Cancertope

In silico Platform for designing genome-based
Personalized immunotherapy or Vaccine against Cancer

Browse Results ...


The result page of search shows exclusive peptide/epitopes generated due to mutation [Neoepitope], the tissue of origin [Tissue], position of peptide in protein [Position], number of mismatches counted by aligning mutated and normal protein sequence [Num Mismatch, percentage of cell lines with this peptide over total number of cell lines [Promiscuity %]. The immune information include CTL epitopes (Yes/No), MHC I binders, MHC II binders (both given as number of alleles) and B cell epitopes (Yes/No). For more information, please click HERE


Result Reset Search:
ProteinNeoepitopesTissuePositionProt MutationcDNA MutationMutation TypeNum MismatchPromiscuity (%)Cell LineCTLMHC INHLApredMHC IIBcell
AAK1AGHRHILSDPROSTATE630p.R634Hc.1901G>AMissense_Mutation10.1122RV1N000N
AAK1GHRHILSDVPROSTATE631p.R634Hc.1901G>AMissense_Mutation10.1122RV1N300N
AAK1HILSDVTHSPROSTATE634p.R634Hc.1901G>AMissense_Mutation10.1122RV1N000N
AAK1HRHILSDVTPROSTATE632p.R634Hc.1901G>AMissense_Mutation10.1122RV1N200N
AAK1KTQRAGHRHPROSTATE626p.R634Hc.1901G>AMissense_Mutation10.1122RV1N000N
AAK1QRAGHRHILPROSTATE628p.R634Hc.1901G>AMissense_Mutation10.1122RV1N500N
AAK1RAGHRHILSPROSTATE629p.R634Hc.1901G>AMissense_Mutation10.1122RV1N100N
AAK1RHILSDVTHPROSTATE633p.R634Hc.1901G>AMissense_Mutation10.1122RV1N000N
AAK1TQRAGHRHIPROSTATE627p.R634Hc.1901G>AMissense_Mutation10.1122RV1Y5130N
AKAP12AVEECKEEEPROSTATE261p.G269delc.804_806delAGGIn_Frame_Del10.88MDAPCA2BN000N
AKAP12CKEEEEKQEPROSTATE265p.G269delc.804_806delAGGIn_Frame_Del30.88MDAPCA2BN000Y
AKAP12ECKEEEEKQPROSTATE264p.G269delc.804_806delAGGIn_Frame_Del30.88MDAPCA2BN000N
AKAP12EECKEEEEKPROSTATE263p.G269delc.804_806delAGGIn_Frame_Del20.88MDAPCA2BN000N
AKAP12EEEEKQEKEPROSTATE267p.G269delc.804_806delAGGIn_Frame_Del10.88MDAPCA2BN000N
AKAP12EEEKQEKEPPROSTATE268p.G269delc.804_806delAGGIn_Frame_Del10.88MDAPCA2BN000N
AKAP12KEEEEKQEKPROSTATE266p.G269delc.804_806delAGGIn_Frame_Del20.88MDAPCA2BN300N
AKAP12VEECKEEEEPROSTATE262p.G269delc.804_806delAGGIn_Frame_Del10.88MDAPCA2BN000N
AKAP12AIEEDLEPEPROSTATE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.8622RV1N000N
AKAP12AIEEDLEPEPROSTATE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86DU145N000N
AKAP12AIEEDLEPEPROSTATE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86LNCAPCLONEFGCN000N
AKAP12AIEEDLEPEPROSTATE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MDAPCA2BN000N
AKAP12AIEEDLEPEPROSTATE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NCIH660N000N
AKAP12AIEEDLEPEPROSTATE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86PC3N000N
AKAP12AIEEDLEPEPROSTATE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86VCAPN000N
AKAP12EEDLEPENGPROSTATE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.8622RV1N000N
AKAP12EEDLEPENGPROSTATE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86DU145N000N
AKAP12EEDLEPENGPROSTATE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86LNCAPCLONEFGCN000N
AKAP12EEDLEPENGPROSTATE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MDAPCA2BN000N
AKAP12EEDLEPENGPROSTATE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NCIH660N000N
AKAP12EEDLEPENGPROSTATE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86PC3N000N
AKAP12EEDLEPENGPROSTATE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86VCAPN000N
AKAP12IEEDLEPENPROSTATE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.8622RV1N200N
AKAP12IEEDLEPENPROSTATE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86DU145N200N
AKAP12IEEDLEPENPROSTATE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86LNCAPCLONEFGCN200N
AKAP12IEEDLEPENPROSTATE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MDAPCA2BN200N
AKAP12IEEDLEPENPROSTATE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NCIH660N200N
AKAP12IEEDLEPENPROSTATE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86PC3N200N
AKAP12IEEDLEPENPROSTATE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86VCAPN200N
AKAP12KVSVAIEEDPROSTATE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.8622RV1N000N
AKAP12KVSVAIEEDPROSTATE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86DU145N000N
AKAP12KVSVAIEEDPROSTATE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86LNCAPCLONEFGCN000N
AKAP12KVSVAIEEDPROSTATE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MDAPCA2BN000N
AKAP12KVSVAIEEDPROSTATE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NCIH660N000N
AKAP12KVSVAIEEDPROSTATE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86PC3N000N
AKAP12KVSVAIEEDPROSTATE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86VCAPN000N
AKAP12SVAIEEDLEPROSTATE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.8622RV1N000N
AKAP12SVAIEEDLEPROSTATE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86DU145N000N
AKAP12SVAIEEDLEPROSTATE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86LNCAPCLONEFGCN000N
AKAP12SVAIEEDLEPROSTATE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MDAPCA2BN000N
AKAP12SVAIEEDLEPROSTATE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NCIH660N000N
AKAP12SVAIEEDLEPROSTATE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86PC3N000N
AKAP12SVAIEEDLEPROSTATE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86VCAPN000N
AKAP12VAIEEDLEPPROSTATE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.8622RV1N000N
AKAP12VAIEEDLEPPROSTATE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86DU145N000N
AKAP12VAIEEDLEPPROSTATE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86LNCAPCLONEFGCN000N
AKAP12VAIEEDLEPPROSTATE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MDAPCA2BN000N
AKAP12VAIEEDLEPPROSTATE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NCIH660N000N
AKAP12VAIEEDLEPPROSTATE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86PC3N000N
AKAP12VAIEEDLEPPROSTATE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86VCAPN000N
AKAP12VKVSVAIEEPROSTATE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.8622RV1N002N
AKAP12VKVSVAIEEPROSTATE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86DU145N002N
AKAP12VKVSVAIEEPROSTATE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86LNCAPCLONEFGCN002N
AKAP12VKVSVAIEEPROSTATE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MDAPCA2BN002N
AKAP12VKVSVAIEEPROSTATE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NCIH660N002N
AKAP12VKVSVAIEEPROSTATE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86PC3N002N
