc.1366_1366delGFrame_Shift_Del60.11MKN74Y18100N
METWFLDQDHQPSTOMACH466p.G456fsc.1366_1366delGFrame_Shift_Del60.11MKN74N200N
METAAIQSEVHCSTOMACH152p.D153Ac.458A>CMissense_Mutation10.11SNU719N300N
METAIQSEVHCISTOMACH153p.D153Ac.458A>CMissense_Mutation10.11SNU719N300N
METARSVSSTTESTOMACH1004p.P1009Sc.3025C>TMissense_Mutation10.11ECC12N100N
METFPHNHTAAISTOMACH146p.D153Ac.458A>CMissense_Mutation10.11SNU719N1303N
METHNHTAAIQSSTOMACH148p.D153Ac.458A>CMissense_Mutation10.11SNU719N000N
METHTAAIQSEVSTOMACH150p.D153Ac.458A>CMissense_Mutation10.11SNU719N200N
METLVSARSVSSSTOMACH1001p.P1009Sc.3025C>TMissense_Mutation10.11ECC12N0036N
METNHTAAIQSESTOMACH149p.D153Ac.458A>CMissense_Mutation10.11SNU719N000N
METPHNHTAAIQSTOMACH147p.D153Ac.458A>CMissense_Mutation10.11SNU719N000N
METRSVSSTTEMSTOMACH1005p.P1009Sc.3025C>TMissense_Mutation10.11ECC12N800N
METSARSVSSTTSTOMACH1003p.P1009Sc.3025C>TMissense_Mutation10.11ECC12N400N
METSSTTEMVSNSTOMACH1008p.P1009Sc.3025C>TMissense_Mutation10.11ECC12N000N
METSTTEMVSNESTOMACH1009p.P1009Sc.3025C>TMissense_Mutation10.11ECC12N000N
METSVSSTTEMVSTOMACH1006p.P1009Sc.3025C>TMissense_Mutation10.11ECC12N100N
METTAAIQSEVHSTOMACH151p.D153Ac.458A>CMissense_Mutation10.11SNU719N000N
METVFPHNHTAASTOMACH145p.D153Ac.458A>CMissense_Mutation10.11SNU719N300N
METVSARSVSSTSTOMACH1002p.P1009Sc.3025C>TMissense_Mutation10.11ECC12N100N
METVSSTTEMVSSTOMACH1007p.P1009Sc.3025C>TMissense_Mutation10.11ECC12N000N
MLL3GTRKQNSGSSTOMACH2797p.K2797fsc.8389_8390delAAFrame_Shift_Del41.11SNU1N000Y
MLL3KGTRKQNSGSTOMACH2796p.K2797fsc.8389_8390delAAFrame_Shift_Del51.11SNU1N000N
MLL3KKGTRKQNSSTOMACH2795p.K2797fsc.8389_8390delAAFrame_Shift_Del41.11SNU1N100N
MLL3TRKQNSGSLSTOMACH2798p.K2797fsc.8389_8390delAAFrame_Shift_Del41.11SNU1N500Y
MLL3CVSVEPKKRSTOMACH2789p.K2797fsc.8390_8390delAFrame_Shift_Del12.1SNU520N400N
MLL3EPKKRNKKTSTOMACH2793p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU520N600N
MLL3FSLINIHHRSTOMACH2805p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU520Y695N
MLL3HHRKNPLLPSTOMACH2811p.K2797fsc.8390_8390delAFrame_Shift_Del42.1SNU520N000Y
MLL3HRKNPLLPMSTOMACH2812p.K2797fsc.8390_8390delAFrame_Shift_Del42.1SNU520Y490N
MLL3IHHRKNPLLSTOMACH2810p.K2797fsc.8390_8390delAFrame_Shift_Del42.1SNU520N700Y
MLL3INIHHRKNPSTOMACH2808p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU520N0011Y
MLL3KKRNKKTKLSTOMACH2795p.K2797fsc.8390_8390delAFrame_Shift_Del42.1SNU520N500N
MLL3KKTKLWFSLSTOMACH2799p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU520N500N
MLL3KLWFSLINISTOMACH2802p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU520Y12120N
MLL3KRNKKTKLWSTOMACH2796p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU520Y490N
MLL3KTKLWFSLISTOMACH2800p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU520Y7120N
MLL3LINIHHRKNSTOMACH2807p.K2797fsc.8390_8390delAFrame_Shift_Del62.1SNU520N001N
MLL3LWFSLINIHSTOMACH2803p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU520N004N
MLL3NIHHRKNPLSTOMACH2809p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU520N800N
MLL3NKKTKLWFSSTOMACH2798p.K2797fsc.8390_8390delAFrame_Shift_Del42.1SNU520N100N
MLL3PKKRNKKTKSTOMACH2794p.K2797fsc.8390_8390delAFrame_Shift_Del42.1SNU520N100N
MLL3RKNPLLPMRSTOMACH2813p.K2797fsc.8390_8390delAFrame_Shift_Del42.1SNU520N100N
MLL3RNKKTKLWFSTOMACH2797p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU520Y5110N