AKAP12VKVSVAIEEPROSTATE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86VCAPN002N
AKAP12VSVAIEEDLPROSTATE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.8622RV1N1500Y
AKAP12VSVAIEEDLPROSTATE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86DU145N1500Y
AKAP12VSVAIEEDLPROSTATE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86LNCAPCLONEFGCN1500Y
AKAP12VSVAIEEDLPROSTATE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MDAPCA2BN1500Y
AKAP12VSVAIEEDLPROSTATE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NCIH660N1500Y
AKAP12VSVAIEEDLPROSTATE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86PC3N1500Y
AKAP12VSVAIEEDLPROSTATE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86VCAPN1500Y
AKAP12AASKESESKPROSTATE225p.P232Sc.694C>TMissense_Mutation10.11DU145N100N
AKAP12ALTDTDASGPROSTATE1713p.A1715Tc.5143G>AMissense_Mutation10.1122RV1N000N
AKAP12ASKESESKQPROSTATE226p.P232Sc.694C>TMissense_Mutation10.11DU145N000N
AKAP12EAASKESESPROSTATE224p.P232Sc.694C>TMissense_Mutation10.11DU145N200N
AKAP12ENQNSALTDPROSTATE1708p.A1715Tc.5143G>AMissense_Mutation10.1122RV1N000N
AKAP12ESESKQSTEPROSTATE229p.P232Sc.694C>TMissense_Mutation10.11DU145N000N
AKAP12ESKQSTEKPPROSTATE231p.P232Sc.694C>TMissense_Mutation10.11DU145N000N
AKAP12KESESKQSTPROSTATE228p.P232Sc.694C>TMissense_Mutation10.11DU145N500N
AKAP12LTDTDASGGPROSTATE1714p.A1715Tc.5143G>AMissense_Mutation10.1122RV1N100N
AKAP12NQNSALTDTPROSTATE1709p.A1715Tc.5143G>AMissense_Mutation10.1122RV1N200N
AKAP12NSALTDTDAPROSTATE1711p.A1715Tc.5143G>AMissense_Mutation10.1122RV1N100N
AKAP12PENQNSALTPROSTATE1707p.A1715Tc.5143G>AMissense_Mutation10.1122RV1N000N
AKAP12QNSALTDTDPROSTATE1710p.A1715Tc.5143G>AMissense_Mutation10.1122RV1N000N
AKAP12SALTDTDASPROSTATE1712p.A1715Tc.5143G>AMissense_Mutation10.1122RV1N200N
AKAP12SESKQSTEKPROSTATE230p.P232Sc.694C>TMissense_Mutation10.11DU145N100N
AKAP12SKESESKQSPROSTATE227p.P232Sc.694C>TMissense_Mutation10.11DU145N100N
AKAP12SKQSTEKPEPROSTATE232p.P232Sc.694C>TMissense_Mutation10.11DU145N000N
AKAP12TDTDASGGLPROSTATE1715p.A1715Tc.5143G>AMissense_Mutation10.1122RV1N400N
AKAP12KKRVRWPSEPROSTATE620p.R625Wc.1873C>TMissense_Mutation10.22NCIH660N100N
AKAP12KRVRWPSESPROSTATE621p.R625Wc.1873C>TMissense_Mutation10.22NCIH660N200N
AKAP12PKKRVRWPSPROSTATE619p.R625Wc.1873C>TMissense_Mutation10.22NCIH660N000N
AKAP12RVRWPSESDPROSTATE622p.R625Wc.1873C>TMissense_Mutation10.22NCIH660N000N
AKAP12RWPSESDKEPROSTATE624p.R625Wc.1873C>TMissense_Mutation10.22NCIH660N000N
AKAP12TPKKRVRWPPROSTATE618p.R625Wc.1873C>TMissense_Mutation10.22NCIH660N200N
AKAP12VRWPSESDKPROSTATE623p.R625Wc.1873C>TMissense_Mutation10.22NCIH660N200N
AKAP12VTPKKRVRWPROSTATE617p.R625Wc.1873C>TMissense_Mutation10.22NCIH660N301N
AKAP12WPSESDKEDPROSTATE625p.R625Wc.1873C>TMissense_Mutation10.22NCIH660N300N
AKAP9LVSERERGCPROSTATE1648p.S1650fsc.4949_4950insAGFrame_Shift_Ins20.11DU145N000N
AKAP9NLVSERERGPROSTATE1647p.S1650fsc.4949_4950insAGFrame_Shift_Ins10.11DU145N000N
AKAP9VSERERGCFPROSTATE1649p.S1650fsc.4949_4950insAGFrame_Shift_Ins30.11DU145N600N
AKAP9DLEKTKQLEPROSTATE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.2722RV1N000N
AKAP9DLEKTKQLEPROSTATE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27DU145N000N
AKAP9DLEKTKQLEPROSTATE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAPCA2BN000N
AKAP9DLEKTKQLEPROSTATE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27NCIH660N000N
AKAP9DLEKTKQLEPROSTATE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27VCAPN000N
AKAP9EKTKQLEEQPROSTATE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.2722RV1N000N
AKAP9EKTKQLEEQPROSTATE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27DU145N000N
AKAP9EKTKQLEEQPROSTATE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAPCA2BN000N
AKAP9EKTKQLEEQPROSTATE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27NCIH660N000N
AKAP9EKTKQLEEQPROSTATE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27VCAPN000N
AKAP9KQLEEQVQEPROSTATE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.2722RV1N000N
AKAP9KQLEEQVQEPROSTATE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27DU145N000N
AKAP9KQLEEQVQEPROSTATE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAPCA2BN000N
AKAP9KQLEEQVQEPROSTATE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27NCIH660N000N
AKAP9KQLEEQVQEPROSTATE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27VCAPN000N
AKAP9KTKQLEEQVPROSTATE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.2722RV1N200N
AKAP9KTKQLEEQVPROSTATE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27DU145N200N
AKAP9KTKQLEEQVPROSTATE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27MDAPCA2BN200N
AKAP9KTKQLEEQVPROSTATE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27NCIH660N200N
AKAP9KTKQLEEQVPROSTATE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27VCAPN200N
AKAP9LEKTKQLEEPROSTATE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.2722RV1N000N
AKAP9LEKTKQLEEPROSTATE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27DU145N000N
AKAP9LEKTKQLEEPROSTATE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAPCA2BN000N
AKAP9LEKTKQLEEPROSTATE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27NCIH660N000N
AKAP9LEKTKQLEEPROSTATE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27VCAPN000N
AKAP9LQDLEKTKQPROSTATE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.2722RV1N000N
AKAP9LQDLEKTKQPROSTATE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27DU145N000N
AKAP9LQDLEKTKQPROSTATE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MDAPCA2BN000N
AKAP9LQDLEKTKQPROSTATE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27NCIH660N000N
AKAP9LQDLEKTKQPROSTATE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27VCAPN000N
AKAP9QDLEKTKQLPROSTATE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.2722RV1N900N
AKAP9QDLEKTKQLPROSTATE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27DU145N900N
AKAP9QDLEKTKQLPROSTATE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAPCA2BN900N
AKAP9QDLEKTKQLPROSTATE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27NCIH660N900N
AKAP9QDLEKTKQLPROSTATE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27VCAPN900N
AKAP9QLEEQVQELPROSTATE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.2722RV1N1200N
AKAP9QLEEQVQELPROSTATE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27DU145N1200N
AKAP9QLEEQVQELPROSTATE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MDAPCA2BN1200N
AKAP9QLEEQVQELPROSTATE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27NCIH660N1200N
AKAP9QLEEQVQELPROSTATE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27VCAPN1200N
AKAP9TKQLEEQVQPROSTATE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.2722RV1N000N
AKAP9TKQLEEQVQPROSTATE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27DU145N000N
AKAP9TKQLEEQVQPROSTATE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAPCA2BN000N
AKAP9TKQLEEQVQPROSTATE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27NCIH660N000N
AKAP9TKQLEEQVQPROSTATE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27VCAPN000N
AKAP9AVVEETIGRPROSTATE1743p.A1744Vc.5231C>TMissense_Mutation10.1122RV1N600N
AKAP9EVVKTTAVVPROSTATE1737p.A1744Vc.5231C>TMissense_Mutation10.1122RV1N300N
AKAP9KTTAVVEETPROSTATE1740p.A1744Vc.5231C>TMissense_Mutation10.1122RV1N100N
AKAP9LEVVKTTAVPROSTATE1736p.A1744Vc.5231C>TMissense_Mutation10.1122RV1N805N
AKAP9TAVVEETIGPROSTATE1742p.A1744Vc.5231C>TMissense_Mutation10.1122RV1N000N
AKAP9TTAVVEETIPROSTATE1741p.A1744Vc.5231C>TMissense_Mutation10.1122RV1Y5150N
AKAP9VKTTAVVEEPROSTATE1739p.A1744Vc.5231C>TMissense_Mutation10.1122RV1N000N
AKAP9VVEETIGRHPROSTATE1744p.A1744Vc.5231C>TMissense_Mutation10.1122RV1N100N
AKAP9VVKTTAVVEPROSTATE1738p.A1744Vc.5231C>TMissense_Mutation10.1122RV1N000N
ALPK2AFKKFLTCPPROSTATE1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.2722RV1N000N
ALPK2DHTAFKKFLPROSTATE1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.2722RV1N600N
ALPK2HTAFKKFLTPROSTATE1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.2722RV1N100N
ALPK2KMDHTAFKKPROSTATE1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.2722RV1N600N
ALPK2LKMDHTAFKPROSTATE1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.2722RV1N1017N
ALPK2MDHTAFKKFPROSTATE1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.2722RV1N600N
ALPK2TAFKKFLTCPROSTATE1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.2722RV1N600N
ALPK2ATRETVTIAPROSTATE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74DU145Y1140N
ALPK2ATRETVTIAPROSTATE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74LNCAPCLONEFGCY1140N
ALPK2ATRETVTIAPROSTATE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74NCIH660Y1140N
ALPK2ATRETVTIAPROSTATE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74PC3Y1140N
ALPK2ATRETVTIAPROSTATE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74VCAPY1140N
ALPK2CFQATRETVPROSTATE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74DU145Y2110N
ALPK2CFQATRETVPROSTATE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74LNCAPCLONEFGCY2110N
ALPK2CFQATRETVPROSTATE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74NCIH660Y2110N
ALPK2CFQATRETVPROSTATE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74PC3Y2110N
ALPK2CFQATRETVPROSTATE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74VCAPY2110N
ALPK2ETVTIATEVPROSTATE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74DU145N400N
ALPK2ETVTIATEVPROSTATE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74LNCAPCLONEFGCN400N
ALPK2ETVTIATEVPROSTATE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74NCIH660N400N
ALPK2ETVTIATEVPROSTATE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74PC3N400N
ALPK2ETVTIATEVPROSTATE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74VCAPN400N
ALPK2FQATRETVTPROSTATE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74DU145N600N
ALPK2FQATRETVTPROSTATE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74LNCAPCLONEFGCN600N
ALPK2FQATRETVTPROSTATE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74NCIH660N600N
ALPK2FQATRETVTPROSTATE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74PC3N600N
ALPK2FQATRETVTPROSTATE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74VCAPN600N
ALPK2QATRETVTIPROSTATE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74DU145N600N
ALPK2QATRETVTIPROSTATE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74LNCAPCLONEFGCN600N
ALPK2QATRETVTIPROSTATE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74NCIH660N600N
ALPK2QATRETVTIPROSTATE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74PC3N600N
ALPK2QATRETVTIPROSTATE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74VCAPN600N
ALPK2RETVTIATEPROSTATE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74DU145N100N
ALPK2RETVTIATEPROSTATE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74LNCAPCLONEFGCN100N
ALPK2RETVTIATEPROSTATE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74NCIH660N100N
ALPK2RETVTIATEPROSTATE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74PC3N100N
ALPK2RETVTIATEPROSTATE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74VCAPN100N
ALPK2TRETVTIATPROSTATE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74DU145N200N
ALPK2TRETVTIATPROSTATE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74LNCAPCLONEFGCN200N
ALPK2TRETVTIATPROSTATE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74NCIH660N200N
ALPK2TRETVTIATPROSTATE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74PC3N200N
ALPK2TRETVTIATPROSTATE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74VCAPN200N
ALPK2ANLRESTIEPROSTATE551p.T558Ic.1673C>TMissense_Mutation10.11LNCAPCLONEFGCN000N
ALPK2CTLHLCSAKPROSTATE560p.G560Cc.1678G>TMissense_Mutation10.11LNCAPCLONEFGCN300N
ALPK2DKEEKQLKMPROSTATE1375p.Q1376Kc.4126C>AMissense_Mutation10.11LNCAPCLONEFGCN200N
ALPK2ECTLHLCSAPROSTATE559p.G560Cc.1678G>TMissense_Mutation10.11LNCAPCLONEFGCN000N
ALPK2ESTIEGTLHPROSTATE555p.T558Ic.1673C>TMissense_Mutation10.11LNCAPCLONEFGCN100N
ALPK2ESTTECTLHPROSTATE555p.G560Cc.1678G>TMissense_Mutation10.11LNCAPCLONEFGCN100N
ALPK2IEGTLHLCSPROSTATE558p.T558Ic.1673C>TMissense_Mutation10.11LNCAPCLONEFGCN300N
ALPK2KEEKQLKMDPROSTATE1376p.Q1376Kc.4126C>AMissense_Mutation10.11LNCAPCLONEFGCN000N
ALPK2LRESTIEGTPROSTATE553p.T558Ic.1673C>TMissense_Mutation10.11LNCAPCLONEFGCN200N
ALPK2LRESTTECTPROSTATE553p.G560Cc.1678G>TMissense_Mutation10.11LNCAPCLONEFGCN203N
ALPK2NANLRESTIPROSTATE550p.T558Ic.1673C>TMissense_Mutation10.11LNCAPCLONEFGCY6100N
ALPK2NLRESTIEGPROSTATE552p.T558Ic.1673C>TMissense_Mutation10.11LNCAPCLONEFGCN000N
ALPK2NLRESTTECPROSTATE552p.G560Cc.1678G>TMissense_Mutation10.11LNCAPCLONEFGCN200N
ALPK2NNVSQDKEEPROSTATE1370p.Q1376Kc.4126C>AMissense_Mutation10.11LNCAPCLONEFGCN000N
ALPK2NVNNVSQDKPROSTATE1368p.Q1376Kc.4126C>AMissense_Mutation10.11LNCAPCLONEFGCY3110Y
ALPK2NVSQDKEEKPROSTATE1371p.Q1376Kc.4126C>AMissense_Mutation10.11LNCAPCLONEFGCN300N