MLL3SLINIHHRKSTOMACH2806p.K2797fsc.8390_8390delAFrame_Shift_Del62.1SNU520Y6130N
MLL3SVEPKKRNKSTOMACH2791p.K2797fsc.8390_8390delAFrame_Shift_Del32.1SNU520N300N
MLL3TKLWFSLINSTOMACH2801p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU520N100N
MLL3VEPKKRNKKSTOMACH2792p.K2797fsc.8390_8390delAFrame_Shift_Del42.1SNU520N106N
MLL3VSVEPKKRNSTOMACH2790p.K2797fsc.8390_8390delAFrame_Shift_Del22.1SNU520N100N
MLL3WFSLINIHHSTOMACH2804p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU520N2015N
MLL3CVSVEPKKGSTOMACH2789p.K2797fsc.8389_8390delAAFrame_Shift_Del10.33SNU1N000N
MLL3EPKKGTRKQSTOMACH2793p.K2797fsc.8389_8390delAAFrame_Shift_Del40.33SNU1N000Y
MLL3PKKGTRKQNSTOMACH2794p.K2797fsc.8389_8390delAAFrame_Shift_Del40.33SNU1N000Y
MLL3SVEPKKGTRSTOMACH2791p.K2797fsc.8389_8390delAAFrame_Shift_Del30.33SNU1N600N
MLL3VEPKKGTRKSTOMACH2792p.K2797fsc.8389_8390delAAFrame_Shift_Del40.33SNU1N100Y
MLL3VSVEPKKGTSTOMACH2790p.K2797fsc.8389_8390delAAFrame_Shift_Del20.33SNU1N100N
MLL3AIKAQCMFLSTOMACH4488p.F4496fsc.13488_13488delTFrame_Shift_Del10.55IM95Y4100N
MLL3APCTNQREFSTOMACH4503p.F4496fsc.13488_13488delTFrame_Shift_Del40.55IM95Y12100N
MLL3AQCMFLRTKSTOMACH4491p.F4496fsc.13488_13488delTFrame_Shift_Del30.55IM95Y1130N
MLL3CFAPCTNQRSTOMACH4501p.F4496fsc.13488_13488delTFrame_Shift_Del40.55IM95Y290N
MLL3CMFLRTKLCSTOMACH4493p.F4496fsc.13488_13488delTFrame_Shift_Del50.55IM95N200N
MLL3CTNQREFMSSTOMACH4505p.F4496fsc.13488_13488delTFrame_Shift_Del50.55IM95N000Y
MLL3FAPCTNQRESTOMACH4502p.F4496fsc.13488_13488delTFrame_Shift_Del40.55IM95N201N
MLL3FLRTKLCFASTOMACH4495p.F4496fsc.13488_13488delTFrame_Shift_Del50.55IM95N802N
MLL3IKAQCMFLRSTOMACH4489p.F4496fsc.13488_13488delTFrame_Shift_Del20.55IM95N100N
MLL3KAQCMFLRTSTOMACH4490p.F4496fsc.13488_13488delTFrame_Shift_Del30.55IM95N400N
MLL3KLCFAPCTNSTOMACH4499p.F4496fsc.13488_13488delTFrame_Shift_Del50.55IM95N000N
MLL3LCFAPCTNQSTOMACH4500p.F4496fsc.13488_13488delTFrame_Shift_Del40.55IM95N001N
MLL3LRTKLCFAPSTOMACH4496p.F4496fsc.13488_13488delTFrame_Shift_Del50.55IM95N1015N
MLL3MFLRTKLCFSTOMACH4494p.F4496fsc.13488_13488delTFrame_Shift_Del60.55IM95N6026N
MLL3NQREFMSKNSTOMACH4507p.F4496fsc.13488_13488delTFrame_Shift_Del50.55IM95N100N
MLL3PCTNQREFMSTOMACH4504p.F4496fsc.13488_13488delTFrame_Shift_Del40.55IM95N000N
MLL3QCMFLRTKLSTOMACH4492p.F4496fsc.13488_13488delTFrame_Shift_Del40.55IM95N900N
MLL3RTKLCFAPCSTOMACH4497p.F4496fsc.13488_13488delTFrame_Shift_Del50.55IM95Y290N
MLL3TKLCFAPCTSTOMACH4498p.F4496fsc.13488_13488delTFrame_Shift_Del50.55IM95N100N
MLL3TNQREFMSKSTOMACH4506p.F4496fsc.13488_13488delTFrame_Shift_Del50.55IM95N000N
MLL3GTRKQNSGSSTOMACH2798p.K2797fsc.8390_8391insAFrame_Shift_Ins41.112313287N000Y
MLL3KGTRKQNSGSTOMACH2797p.K2797fsc.8390_8391insAFrame_Shift_Ins51.112313287N000N
MLL3KKGTRKQNSSTOMACH2796p.K2797fsc.8390_8391insAFrame_Shift_Ins41.112313287N100N
MLL3TRKQNSGSLSTOMACH2799p.K2797fsc.8390_8391insAFrame_Shift_Ins41.112313287N500Y
MLL3ESKCETEKKSTOMACH2834p.N2842fsc.8525_8526insAFrame_Shift_Ins10.112313287N200N
MLL3EPKKKGTRKSTOMACH2793p.K2797fsc.8390_8391insAFrame_Shift_Ins30.772313287N200Y
MLL3KKKGTRKQNSTOMACH2795p.K2797fsc.8390_8391insAFrame_Shift_Ins30.772313287N200Y
MLL3PKKKGTRKQSTOMACH2794p.K2797fsc.8390_8391insAFrame_Shift_Ins30.772313287N000Y
MLL3SVEPKKKGTSTOMACH2791p.K2797fsc.8390_8391insAFrame_Shift_Ins20.772313287N200N