ALPK2QDKEEKQLKPROSTATE1374p.Q1376Kc.4126C>AMissense_Mutation10.11LNCAPCLONEFGCN100N
ALPK2RESTIEGTLPROSTATE554p.T558Ic.1673C>TMissense_Mutation10.11LNCAPCLONEFGCN1000N
ALPK2RESTTECTLPROSTATE554p.G560Cc.1678G>TMissense_Mutation10.11LNCAPCLONEFGCN900N
ALPK2SQDKEEKQLPROSTATE1373p.Q1376Kc.4126C>AMissense_Mutation10.11LNCAPCLONEFGCN600N
ALPK2STIEGTLHLPROSTATE556p.T558Ic.1673C>TMissense_Mutation10.11LNCAPCLONEFGCN1700N
ALPK2STTECTLHLPROSTATE556p.G560Cc.1678G>TMissense_Mutation10.11LNCAPCLONEFGCN900N
ALPK2TECTLHLCSPROSTATE558p.G560Cc.1678G>TMissense_Mutation10.11LNCAPCLONEFGCN300N
ALPK2TIEGTLHLCPROSTATE557p.T558Ic.1673C>TMissense_Mutation10.11LNCAPCLONEFGCN100N
ALPK2TTECTLHLCPROSTATE557p.G560Cc.1678G>TMissense_Mutation10.11LNCAPCLONEFGCN200N
ALPK2VNNVSQDKEPROSTATE1369p.Q1376Kc.4126C>AMissense_Mutation10.11LNCAPCLONEFGCN000N
ALPK2VSQDKEEKQPROSTATE1372p.Q1376Kc.4126C>AMissense_Mutation10.11LNCAPCLONEFGCN000N
BRAFDFGRATVKSPROSTATE594p.L597Rc.1790T>GMissense_Mutation10.1122RV1N000N
BRAFFGRATVKSRPROSTATE595p.L597Rc.1790T>GMissense_Mutation10.1122RV1N3011N
BRAFGDFGRATVKPROSTATE593p.L597Rc.1790T>GMissense_Mutation10.1122RV1N100N
BRAFGRATVKSRWPROSTATE596p.L597Rc.1790T>GMissense_Mutation10.1122RV1Y290Y
BRAFIGDFGRATVPROSTATE592p.L597Rc.1790T>GMissense_Mutation10.1122RV1Y5110N
BRAFKIGDFGRATPROSTATE591p.L597Rc.1790T>GMissense_Mutation10.1122RV1N300N
BRAFRATVKSRWSPROSTATE597p.L597Rc.1790T>GMissense_Mutation10.1122RV1N100Y
BRAFTVKIGDFGRPROSTATE589p.L597Rc.1790T>GMissense_Mutation10.1122RV1Y690N
BRAFVKIGDFGRAPROSTATE590p.L597Rc.1790T>GMissense_Mutation10.1122RV1N200N
CDH1AGVCRKAQSPROSTATE692p.P700Sc.2098C>TMissense_Mutation10.11LNCAPCLONEFGCN100N
CDH1AQSVEAGLQPROSTATE698p.P700Sc.2098C>TMissense_Mutation10.11LNCAPCLONEFGCN000N
CDH1CRKAQSVEAPROSTATE695p.P700Sc.2098C>TMissense_Mutation10.11LNCAPCLONEFGCN200N
CDH1FHNTQIHFLPROSTATE91p.P94Tc.280C>AMissense_Mutation10.11LNCAPCLONEFGCN804N
CDH1GVCRKAQSVPROSTATE693p.P700Sc.2098C>TMissense_Mutation10.11LNCAPCLONEFGCY4100N
CDH1HNTQIHFLVPROSTATE92p.P94Tc.280C>AMissense_Mutation10.11LNCAPCLONEFGCN300N
CDH1KAQSVEAGLPROSTATE697p.P700Sc.2098C>TMissense_Mutation10.11LNCAPCLONEFGCN1300N
CDH1KRPLRFHNTPROSTATE86p.P94Tc.280C>AMissense_Mutation10.11LNCAPCLONEFGCN400N
CDH1LRFHNTQIHPROSTATE89p.P94Tc.280C>AMissense_Mutation10.11LNCAPCLONEFGCN2036N
CDH1NTQIHFLVYPROSTATE93p.P94Tc.280C>AMissense_Mutation10.11LNCAPCLONEFGCN700N
CDH1PLRFHNTQIPROSTATE88p.P94Tc.280C>AMissense_Mutation10.11LNCAPCLONEFGCN100N
CDH1QSVEAGLQIPROSTATE699p.P700Sc.2098C>TMissense_Mutation10.11LNCAPCLONEFGCN700N
CDH1RFHNTQIHFPROSTATE90p.P94Tc.280C>AMissense_Mutation10.11LNCAPCLONEFGCY690N
CDH1RKAQSVEAGPROSTATE696p.P700Sc.2098C>TMissense_Mutation10.11LNCAPCLONEFGCN000N
CDH1RPLRFHNTQPROSTATE87p.P94Tc.280C>AMissense_Mutation10.11LNCAPCLONEFGCN100N
CDH1SVEAGLQIPPROSTATE700p.P700Sc.2098C>TMissense_Mutation10.11LNCAPCLONEFGCN000N
CDH1TQIHFLVYAPROSTATE94p.P94Tc.280C>AMissense_Mutation10.11LNCAPCLONEFGCY4110N
CDH1VCRKAQSVEPROSTATE694p.P700Sc.2098C>TMissense_Mutation10.11LNCAPCLONEFGCN001N
CHD1AKKKLFLVRPROSTATE1318p.K1320fsc.3960_3960delAFrame_Shift_Del40.1122RV1N100N
CHD1DLAKKKLFLPROSTATE1316p.K1320fsc.3960_3960delAFrame_Shift_Del40.1122RV1Y690N
CHD1EKQELRRIKPROSTATE1332p.K1320fsc.3960_3960delAFrame_Shift_Del40.1122RV1N100N
CHD1EVQRGEKQEPROSTATE1327p.K1320fsc.3960_3960delAFrame_Shift_Del50.1122RV1N000N
CHD1FLVREVQRGPROSTATE1323p.K1320fsc.3960_3960delAFrame_Shift_Del50.1122RV1N1011N
CHD1GEKQELRRIPROSTATE1331p.K1320fsc.3960_3960delAFrame_Shift_Del50.1122RV1N600N
CHD1KKKLFLVREPROSTATE1319p.K1320fsc.3960_3960delAFrame_Shift_Del50.1122RV1N000N
CHD1KKLFLVREVPROSTATE1320p.K1320fsc.3960_3960delAFrame_Shift_Del50.1122RV1N400N
CHD1KLFLVREVQPROSTATE1321p.K1320fsc.3960_3960delAFrame_Shift_Del50.1122RV1N100N
CHD1KQELRRIKQPROSTATE1333p.K1320fsc.3960_3960delAFrame_Shift_Del50.1122RV1N100N
CHD1LAKKKLFLVPROSTATE1317p.K1320fsc.3960_3960delAFrame_Shift_Del40.1122RV1N800N
CHD1LFLVREVQRPROSTATE1322p.K1320fsc.3960_3960delAFrame_Shift_Del50.1122RV1N200N
CHD1LSRDLAKKKPROSTATE1313p.K1320fsc.3960_3960delAFrame_Shift_Del10.1122RV1N104N
CHD1LVREVQRGEPROSTATE1324p.K1320fsc.3960_3960delAFrame_Shift_Del50.1122RV1N001N
CHD1QRGEKQELRPROSTATE1329p.K1320fsc.3960_3960delAFrame_Shift_Del50.1122RV1N300N
CHD1RDLAKKKLFPROSTATE1315p.K1320fsc.3960_3960delAFrame_Shift_Del30.1122RV1N500N
CHD1REVQRGEKQPROSTATE1326p.K1320fsc.3960_3960delAFrame_Shift_Del50.1122RV1N100N
CHD1RGEKQELRRPROSTATE1330p.K1320fsc.3960_3960delAFrame_Shift_Del50.1122RV1N100N
CHD1SRDLAKKKLPROSTATE1314p.K1320fsc.3960_3960delAFrame_Shift_Del20.1122RV1Y5100N
CHD1VQRGEKQELPROSTATE1328p.K1320fsc.3960_3960delAFrame_Shift_Del50.1122RV1N807N
CHD1VREVQRGEKPROSTATE1325p.K1320fsc.3960_3960delAFrame_Shift_Del60.1122RV1N303N
CHD1AGFEKKQRTPROSTATE305p.N310fsc.929_930insAFrame_Shift_Ins40.11LNCAPCLONEFGCN400N
CHD1DPNAGFEKKPROSTATE302p.N310fsc.929_930insAFrame_Shift_Ins10.11LNCAPCLONEFGCN100N
CHD1EKKQRTRRDPROSTATE308p.N310fsc.929_930insAFrame_Shift_Ins50.11LNCAPCLONEFGCN000Y
CHD1FEKKQRTRRPROSTATE307p.N310fsc.929_930insAFrame_Shift_Ins50.11LNCAPCLONEFGCN101N
CHD1GFEKKQRTRPROSTATE306p.N310fsc.929_930insAFrame_Shift_Ins50.11LNCAPCLONEFGCN100N
CHD1KKQRTRRDSPROSTATE309p.N310fsc.929_930insAFrame_Shift_Ins50.11LNCAPCLONEFGCN100N
CHD1KQRTRRDSVPROSTATE310p.N310fsc.929_930insAFrame_Shift_Ins50.11LNCAPCLONEFGCN500N
CHD1NAGFEKKQRPROSTATE304p.N310fsc.929_930insAFrame_Shift_Ins30.11LNCAPCLONEFGCN300N
CHD1PNAGFEKKQPROSTATE303p.N310fsc.929_930insAFrame_Shift_Ins20.11LNCAPCLONEFGCN000N
CHD1QRTRRDSVFPROSTATE311p.N310fsc.929_930insAFrame_Shift_Ins50.11LNCAPCLONEFGCN300N
CHD1RTRRDSVFNPROSTATE312p.N310fsc.929_930insAFrame_Shift_Ins50.11LNCAPCLONEFGCN100N
CHD1DQRSYGSRSPROSTATE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.8622RV1N100N
CHD1DQRSYGSRSPROSTATE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86LNCAPCLONEFGCN100N
CHD1DQRSYGSRSPROSTATE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86VCAPN100N
CHD1LDQRSYGSRPROSTATE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.8622RV1N000N
CHD1LDQRSYGSRPROSTATE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86LNCAPCLONEFGCN000N
CHD1LDQRSYGSRPROSTATE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86VCAPN000N
CHD1PLDQRSYGSPROSTATE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.8622RV1N000N
CHD1PLDQRSYGSPROSTATE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86LNCAPCLONEFGCN000N
CHD1PLDQRSYGSPROSTATE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86VCAPN000N
CHD1QRSYGSRSPPROSTATE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.8622RV1N000N
CHD1QRSYGSRSPPROSTATE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86LNCAPCLONEFGCN000N
CHD1QRSYGSRSPPROSTATE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86VCAPN000N
CHD1RSPLDQRSYPROSTATE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.8622RV1N600N
CHD1RSPLDQRSYPROSTATE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86LNCAPCLONEFGCN600N
CHD1RSPLDQRSYPROSTATE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86VCAPN600N
CHD1RSYGSRSPFPROSTATE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.8622RV1N900N
CHD1RSYGSRSPFPROSTATE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86LNCAPCLONEFGCN900N
CHD1RSYGSRSPFPROSTATE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86VCAPN900N
CHD1SPLDQRSYGPROSTATE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.8622RV1N000N
CHD1SPLDQRSYGPROSTATE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86LNCAPCLONEFGCN000N
CHD1SPLDQRSYGPROSTATE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86VCAPN000N
CHD1SYGSRSPFEPROSTATE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.8622RV1N000N
CHD1SYGSRSPFEPROSTATE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86LNCAPCLONEFGCN000N
CHD1SYGSRSPFEPROSTATE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86VCAPN000N
CREB3L2FTHITSDSFPROSTATE95p.T100delc.299_301delCCAIn_Frame_Del444.4722RV1N801N
CREB3L2FTHITSDSFPROSTATE95p.T100delc.299_301delCCAIn_Frame_Del444.47LNCAPCLONEFGCN801N
CREB3L2FTHITSDSFPROSTATE95p.T100delc.299_301delCCAIn_Frame_Del444.47MDAPCA2BN801N
CREB3L2FTHITSDSFPROSTATE95p.T100delc.299_301delCCAIn_Frame_Del444.47PC3N801N
CREB3L2FTHITSDSFPROSTATE95p.T100delc.299_301delCCAIn_Frame_Del444.47VCAPN801N
CREB3L2HITSDSFNDPROSTATE97p.T100delc.299_301delCCAIn_Frame_Del244.4722RV1N000N
CREB3L2HITSDSFNDPROSTATE97p.T100delc.299_301delCCAIn_Frame_Del244.47LNCAPCLONEFGCN000N
CREB3L2HITSDSFNDPROSTATE97p.T100delc.299_301delCCAIn_Frame_Del244.47MDAPCA2BN000N
CREB3L2HITSDSFNDPROSTATE97p.T100delc.299_301delCCAIn_Frame_Del244.47PC3N000N
CREB3L2HITSDSFNDPROSTATE97p.T100delc.299_301delCCAIn_Frame_Del244.47VCAPN000N
CREB3L2ITSDSFNDDPROSTATE98p.T100delc.299_301delCCAIn_Frame_Del144.4722RV1N000N
CREB3L2ITSDSFNDDPROSTATE98p.T100delc.299_301delCCAIn_Frame_Del144.47LNCAPCLONEFGCN000N
CREB3L2ITSDSFNDDPROSTATE98p.T100delc.299_301delCCAIn_Frame_Del144.47MDAPCA2BN000N
CREB3L2ITSDSFNDDPROSTATE98p.T100delc.299_301delCCAIn_Frame_Del144.47PC3N000N
CREB3L2ITSDSFNDDPROSTATE98p.T100delc.299_301delCCAIn_Frame_Del144.47VCAPN000N
CREB3L2PFTHITSDSPROSTATE94p.T100delc.299_301delCCAIn_Frame_Del344.4722RV1N000N
CREB3L2PFTHITSDSPROSTATE94p.T100delc.299_301delCCAIn_Frame_Del344.47LNCAPCLONEFGCN000N
CREB3L2PFTHITSDSPROSTATE94p.T100delc.299_301delCCAIn_Frame_Del344.47MDAPCA2BN000N
CREB3L2PFTHITSDSPROSTATE94p.T100delc.299_301delCCAIn_Frame_Del344.47PC3N000N
CREB3L2PFTHITSDSPROSTATE94p.T100delc.299_301delCCAIn_Frame_Del344.47VCAPN000N
CREB3L2QSPFTHITSPROSTATE92p.T100delc.299_301delCCAIn_Frame_Del144.4722RV1N000N
CREB3L2QSPFTHITSPROSTATE92p.T100delc.299_301delCCAIn_Frame_Del144.47LNCAPCLONEFGCN000N
CREB3L2QSPFTHITSPROSTATE92p.T100delc.299_301delCCAIn_Frame_Del144.47MDAPCA2BN000N
CREB3L2QSPFTHITSPROSTATE92p.T100delc.299_301delCCAIn_Frame_Del144.47PC3N000N
CREB3L2QSPFTHITSPROSTATE92p.T100delc.299_301delCCAIn_Frame_Del144.47VCAPN000N
CREB3L2SPFTHITSDPROSTATE93p.T100delc.299_301delCCAIn_Frame_Del244.4722RV1N100N
CREB3L2SPFTHITSDPROSTATE93p.T100delc.299_301delCCAIn_Frame_Del244.47LNCAPCLONEFGCN100N
CREB3L2SPFTHITSDPROSTATE93p.T100delc.299_301delCCAIn_Frame_Del244.47MDAPCA2BN100N
CREB3L2SPFTHITSDPROSTATE93p.T100delc.299_301delCCAIn_Frame_Del244.47PC3N100N
CREB3L2SPFTHITSDPROSTATE93p.T100delc.299_301delCCAIn_Frame_Del244.47VCAPN100N
CREB3L2THITSDSFNPROSTATE96p.T100delc.299_301delCCAIn_Frame_Del344.4722RV1N100N
CREB3L2THITSDSFNPROSTATE96p.T100delc.299_301delCCAIn_Frame_Del344.47LNCAPCLONEFGCN100N
CREB3L2THITSDSFNPROSTATE96p.T100delc.299_301delCCAIn_Frame_Del344.47MDAPCA2BN100N
CREB3L2THITSDSFNPROSTATE96p.T100delc.299_301delCCAIn_Frame_Del344.47PC3N100N
CREB3L2THITSDSFNPROSTATE96p.T100delc.299_301delCCAIn_Frame_Del344.47VCAPN100N
CTBP2APSPNQPTNPROSTATE966p.K974fsc.2922_2922delAFrame_Shift_Del124.3422RV1N300N
CTBP2APSPNQPTNPROSTATE966p.K974fsc.2922_2922delAFrame_Shift_Del124.34DU145N300N
CTBP2APSPNQPTNPROSTATE966p.K974fsc.2922_2922delAFrame_Shift_Del124.34PC3N300N
CTBP2GTIESTPTSPROSTATE976p.K974fsc.2922_2922delAFrame_Shift_Del524.3422RV1N100N
CTBP2GTIESTPTSPROSTATE976p.K974fsc.2922_2922delAFrame_Shift_Del524.34DU145N100N
CTBP2GTIESTPTSPROSTATE976p.K974fsc.2922_2922delAFrame_Shift_Del524.34PC3N100N
CTBP2NQPTNTGTIPROSTATE970p.K974fsc.2922_2922delAFrame_Shift_Del424.3422RV1N1000N
CTBP2NQPTNTGTIPROSTATE970p.K974fsc.2922_2922delAFrame_Shift_Del424.34DU145N1000N
CTBP2NQPTNTGTIPROSTATE970p.K974fsc.2922_2922delAFrame_Shift_Del424.34PC3N1000N
CTBP2NTGTIESTPPROSTATE974p.K974fsc.2922_2922delAFrame_Shift_Del524.3422RV1N000N
CTBP2NTGTIESTPPROSTATE974p.K974fsc.2922_2922delAFrame_Shift_Del524.34DU145N000N
CTBP2NTGTIESTPPROSTATE974p.K974fsc.2922_2922delAFrame_Shift_Del524.34PC3N000N
CTBP2PNQPTNTGTPROSTATE969p.K974fsc.2922_2922delAFrame_Shift_Del324.3422RV1N000N
CTBP2PNQPTNTGTPROSTATE969p.K974fsc.2922_2922delAFrame_Shift_Del324.34DU145N000N
CTBP2PNQPTNTGTPROSTATE969p.K974fsc.2922_2922delAFrame_Shift_Del324.34PC3N000N
CTBP2PSPNQPTNTPROSTATE967p.K974fsc.2922_2922delAFrame_Shift_Del224.3422RV1N000N
CTBP2PSPNQPTNTPROSTATE967p.K974fsc.2922_2922delAFrame_Shift_Del224.34DU145N000N
CTBP2PSPNQPTNTPROSTATE967p.K974fsc.2922_2922delAFrame_Shift_Del224.34PC3N000N
CTBP2PTNTGTIESPROSTATE972p.K974fsc.2922_2922delAFrame_Shift_Del524.3422RV1N000N
CTBP2PTNTGTIESPROSTATE972p.K974fsc.2922_2922delAFrame_Shift_Del524.34DU145N000N
CTBP2PTNTGTIESPROSTATE972p.K974fsc.2922_2922delAFrame_Shift_Del524.34PC3N000N
CTBP2QPTNTGTIEPROSTATE971p.K974fsc.2922_2922delAFrame_Shift_Del524.3422RV1N000N
CTBP2QPTNTGTIEPROSTATE971p.K974fsc.2922_2922delAFrame_Shift_Del524.34DU145N000N
CTBP2QPTNTGTIEPROSTATE971p.K974fsc.2922_2922delAFrame_Shift_Del524.34PC3N000N
CTBP2SPNQPTNTGPROSTATE968p.K974fsc.2922_2922delAFrame_Shift_Del224.3422RV1N000N
CTBP2SPNQPTNTGPROSTATE968p.K974fsc.2922_2922delAFrame_Shift_Del224.34DU145N000N
CTBP2SPNQPTNTGPROSTATE968p.K974fsc.2922_2922delAFrame_Shift_Del224.34PC3N000N
CTBP2TGTIESTPTPROSTATE975p.K974fsc.2922_2922delAFrame_Shift_Del524.3422RV1N000N
CTBP2TGTIESTPTPROSTATE975p.K974fsc.2922_2922delAFrame_Shift_Del524.34DU145N000N