MLL3VEPKKKGTRSTOMACH2792p.K2797fsc.8390_8391insAFrame_Shift_Ins30.772313287N003Y
MLL3VSVEPKKKGSTOMACH2790p.K2797fsc.8390_8391insAFrame_Shift_Ins10.772313287N000N
MLL3DLKQVRITPSTOMACH149p.F153Vc.457T>GMissense_Mutation10.11SNU520N000N
MLL3FTKQPPSTSSTOMACH1830p.P1838Sc.5512C>TMissense_Mutation10.11GCIYN201Y
MLL3GDLKQVRITSTOMACH148p.F153Vc.457T>GMissense_Mutation10.11SNU520N400N
MLL3GQGDLKQVRSTOMACH146p.F153Vc.457T>GMissense_Mutation10.11SNU520N600N
MLL3GRSKLKSLISTOMACH908p.G915Lc.2743_2744GG>TTMissense_Mutation10.11SNU601N400N
MLL3KLKSLIGAVSTOMACH911p.G915Lc.2743_2744GG>TTMissense_Mutation10.11SNU601Y6110N
MLL3KQPPSTSTSSTOMACH1832p.P1838Sc.5512C>TMissense_Mutation10.11GCIYN300N
MLL3KQVRITPGFSTOMACH151p.F153Vc.457T>GMissense_Mutation10.11SNU520N1100N
MLL3KSLIGAVVLSTOMACH913p.G915Lc.2743_2744GG>TTMissense_Mutation10.11SNU601N1600N
MLL3LGQGDLKQVSTOMACH145p.F153Vc.457T>GMissense_Mutation10.11SNU520N600N
MLL3LIGAVVLPGSTOMACH915p.G915Lc.2743_2744GG>TTMissense_Mutation10.11SNU601N0026N
MLL3LKQVRITPGSTOMACH150p.F153Vc.457T>GMissense_Mutation10.11SNU520N000N
MLL3LKSLIGAVVSTOMACH912p.G915Lc.2743_2744GG>TTMissense_Mutation10.11SNU601N302N
MLL3PPSTSTSTSSTOMACH1834p.P1838Sc.5512C>TMissense_Mutation10.11GCIYN000N
MLL3PSTSTSTSSSTOMACH1835p.P1838Sc.5512C>TMissense_Mutation10.11GCIYN000N
MLL3QGDLKQVRISTOMACH147p.F153Vc.457T>GMissense_Mutation10.11SNU520N600N
MLL3QPPSTSTSTSTOMACH1833p.P1838Sc.5512C>TMissense_Mutation10.11GCIYN400N
MLL3QVRITPGFISTOMACH152p.F153Vc.457T>GMissense_Mutation10.11SNU520Y3120N
MLL3RGRSKLKSLSTOMACH907p.G915Lc.2743_2744GG>TTMissense_Mutation10.11SNU601N1200N
MLL3RSKLKSLIGSTOMACH909p.G915Lc.2743_2744GG>TTMissense_Mutation10.11SNU601N100N
MLL3SKLKSLIGASTOMACH910p.G915Lc.2743_2744GG>TTMissense_Mutation10.11SNU601N200N
MLL3SLIGAVVLPSTOMACH914p.G915Lc.2743_2744GG>TTMissense_Mutation10.11SNU601N000N
MLL3STSTSSDDVSTOMACH1838p.P1838Sc.5512C>TMissense_Mutation10.11GCIYN100N
MLL3STSTSTSSDSTOMACH1836p.P1838Sc.5512C>TMissense_Mutation10.11GCIYN000N
MLL3TKQPPSTSTSTOMACH1831p.P1838Sc.5512C>TMissense_Mutation10.11GCIYN100N
MLL3TSTSTSSDDSTOMACH1837p.P1838Sc.5512C>TMissense_Mutation10.11GCIYN000N
MLL3VRITPGFILSTOMACH153p.F153Vc.457T>GMissense_Mutation10.11SNU520N1009N
MSH2AVQQKETLQSTOMACH2p.P5Qc.14C>AMissense_Mutation10.11SNU601N000N
MSH2MAVQQKETLSTOMACH1p.P5Qc.14C>AMissense_Mutation10.11SNU601Y16100N
MSH2QKETLQLESSTOMACH5p.P5Qc.14C>AMissense_Mutation10.11SNU601N100N
MSH2QQKETLQLESTOMACH4p.P5Qc.14C>AMissense_Mutation10.11SNU601N000N
MSH2VQQKETLQLSTOMACH3p.P5Qc.14C>AMissense_Mutation10.11SNU601N14021N
MSH2IKALEKHEGSTOMACH418p.Q419Kc.1255C>AMissense_Mutation10.66NCCSTCK140N0018N
MSH2INQLPNVIKSTOMACH411p.Q419Kc.1255C>AMissense_Mutation10.66NCCSTCK140N005Y
MSH2KALEKHEGKSTOMACH419p.Q419Kc.1255C>AMissense_Mutation10.66NCCSTCK140N400N
MSH2LPNVIKALESTOMACH414p.Q419Kc.1255C>AMissense_Mutation10.66NCCSTCK140N202N
MSH2NQLPNVIKASTOMACH412p.Q419Kc.1255C>AMissense_Mutation10.66NCCSTCK140Y790N
MSH2NVIKALEKHSTOMACH416p.Q419Kc.1255C>AMissense_Mutation10.66NCCSTCK140N100N
MSH2PNVIKALEKSTOMACH415p.Q419Kc.1255C>AMissense_Mutation10.66NCCSTCK140N000N
MSH2QLPNVIKALSTOMACH413p.Q419Kc.1255C>AMissense_Mutation10.66NCCSTCK140Y15120N
MSH2VIKALEKHESTOMACH417p.Q419Kc.1255C>AMissense_Mutation10.66NCCSTCK140N000N
MSH3ALWECSLPQSTOMACH389p.K381fsc.1141_1141delAFrame_Shift_Del62.65IM95N000N
MSH3ALWECSLPQSTOMACH389p.K381fsc.1141_1141delAFrame_Shift_Del62.65SNU1N000N
MSH3ALWECSLPQSTOMACH389p.K381fsc.1141_1141delAFrame_Shift_Del62.65SNU520N000N
MSH3ALWECSLPQSTOMACH389p.K381fsc.1141_1141delAFrame_Shift_Del62.65TGBC11TKBN000N
MSH3ARLCLIVSRSTOMACH398p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95Y390N
MSH3ARLCLIVSRSTOMACH398p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1Y390N
MSH3ARLCLIVSRSTOMACH398p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520Y390N
MSH3ARLCLIVSRSTOMACH398p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBY390N
MSH3ATFLLALWESTOMACH384p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95N000N
MSH3ATFLLALWESTOMACH384p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1N000N
MSH3ATFLLALWESTOMACH384p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520N000N
MSH3ATFLLALWESTOMACH384p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBN000N
MSH3CLIVSRTLLSTOMACH401p.K381fsc.1141_1141delAFrame_Shift_Del62.65IM95N1400N
MSH3CLIVSRTLLSTOMACH401p.K381fsc.1141_1141delAFrame_Shift_Del62.65SNU1N1400N
MSH3CLIVSRTLLSTOMACH401p.K381fsc.1141_1141delAFrame_Shift_Del62.65SNU520N1400N
MSH3CLIVSRTLLSTOMACH401p.K381fsc.1141_1141delAFrame_Shift_Del62.65TGBC11TKBN1400N
MSH3CSLPQARLCSTOMACH393p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95N200N
MSH3CSLPQARLCSTOMACH393p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1N200N
MSH3CSLPQARLCSTOMACH393p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520N200N
MSH3CSLPQARLCSTOMACH393p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBN200N
MSH3DKKRATFLLSTOMACH380p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95N500N
MSH3DKKRATFLLSTOMACH380p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1N500N
MSH3DKKRATFLLSTOMACH380p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520N500N
MSH3DKKRATFLLSTOMACH380p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBN500N
MSH3ECSLPQARLSTOMACH392p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95Y490N
MSH3ECSLPQARLSTOMACH392p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1Y490N
MSH3ECSLPQARLSTOMACH392p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520Y490N
MSH3ECSLPQARLSTOMACH392p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBY490N
MSH3ENVRDKKRASTOMACH376p.K381fsc.1141_1141delAFrame_Shift_Del22.65IM95N100N
MSH3ENVRDKKRASTOMACH376p.K381fsc.1141_1141delAFrame_Shift_Del22.65SNU1N100N
MSH3ENVRDKKRASTOMACH376p.K381fsc.1141_1141delAFrame_Shift_Del22.65SNU520N100N
MSH3ENVRDKKRASTOMACH376p.K381fsc.1141_1141delAFrame_Shift_Del22.65TGBC11TKBN100N
MSH3FLLALWECSSTOMACH386p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95N203N
MSH3FLLALWECSSTOMACH386p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1N203N
MSH3FLLALWECSSTOMACH386p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520N203N
MSH3FLLALWECSSTOMACH386p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBN203N
MSH3IVSRTLLLVSTOMACH403p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95Y4927N
MSH3IVSRTLLLVSTOMACH403p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1Y4927N
MSH3IVSRTLLLVSTOMACH403p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520Y4927N
MSH3IVSRTLLLVSTOMACH403p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBY4927N
MSH3KENVRDKKRSTOMACH375p.K381fsc.1141_1141delAFrame_Shift_Del12.65IM95Y090Y
MSH3KENVRDKKRSTOMACH375p.K381fsc.1141_1141delAFrame_Shift_Del12.65SNU1Y090Y