CTBP2TGTIESTPTPROSTATE975p.K974fsc.2922_2922delAFrame_Shift_Del524.34PC3N000N
CTBP2TIESTPTSNPROSTATE977p.K974fsc.2922_2922delAFrame_Shift_Del524.3422RV1N100N
CTBP2TIESTPTSNPROSTATE977p.K974fsc.2922_2922delAFrame_Shift_Del524.34DU145N100N
CTBP2TIESTPTSNPROSTATE977p.K974fsc.2922_2922delAFrame_Shift_Del524.34PC3N100N
CTBP2TNTGTIESTPROSTATE973p.K974fsc.2922_2922delAFrame_Shift_Del524.3422RV1N000N
CTBP2TNTGTIESTPROSTATE973p.K974fsc.2922_2922delAFrame_Shift_Del524.34DU145N000N
CTBP2TNTGTIESTPROSTATE973p.K974fsc.2922_2922delAFrame_Shift_Del524.34PC3N000N
CTNNB1CLQILGYGNPROSTATE300p.A305Gc.914C>GMissense_Mutation10.11DU145N000N
CTNNB1DCLQILGYGPROSTATE299p.A305Gc.914C>GMissense_Mutation10.11DU145N000N
CTNNB1GYGNQESKLPROSTATE305p.A305Gc.914C>GMissense_Mutation10.11DU145Y6100N
CTNNB1ILGYGNQESPROSTATE303p.A305Gc.914C>GMissense_Mutation10.11DU145N1010N
CTNNB1LGYGNQESKPROSTATE304p.A305Gc.914C>GMissense_Mutation10.11DU145N100N
CTNNB1LQILGYGNQPROSTATE301p.A305Gc.914C>GMissense_Mutation10.11DU145N0012N
CTNNB1QILGYGNQEPROSTATE302p.A305Gc.914C>GMissense_Mutation10.11DU145N000N
CTNNB1TDCLQILGYPROSTATE298p.A305Gc.914C>GMissense_Mutation10.11DU145N300N
CTNNB1TTDCLQILGPROSTATE297p.A305Gc.914C>GMissense_Mutation10.11DU145N100N
FLT3ACPQIRCTWPROSTATE375p.Y376Cc.1127A>GMissense_Mutation10.1122RV1N100N
FLT3CFSVRFKACPROSTATE368p.Y376Cc.1127A>GMissense_Mutation10.1122RV1N100N
FLT3CPQIRCTWTPROSTATE376p.Y376Cc.1127A>GMissense_Mutation10.1122RV1N500N
FLT3FKACPQIRCPROSTATE373p.Y376Cc.1127A>GMissense_Mutation10.1122RV1N301N
FLT3FSVRFKACPPROSTATE369p.Y376Cc.1127A>GMissense_Mutation10.1122RV1N204N
FLT3KACPQIRCTPROSTATE374p.Y376Cc.1127A>GMissense_Mutation10.1122RV1N200N
FLT3RFKACPQIRPROSTATE372p.Y376Cc.1127A>GMissense_Mutation10.1122RV1N100N
FLT3SVRFKACPQPROSTATE370p.Y376Cc.1127A>GMissense_Mutation10.1122RV1N100N
FLT3VRFKACPQIPROSTATE371p.Y376Cc.1127A>GMissense_Mutation10.1122RV1N7028N
FMN2LPPLPGAAIPROSTATE934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03NCIH660N1401N
FMN2PLPPLPGAAPROSTATE933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03NCIH660N000N
FMN2AEDVLGPRDPROSTATE23p.A26Vc.77C>TMissense_Mutation10.11MDAPCA2BN000N
FMN2DVLGPRDVEPROSTATE25p.A26Vc.77C>TMissense_Mutation10.11MDAPCA2BN000N
FMN2EDVLGPRDVPROSTATE24p.A26Vc.77C>TMissense_Mutation10.11MDAPCA2BN400N
FMN2EGGGGAEDVPROSTATE18p.A26Vc.77C>TMissense_Mutation10.11MDAPCA2BN500N
FMN2GAEDVLGPRPROSTATE22p.A26Vc.77C>TMissense_Mutation10.11MDAPCA2BN500N
FMN2GGAEDVLGPPROSTATE21p.A26Vc.77C>TMissense_Mutation10.11MDAPCA2BN000N
FMN2GGGAEDVLGPROSTATE20p.A26Vc.77C>TMissense_Mutation10.11MDAPCA2BN000N
FMN2GGGGAEDVLPROSTATE19p.A26Vc.77C>TMissense_Mutation10.11MDAPCA2BN900N
FMN2VLGPRDVEAPROSTATE26p.A26Vc.77C>TMissense_Mutation10.11MDAPCA2BN300Y
GPR112ASISDMFIQPROSTATE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.722RV1N000N
GPR112ASISDMFIQPROSTATE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7DU145N000N
GPR112ASISDMFIQPROSTATE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7MDAPCA2BN000N
GPR112ASISDMFIQPROSTATE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7NCIH660N000N
GPR112ASISDMFIQPROSTATE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7PC3N000N
GPR112ASISDMFIQPROSTATE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7VCAPN000N
GPR112ISDMFIQNLPROSTATE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.722RV1Y11100N
GPR112ISDMFIQNLPROSTATE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7DU145Y11100N
GPR112ISDMFIQNLPROSTATE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7MDAPCA2BY11100N
GPR112ISDMFIQNLPROSTATE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7NCIH660Y11100N
GPR112ISDMFIQNLPROSTATE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7PC3Y11100N
GPR112ISDMFIQNLPROSTATE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7VCAPY11100N
GPR112SASISDMFIPROSTATE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.722RV1N700N
GPR112SASISDMFIPROSTATE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7DU145N700N
GPR112SASISDMFIPROSTATE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7MDAPCA2BN700N
GPR112SASISDMFIPROSTATE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7NCIH660N700N
GPR112SASISDMFIPROSTATE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7PC3N700N
GPR112SASISDMFIPROSTATE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7VCAPN700N
GPR112SDMFIQNLAPROSTATE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.722RV1N400N
GPR112SDMFIQNLAPROSTATE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7DU145N400N
GPR112SDMFIQNLAPROSTATE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7MDAPCA2BN400N
GPR112SDMFIQNLAPROSTATE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7NCIH660N400N
GPR112SDMFIQNLAPROSTATE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7PC3N400N
GPR112SDMFIQNLAPROSTATE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7VCAPN400N
GPR112SISDMFIQNPROSTATE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.722RV1N000N
GPR112SISDMFIQNPROSTATE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7DU145N000N
GPR112SISDMFIQNPROSTATE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7MDAPCA2BN000N
GPR112SISDMFIQNPROSTATE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7NCIH660N000N
GPR112SISDMFIQNPROSTATE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7PC3N000N
GPR112SISDMFIQNPROSTATE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7VCAPN000N
GPR112VSASISDMFPROSTATE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.722RV1N900N
GPR112VSASISDMFPROSTATE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7DU145N900N
GPR112VSASISDMFPROSTATE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7MDAPCA2BN900N
GPR112VSASISDMFPROSTATE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7NCIH660N900N
GPR112VSASISDMFPROSTATE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7PC3N900N
GPR112VSASISDMFPROSTATE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7VCAPN900N
GPR112VVSASISDMPROSTATE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.722RV1N5020N
GPR112VVSASISDMPROSTATE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7DU145N5020N
GPR112VVSASISDMPROSTATE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7MDAPCA2BN5020N
GPR112VVSASISDMPROSTATE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7NCIH660N5020N
GPR112VVSASISDMPROSTATE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7PC3N5020N