MSH3KENVRDKKRSTOMACH375p.K381fsc.1141_1141delAFrame_Shift_Del12.65SNU520Y090Y
MSH3KENVRDKKRSTOMACH375p.K381fsc.1141_1141delAFrame_Shift_Del12.65TGBC11TKBY090Y
MSH3KKRATFLLASTOMACH381p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95N200N
MSH3KKRATFLLASTOMACH381p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1N200N
MSH3KKRATFLLASTOMACH381p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520N200N
MSH3KKRATFLLASTOMACH381p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBN200N
MSH3KRATFLLALSTOMACH382p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95Y990N
MSH3KRATFLLALSTOMACH382p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1Y990N
MSH3KRATFLLALSTOMACH382p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520Y990N
MSH3KRATFLLALSTOMACH382p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBY990N
MSH3LALWECSLPSTOMACH388p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95N000N
MSH3LALWECSLPSTOMACH388p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1N000N
MSH3LALWECSLPSTOMACH388p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520N000N
MSH3LALWECSLPSTOMACH388p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBN000N
MSH3LCLIVSRTLSTOMACH400p.K381fsc.1141_1141delAFrame_Shift_Del62.65IM95N1207N
MSH3LCLIVSRTLSTOMACH400p.K381fsc.1141_1141delAFrame_Shift_Del62.65SNU1N1207N
MSH3LCLIVSRTLSTOMACH400p.K381fsc.1141_1141delAFrame_Shift_Del62.65SNU520N1207N
MSH3LCLIVSRTLSTOMACH400p.K381fsc.1141_1141delAFrame_Shift_Del62.65TGBC11TKBN1207N
MSH3LIVSRTLLLSTOMACH402p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95Y15924N
MSH3LIVSRTLLLSTOMACH402p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1Y15924N
MSH3LIVSRTLLLSTOMACH402p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520Y15924N
MSH3LIVSRTLLLSTOMACH402p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBY15924N
MSH3LLALWECSLSTOMACH387p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95N1000N
MSH3LLALWECSLSTOMACH387p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1N1000N
MSH3LLALWECSLSTOMACH387p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520N1000N
MSH3LLALWECSLSTOMACH387p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBN1000N
MSH3LPQARLCLISTOMACH395p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95N1700N
MSH3LPQARLCLISTOMACH395p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1N1700N
MSH3LPQARLCLISTOMACH395p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520N1700N
MSH3LPQARLCLISTOMACH395p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBN1700N
MSH3LWECSLPQASTOMACH390p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95N100N
MSH3LWECSLPQASTOMACH390p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1N100N
MSH3LWECSLPQASTOMACH390p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520N100N
MSH3LWECSLPQASTOMACH390p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBN100N
MSH3NVRDKKRATSTOMACH377p.K381fsc.1141_1141delAFrame_Shift_Del32.65IM95N200N
MSH3NVRDKKRATSTOMACH377p.K381fsc.1141_1141delAFrame_Shift_Del32.65SNU1N200N
MSH3NVRDKKRATSTOMACH377p.K381fsc.1141_1141delAFrame_Shift_Del32.65SNU520N200N
MSH3NVRDKKRATSTOMACH377p.K381fsc.1141_1141delAFrame_Shift_Del32.65TGBC11TKBN200N
MSH3PQARLCLIVSTOMACH396p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95N200N
MSH3PQARLCLIVSTOMACH396p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1N200N
MSH3PQARLCLIVSTOMACH396p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520N200N
MSH3PQARLCLIVSTOMACH396p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBN200N
MSH3QARLCLIVSSTOMACH397p.K381fsc.1141_1141delAFrame_Shift_Del62.65IM95N100N
MSH3QARLCLIVSSTOMACH397p.K381fsc.1141_1141delAFrame_Shift_Del62.65SNU1N100N
MSH3QARLCLIVSSTOMACH397p.K381fsc.1141_1141delAFrame_Shift_Del62.65SNU520N100N
MSH3QARLCLIVSSTOMACH397p.K381fsc.1141_1141delAFrame_Shift_Del62.65TGBC11TKBN100N
MSH3RATFLLALWSTOMACH383p.K381fsc.1141_1141delAFrame_Shift_Del62.65IM95N400N
MSH3RATFLLALWSTOMACH383p.K381fsc.1141_1141delAFrame_Shift_Del62.65SNU1N400N
MSH3RATFLLALWSTOMACH383p.K381fsc.1141_1141delAFrame_Shift_Del62.65SNU520N400N
MSH3RATFLLALWSTOMACH383p.K381fsc.1141_1141delAFrame_Shift_Del62.65TGBC11TKBN400N
MSH3RDKKRATFLSTOMACH379p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95Y7130N
MSH3RDKKRATFLSTOMACH379p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1Y7130N
MSH3RDKKRATFLSTOMACH379p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520Y7130N
MSH3RDKKRATFLSTOMACH379p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBY7130N
MSH3RLCLIVSRTSTOMACH399p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95N400N
MSH3RLCLIVSRTSTOMACH399p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1N400N
MSH3RLCLIVSRTSTOMACH399p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520N400N
MSH3RLCLIVSRTSTOMACH399p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBN400N
MSH3SLPQARLCLSTOMACH394p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95Y12100N
MSH3SLPQARLCLSTOMACH394p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1Y12100N
MSH3SLPQARLCLSTOMACH394p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520Y12100N
MSH3SLPQARLCLSTOMACH394p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBY12100N
MSH3SRTLLLVQSSTOMACH405p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95N200N
MSH3SRTLLLVQSSTOMACH405p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1N200N
MSH3SRTLLLVQSSTOMACH405p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520N200N
MSH3SRTLLLVQSSTOMACH405p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBN200N
MSH3TFLLALWECSTOMACH385p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95N100N
MSH3TFLLALWECSTOMACH385p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1N100N
MSH3TFLLALWECSTOMACH385p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520N100N
MSH3TFLLALWECSTOMACH385p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBN100N
MSH3VRDKKRATFSTOMACH378p.K381fsc.1141_1141delAFrame_Shift_Del42.65IM95Y4912N
MSH3VRDKKRATFSTOMACH378p.K381fsc.1141_1141delAFrame_Shift_Del42.65SNU1Y4912N
MSH3VRDKKRATFSTOMACH378p.K381fsc.1141_1141delAFrame_Shift_Del42.65SNU520Y4912N
MSH3VRDKKRATFSTOMACH378p.K381fsc.1141_1141delAFrame_Shift_Del42.65TGBC11TKBY4912N
MSH3VSRTLLLVQSTOMACH404p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95N003N
MSH3VSRTLLLVQSTOMACH404p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1N003N
MSH3VSRTLLLVQSTOMACH404p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520N003N
MSH3VSRTLLLVQSTOMACH404p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBN003N
MSH3WECSLPQARSTOMACH391p.K381fsc.1141_1141delAFrame_Shift_Del52.65IM95N202N
MSH3WECSLPQARSTOMACH391p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU1N202N