GPR112VVSASISDMPROSTATE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7VCAPN5020N
JAK2DRCPDEIYMPROSTATE1092p.G1093Rc.3277G>AMissense_Mutation10.1122RV1Y3100N
JAK2GRLPRPDRCPROSTATE1086p.G1093Rc.3277G>AMissense_Mutation10.1122RV1N400N
JAK2LPRPDRCPDPROSTATE1088p.G1093Rc.3277G>AMissense_Mutation10.1122RV1N200N
JAK2NGRLPRPDRPROSTATE1085p.G1093Rc.3277G>AMissense_Mutation10.1122RV1N100N
JAK2PDRCPDEIYPROSTATE1091p.G1093Rc.3277G>AMissense_Mutation10.1122RV1N100N
JAK2PRPDRCPDEPROSTATE1089p.G1093Rc.3277G>AMissense_Mutation10.1122RV1N000N
JAK2RCPDEIYMIPROSTATE1093p.G1093Rc.3277G>AMissense_Mutation10.1122RV1N300N
JAK2RLPRPDRCPPROSTATE1087p.G1093Rc.3277G>AMissense_Mutation10.1122RV1N000N
JAK2RPDRCPDEIPROSTATE1090p.G1093Rc.3277G>AMissense_Mutation10.1122RV1Y1290N
MAML2AVQNMWMYGPROSTATE863p.G868Wc.2602G>TMissense_Mutation10.1122RV1N000N
MAML2LSTAVQNMWPROSTATE860p.G868Wc.2602G>TMissense_Mutation10.1122RV1N500N
MAML2MWMYGNLPCPROSTATE867p.G868Wc.2602G>TMissense_Mutation10.1122RV1N0012N
MAML2NMWMYGNLPPROSTATE866p.G868Wc.2602G>TMissense_Mutation10.1122RV1N200N
MAML2QNMWMYGNLPROSTATE865p.G868Wc.2602G>TMissense_Mutation10.1122RV1N800N
MAML2STAVQNMWMPROSTATE861p.G868Wc.2602G>TMissense_Mutation10.1122RV1Y2100N
MAML2TAVQNMWMYPROSTATE862p.G868Wc.2602G>TMissense_Mutation10.1122RV1Y7120N
MAML2VQNMWMYGNPROSTATE864p.G868Wc.2602G>TMissense_Mutation10.1122RV1N001N
MAML2WMYGNLPCNPROSTATE868p.G868Wc.2602G>TMissense_Mutation10.1122RV1N602N
MAP3K1STTTTTTTEPROSTATE941p.T949delc.2822_2824delCAAIn_Frame_Del176.4422RV1N000N
MAP3K1STTTTTTTEPROSTATE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44LNCAPCLONEFGCN000N
MAP3K1STTTTTTTEPROSTATE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44MDAPCA2BN000N
MAP3K1STTTTTTTEPROSTATE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44NCIH660N000N
MAP3K1STTTTTTTEPROSTATE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44PC3N000N
MAP3K1STTTTTTTEPROSTATE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44VCAPN000N
MAP3K4APKELFHEAPROSTATE800p.L801Pc.2402T>CMissense_Mutation10.11MDAPCA2BN900N
MAP3K4CIFMEYCDEPROSTATE1416p.Y1416Cc.4247A>GMissense_Mutation10.11MDAPCA2BN000N
MAP3K4EEMCIFMEYPROSTATE1413p.Y1416Cc.4247A>GMissense_Mutation10.11MDAPCA2BN600N
MAP3K4EISRAPKELPROSTATE796p.L801Pc.2402T>CMissense_Mutation10.11MDAPCA2BN400N
MAP3K4ELHREEMCIPROSTATE1409p.Y1416Cc.4247A>GMissense_Mutation10.11MDAPCA2BN400N
MAP3K4EMCIFMEYCPROSTATE1414p.Y1416Cc.4247A>GMissense_Mutation10.11MDAPCA2BN300N
MAP3K4HREEMCIFMPROSTATE1411p.Y1416Cc.4247A>GMissense_Mutation10.11MDAPCA2BY490N
MAP3K4IEISRAPKEPROSTATE795p.L801Pc.2402T>CMissense_Mutation10.11MDAPCA2BN200N
MAP3K4ISRAPKELFPROSTATE797p.L801Pc.2402T>CMissense_Mutation10.11MDAPCA2BN500N
MAP3K4LHREEMCIFPROSTATE1410p.Y1416Cc.4247A>GMissense_Mutation10.11MDAPCA2BN200N
MAP3K4MCIFMEYCDPROSTATE1415p.Y1416Cc.4247A>GMissense_Mutation10.11MDAPCA2BN000N
MAP3K4PKELFHEARPROSTATE801p.L801Pc.2402T>CMissense_Mutation10.11MDAPCA2BN100N
MAP3K4RAPKELFHEPROSTATE799p.L801Pc.2402T>CMissense_Mutation10.11MDAPCA2BN000N
MAP3K4REEMCIFMEPROSTATE1412p.Y1416Cc.4247A>GMissense_Mutation10.11MDAPCA2BN000N
MAP3K4SRAPKELFHPROSTATE798p.L801Pc.2402T>CMissense_Mutation10.11MDAPCA2BN200N
MAP3K4SVIEISRAPPROSTATE793p.L801Pc.2402T>CMissense_Mutation10.11MDAPCA2BN000N
MAP3K4VELHREEMCPROSTATE1408p.Y1416Cc.4247A>GMissense_Mutation10.11MDAPCA2BN600N
MAP3K4VIEISRAPKPROSTATE794p.L801Pc.2402T>CMissense_Mutation10.11MDAPCA2BN300N
MEN1AARLRCQHPPROSTATE537p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1N100N
MEN1ALKVAARLRPROSTATE533p.R521fsc.1561_1561delCFrame_Shift_Del40.1122RV1Y3100N
MEN1AQPEALKVAPROSTATE529p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1N400N
MEN1ARLRCQHPQPROSTATE538p.R521fsc.1561_1561delCFrame_Shift_Del60.1122RV1N100N
MEN1AVSGPPGSLPROSTATE515p.R521fsc.1561_1561delCFrame_Shift_Del30.1122RV1N500N
MEN1CQHPQHHHRPROSTATE542p.R521fsc.1561_1561delCFrame_Shift_Del70.1122RV1N500N
MEN1EALKVAARLPROSTATE532p.R521fsc.1561_1561delCFrame_Shift_Del40.1122RV1N1500N
MEN1GAVSGPPGSPROSTATE514p.R521fsc.1561_1561delCFrame_Shift_Del20.1122RV1N200N
MEN1GLSLAQPEAPROSTATE525p.R521fsc.1561_1561delCFrame_Shift_Del40.1122RV1N400N
MEN1GPPGSLLGLPROSTATE518p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1N2000N
MEN1GSLLGLSLAPROSTATE521p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1N300N
MEN1HHHRRRVQCPROSTATE547p.R521fsc.1561_1561delCFrame_Shift_Del60.1122RV1N200N
MEN1HHRRRVQCSPROSTATE548p.R521fsc.1561_1561delCFrame_Shift_Del60.1122RV1N100N
MEN1HPQHHHRRRPROSTATE544p.R521fsc.1561_1561delCFrame_Shift_Del60.1122RV1N400N
MEN1HRRRVQCSLPROSTATE549p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1Y690N
MEN1KVAARLRCQPROSTATE535p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1N000N
MEN1LAQPEALKVPROSTATE528p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1N600N
MEN1LGLSLAQPEPROSTATE524p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1N000N
MEN1LKVAARLRCPROSTATE534p.R521fsc.1561_1561delCFrame_Shift_Del40.1122RV1N1030N
MEN1LLGLSLAQPPROSTATE523p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1N000N
MEN1LRCQHPQHHPROSTATE540p.R521fsc.1561_1561delCFrame_Shift_Del60.1122RV1N2022N
MEN1LSLAQPEALPROSTATE526p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1N1200N
MEN1PEALKVAARPROSTATE531p.R521fsc.1561_1561delCFrame_Shift_Del40.1122RV1N000N
MEN1PGSLLGLSLPROSTATE520p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1N000N
MEN1PPGSLLGLSPROSTATE519p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1N000N
MEN1PQHHHRRRVPROSTATE545p.R521fsc.1561_1561delCFrame_Shift_Del60.1122RV1N100N
MEN1QCSLSRVRRPROSTATE554p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1Y390N
MEN1QGAVSGPPGPROSTATE513p.R521fsc.1561_1561delCFrame_Shift_Del10.1122RV1N000N
MEN1QHHHRRRVQPROSTATE546p.R521fsc.1561_1561delCFrame_Shift_Del60.1122RV1N000N
MEN1QHPQHHHRRPROSTATE543p.R521fsc.1561_1561delCFrame_Shift_Del70.1122RV1N100N
MEN1QPEALKVAAPROSTATE530p.R521fsc.1561_1561delCFrame_Shift_Del40.1122RV1N600N
MEN1RCQHPQHHHPROSTATE541p.R521fsc.1561_1561delCFrame_Shift_Del70.1122RV1N000N
MEN1RLRCQHPQHPROSTATE539p.R521fsc.1561_1561delCFrame_Shift_Del60.1122RV1N100N
MEN1RRRVQCSLSPROSTATE550p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1N200N
MEN1RRVQCSLSRPROSTATE551p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1N400N
MEN1RVQCSLSRVPROSTATE552p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1Y3110N
MEN1SGPPGSLLGPROSTATE517p.R521fsc.1561_1561delCFrame_Shift_Del40.1122RV1N100N
MEN1SLAQPEALKPROSTATE527p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1Y5160N