MSH3WECSLPQARSTOMACH391p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU520N202N
MSH3WECSLPQARSTOMACH391p.K381fsc.1141_1141delAFrame_Shift_Del52.65TGBC11TKBN202N
MSH3GAAAAAAPPSTOMACH50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94AGSN000N
MSH3GAAAAAAPPSTOMACH50p.AAAAAA52delc.154_171delGCAGCGGCTGCAGCGGCCIn_Frame_Del113.94GSUN000N
MSH3GAAAAAAPPSTOMACH50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94HS746TN000N
MSH3GAAAAAAPPSTOMACH50p.AAAAAA52delc.154_171delGCAGCGGCTGCAGCGGCCIn_Frame_Del113.94SNU520N000N
MSH3PGAAAAAAPSTOMACH49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94AGSN000N
MSH3PGAAAAAAPSTOMACH49p.AAAAAA52delc.154_171delGCAGCGGCTGCAGCGGCCIn_Frame_Del113.94GSUN000N
MSH3PGAAAAAAPSTOMACH49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94HS746TN000N
MSH3PGAAAAAAPSTOMACH49p.AAAAAA52delc.154_171delGCAGCGGCTGCAGCGGCCIn_Frame_Del113.94SNU520N000N
MSH3AAAAPPAPASTOMACH53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23AGSN200N
MSH3AAAAPPAPASTOMACH59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23AGSN200N
MSH3AAAAPPAPASTOMACH53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23HS746TN200N
MSH3AAAAPPAPASTOMACH59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HS746TN200N
MSH3AAAPPAPAFSTOMACH54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23AGSY8100N
MSH3AAAPPAPAFSTOMACH60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23AGSY8100N
MSH3AAAPPAPAFSTOMACH54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23HS746TY8100N
MSH3AAAPPAPAFSTOMACH60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23HS746TY8100N
MSH3AAPPAPAFPSTOMACH55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23AGSN000N
MSH3AAPPAPAFPSTOMACH61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23AGSN000N
MSH3AAPPAPAFPSTOMACH55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23HS746TN000N
MSH3AAPPAPAFPSTOMACH61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HS746TN000N
MSH3DGISTRMGASTOMACH933p.F936Sc.2807T>CMissense_Mutation10.11SNU719N200N
MSH3GISTRMGAASTOMACH934p.F936Sc.2807T>CMissense_Mutation10.11SNU719N000N
MSH3GIVDGISTRSTOMACH930p.F936Sc.2807T>CMissense_Mutation10.11SNU719Y690N
MSH3IGIVDGISTSTOMACH929p.F936Sc.2807T>CMissense_Mutation10.11SNU719N008N
MSH3ISTRMGAADSTOMACH935p.F936Sc.2807T>CMissense_Mutation10.11SNU719N000N
MSH3IVDGISTRMSTOMACH931p.F936Sc.2807T>CMissense_Mutation10.11SNU719N100N
MSH3IYMPLELQYSTOMACH228p.T230Mc.689C>TMissense_Mutation10.11KATOIIIN700Y
MSH3KRSKSIYMPSTOMACH223p.T230Mc.689C>TMissense_Mutation10.11KATOIIIN200N
MSH3KSIYMPLELSTOMACH226p.T230Mc.689C>TMissense_Mutation10.11KATOIIIN1600N
MSH3MPLELQYIESTOMACH230p.T230Mc.689C>TMissense_Mutation10.11KATOIIIN200N
MSH3NKRSKSIYMSTOMACH222p.T230Mc.689C>TMissense_Mutation10.11KATOIIIY490N
MSH3RSKSIYMPLSTOMACH224p.T230Mc.689C>TMissense_Mutation10.11KATOIIIY12100N
MSH3SIYMPLELQSTOMACH227p.T230Mc.689C>TMissense_Mutation10.11KATOIIIN000Y
MSH3SKSIYMPLESTOMACH225p.T230Mc.689C>TMissense_Mutation10.11KATOIIIN000N
MSH3STRMGAADNSTOMACH936p.F936Sc.2807T>CMissense_Mutation10.11SNU719N000N
MSH3TIGIVDGISSTOMACH928p.F936Sc.2807T>CMissense_Mutation10.11SNU719N000N
MSH3VDGISTRMGSTOMACH932p.F936Sc.2807T>CMissense_Mutation10.11SNU719N100N
MSH3YMPLELQYISTOMACH229p.T230Mc.689C>TMissense_Mutation10.11KATOIIIN14013N
MSH6LLPEDTPPSSTOMACH1080p.T1085fsc.3254_3254delCFrame_Shift_Del11.44SNU520N106Y
MSH6VHKLLTLIDSTOMACH1350p.T1355fsc.4065_4066insTTGAFrame_Shift_Ins10.66SNU5N0018N
MSH6AHVSGGGDESTOMACH350p.D358Ec.1074C>GMissense_Mutation10.11SNU719N000Y
MSH6CRPVILLSESTOMACH1075p.P1082Sc.3244C>TMissense_Mutation10.11HUG1NN100N
MSH6DESSRPTVWSTOMACH357p.D358Ec.1074C>GMissense_Mutation10.11SNU719N300N
MSH6EGLIPSSQFSTOMACH619p.G624Sc.1870G>AMissense_Mutation10.11NCIN87N400N
MSH6ESSRPTVWYSTOMACH358p.D358Ec.1074C>GMissense_Mutation10.11SNU719N500N
MSH6GDESSRPTVSTOMACH356p.D358Ec.1074C>GMissense_Mutation10.11SNU719N300N
MSH6GGDESSRPTSTOMACH355p.D358Ec.1074C>GMissense_Mutation10.11SNU719N200N
MSH6GGGDESSRPSTOMACH354p.D358Ec.1074C>GMissense_Mutation10.11SNU719N000N
MSH6GLIPSSQFWSTOMACH620p.G624Sc.1870G>AMissense_Mutation10.11NCIN87N400N
MSH6HVSGGGDESSTOMACH351p.D358Ec.1074C>GMissense_Mutation10.11SNU719N000Y
MSH6ILLSEDTPPSTOMACH1079p.P1082Sc.3244C>TMissense_Mutation10.11HUG1NN000N
MSH6IPSSQFWDASTOMACH622p.G624Sc.1870G>AMissense_Mutation10.11NCIN87N800N
MSH6LIPSSQFWDSTOMACH621p.G624Sc.1870G>AMissense_Mutation10.11NCIN87N000N
MSH6LLSEDTPPFSTOMACH1080p.P1082Sc.3244C>TMissense_Mutation10.11HUG1NN703N
MSH6LQEGLIPSSSTOMACH617p.G624Sc.1870G>AMissense_Mutation10.11NCIN87N002N
MSH6LSEDTPPFLSTOMACH1081p.P1082Sc.3244C>TMissense_Mutation10.11HUG1NN1100N
MSH6MCRPVILLSSTOMACH1074p.P1082Sc.3244C>TMissense_Mutation10.11HUG1NN000N
MSH6PSSQFWDASSTOMACH623p.G624Sc.1870G>AMissense_Mutation10.11NCIN87N000N
MSH6PVILLSEDTSTOMACH1077p.P1082Sc.3244C>TMissense_Mutation10.11HUG1NN000N
MSH6QEGLIPSSQSTOMACH618p.G624Sc.1870G>AMissense_Mutation10.11NCIN87N000N
MSH6RPVILLSEDSTOMACH1076p.P1082Sc.3244C>TMissense_Mutation10.11HUG1NN100N
MSH6SEDTPPFLESTOMACH1082p.P1082Sc.3244C>TMissense_Mutation10.11HUG1NN000Y
MSH6SGGGDESSRSTOMACH353p.D358Ec.1074C>GMissense_Mutation10.11SNU719N100N
MSH6SLQEGLIPSSTOMACH616p.G624Sc.1870G>AMissense_Mutation10.11NCIN87N000N
MSH6SSQFWDASKSTOMACH624p.G624Sc.1870G>AMissense_Mutation10.11NCIN87N200N
MSH6VILLSEDTPSTOMACH1078p.P1082Sc.3244C>TMissense_Mutation10.11HUG1NN000N
MSH6VSGGGDESSSTOMACH352p.D358Ec.1074C>GMissense_Mutation10.11SNU719N000N
MYLKAHLVPLTFGSTOMACH1336p.P1334fsc.4001_4001delCFrame_Shift_Del50.112313287N000N
MYLKDKPDPQLAHSTOMACH1329p.P1334fsc.4001_4001delCFrame_Shift_Del40.112313287N100N
MYLKDPQLAHLVPSTOMACH1332p.P1334fsc.4001_4001delCFrame_Shift_Del50.112313287N000N
MYLKHLVPLTFGASTOMACH1337p.P1334fsc.4001_4001delCFrame_Shift_Del50.112313287N400N
MYLKKPDPQLAHLSTOMACH1330p.P1334fsc.4001_4001delCFrame_Shift_Del50.112313287Y20100N
MYLKLAHLVPLTFSTOMACH1335p.P1334fsc.4001_4001delCFrame_Shift_Del50.112313287N708N
MYLKLVPLTFGAPSTOMACH1338p.P1334fsc.4001_4001delCFrame_Shift_Del50.112313287N000N
MYLKPDPQLAHLVSTOMACH1331p.P1334fsc.4001_4001delCFrame_Shift_Del50.112313287N100N
MYLKPQLAHLVPLSTOMACH1333p.P1334fsc.4001_4001delCFrame_Shift_Del50.112313287N500N
MYLKQLAHLVPLTSTOMACH1334p.P1334fsc.4001_4001delCFrame_Shift_Del50.112313287N300N
MYLKTVVDKPDPQSTOMACH1326p.P1334fsc.4001_4001delCFrame_Shift_Del10.112313287N000N
MYLKVDKPDPQLASTOMACH1328p.P1334fsc.4001_4001delCFrame_Shift_Del30.112313287N400N
MYLKVPLTFGAPHSTOMACH1339p.P1334fsc.4001_4001delCFrame_Shift_Del50.112313287N200Y
MYLKVVDKPDPQLSTOMACH1327p.P1334fsc.4001_4001delCFrame_Shift_Del20.112313287N700N
MYLKASKELKKDVSTOMACH1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02ECC10