MEN1SLLGLSLAQPROSTATE522p.R521fsc.1561_1561delCFrame_Shift_Del40.1122RV1N000N
MEN1VAARLRCQHPROSTATE536p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1N006N
MEN1VQCSLSRVRPROSTATE553p.R521fsc.1561_1561delCFrame_Shift_Del50.1122RV1N403N
MEN1VSGPPGSLLPROSTATE516p.R521fsc.1561_1561delCFrame_Shift_Del40.1122RV1N1100N
MEN1DLHTDLLELPROSTATE253p.S258Lc.773C>TMissense_Mutation10.1122RV1Y9100N
MEN1DLLELLQLQPROSTATE257p.S258Lc.773C>TMissense_Mutation10.1122RV1N000N
MEN1GSHMRCDRKPROSTATE230p.Y232Hc.694T>CMissense_Mutation10.1122RV1N100N
MEN1HMRCDRKMEPROSTATE232p.Y232Hc.694T>CMissense_Mutation10.1122RV1N100N
MEN1HTDLLELLQPROSTATE255p.S258Lc.773C>TMissense_Mutation10.1122RV1N100N
MEN1IDLHTDLLEPROSTATE252p.S258Lc.773C>TMissense_Mutation10.1122RV1N100N
MEN1KGSHMRCDRPROSTATE229p.Y232Hc.694T>CMissense_Mutation10.1122RV1N000N
MEN1LHTDLLELLPROSTATE254p.S258Lc.773C>TMissense_Mutation10.1122RV1N606N
MEN1LKGSHMRCDPROSTATE228p.Y232Hc.694T>CMissense_Mutation10.1122RV1N000N
MEN1LLELLQLQQPROSTATE258p.S258Lc.773C>TMissense_Mutation10.1122RV1N105N
MEN1LYLKGSHMRPROSTATE226p.Y232Hc.694T>CMissense_Mutation10.1122RV1N2013N
MEN1PSIDLHTDLPROSTATE250p.S258Lc.773C>TMissense_Mutation10.1122RV1N000N
MEN1SHMRCDRKMPROSTATE231p.Y232Hc.694T>CMissense_Mutation10.1122RV1N200N
MEN1SIDLHTDLLPROSTATE251p.S258Lc.773C>TMissense_Mutation10.1122RV1N500N
MEN1SWLYLKGSHPROSTATE224p.Y232Hc.694T>CMissense_Mutation10.1122RV1N000N
MEN1TDLLELLQLPROSTATE256p.S258Lc.773C>TMissense_Mutation10.1122RV1N700N
MEN1WLYLKGSHMPROSTATE225p.Y232Hc.694T>CMissense_Mutation10.1122RV1Y13107N
MEN1YLKGSHMRCPROSTATE227p.Y232Hc.694T>CMissense_Mutation10.1122RV1N402N
MLH1APLFDLVMLPROSTATE580p.A586Vc.1757C>TMissense_Mutation10.11DU145Y22100N
MLH1DLVMLALDSPROSTATE584p.A586Vc.1757C>TMissense_Mutation10.11DU145N000N
MLH1EPAPLFDLVPROSTATE578p.A586Vc.1757C>TMissense_Mutation10.11DU145Y12110N
MLH1FDLVMLALDPROSTATE583p.A586Vc.1757C>TMissense_Mutation10.11DU145N300N
MLH1LFDLVMLALPROSTATE582p.A586Vc.1757C>TMissense_Mutation10.11DU145N900N
MLH1LVMLALDSPPROSTATE585p.A586Vc.1757C>TMissense_Mutation10.11DU145N004N
MLH1PAPLFDLVMPROSTATE579p.A586Vc.1757C>TMissense_Mutation10.11DU145N000N
MLH1PLFDLVMLAPROSTATE581p.A586Vc.1757C>TMissense_Mutation10.11DU145N400N
MLH1VMLALDSPEPROSTATE586p.A586Vc.1757C>TMissense_Mutation10.11DU145N001N
MLL3ACEIIPSDTPROSTATE4683p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BN100N
MLL3AEILSWNFLPROSTATE4692p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BY11110N
MLL3CEIIPSDTAPROSTATE4684p.N4686fsc.14057_14057delAFrame_Shift_Del40.11MDAPCA2BN500N
MLL3DTAEILSWNPROSTATE4690p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BN000N
MLL3EACEIIPSDPROSTATE4682p.N4686fsc.14057_14057delAFrame_Shift_Del40.11MDAPCA2BN000N
MLL3EIIPSDTAEPROSTATE4685p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BN000N
MLL3EILSWNFLLPROSTATE4693p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BN1200N
MLL3FLLPLTPQVPROSTATE4699p.N4686fsc.14057_14057delAFrame_Shift_Del40.11MDAPCA2BN1102N
MLL3GVEACEIIPPROSTATE4680p.N4686fsc.14057_14057delAFrame_Shift_Del30.11MDAPCA2BN000N
MLL3IIPSDTAEIPROSTATE4686p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BN7016N
MLL3ILSWNFLLPPROSTATE4694p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BN000N
MLL3IPSDTAEILPROSTATE4687p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BY16100N
MLL3LLPLTPQVVPROSTATE4700p.N4686fsc.14057_14057delAFrame_Shift_Del40.11MDAPCA2BN802N
MLL3LPGVEACEIPROSTATE4678p.N4686fsc.14057_14057delAFrame_Shift_Del10.11MDAPCA2BN1200N
MLL3LPLTPQVVPPROSTATE4701p.N4686fsc.14057_14057delAFrame_Shift_Del40.11MDAPCA2BN200Y
MLL3LSWNFLLPLPROSTATE4695p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BN2100N
MLL3LTPQVVPVLPROSTATE4703p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BN1500N
MLL3NFLLPLTPQPROSTATE4698p.N4686fsc.14057_14057delAFrame_Shift_Del40.11MDAPCA2BN000N
MLL3PGVEACEIIPROSTATE4679p.N4686fsc.14057_14057delAFrame_Shift_Del20.11MDAPCA2BN400N
MLL3PLTPQVVPVPROSTATE4702p.N4686fsc.14057_14057delAFrame_Shift_Del40.11MDAPCA2BN300N
MLL3PQVVPVLNLPROSTATE4705p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BN200N
MLL3PSDTAEILSPROSTATE4688p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BN000N
MLL3QVVPVLNLKPROSTATE4706p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BY5140N
MLL3SDTAEILSWPROSTATE4689p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BN400N
MLL3SWNFLLPLTPROSTATE4696p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BN000N
MLL3TAEILSWNFPROSTATE4691p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BN400N
MLL3TPQVVPVLNPROSTATE4704p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BN300N
MLL3VEACEIIPSPROSTATE4681p.N4686fsc.14057_14057delAFrame_Shift_Del40.11MDAPCA2BN404N
MLL3WNFLLPLTPPROSTATE4697p.N4686fsc.14057_14057delAFrame_Shift_Del50.11MDAPCA2BN2020N
MLL3AIKAQCMFLPROSTATE4488p.F4496fsc.13488_13488delTFrame_Shift_Del10.55DU145Y4100N
MLL3AIKAQCMFLPROSTATE4488p.F4496fsc.13488_13488delTFrame_Shift_Del10.55LNCAPCLONEFGCY4100N
MLL3APCTNQREFPROSTATE4503p.F4496fsc.13488_13488delTFrame_Shift_Del40.55DU145Y12100N
MLL3APCTNQREFPROSTATE4503p.F4496fsc.13488_13488delTFrame_Shift_Del40.55LNCAPCLONEFGCY12100N
MLL3AQCMFLRTKPROSTATE4491p.F4496fsc.13488_13488delTFrame_Shift_Del30.55DU145Y1130N
MLL3AQCMFLRTKPROSTATE4491p.F4496fsc.13488_13488delTFrame_Shift_Del30.55LNCAPCLONEFGCY1130N
MLL3CFAPCTNQRPROSTATE4501p.F4496fsc.13488_13488delTFrame_Shift_Del40.55DU145Y290N
MLL3CFAPCTNQRPROSTATE4501p.F4496fsc.13488_13488delTFrame_Shift_Del40.55LNCAPCLONEFGCY290N
MLL3CMFLRTKLCPROSTATE4493p.F4496fsc.13488_13488delTFrame_Shift_Del50.55DU145N200N
MLL3CMFLRTKLCPROSTATE4493p.F4496fsc.13488_13488delTFrame_Shift_Del50.55LNCAPCLONEFGCN200N
MLL3CTNQREFMSPROSTATE4505p.F4496fsc.13488_13488delTFrame_Shift_Del50.55DU145N000Y
MLL3CTNQREFMSPROSTATE4505p.F4496fsc.13488_13488delTFrame_Shift_Del50.55LNCAPCLONEFGCN000Y
MLL3FAPCTNQREPROSTATE4502p.F4496fsc.13488_13488delTFrame_Shift_Del40.55DU145N201N
MLL3FAPCTNQREPROSTATE4502p.F4496fsc.13488_13488delTFrame_Shift_Del40.55LNCAPCLONEFGCN201N
MLL3FLRTKLCFAPROSTATE4495p.F4496fsc.13488_13488delTFrame_Shift_Del50.55DU145N802N
MLL3FLRTKLCFAPROSTATE4495p.F4496fsc.13488_13488delTFrame_Shift_Del50.55LNCAPCLONEFGCN802N
MLL3IKAQCMFLRPROSTATE4489p.F4496fsc.13488_13488delTFrame_Shift_Del20.55DU145N100N
MLL3IKAQCMFLRPROSTATE4489p.F4496fsc.13488_13488delTFrame_Shift_Del20.55LNCAPCLONEFGCN100N
MLL3KAQCMFLRTPROSTATE4490p.F4496fsc.13488_13488delTFrame_Shift_Del30.55DU145N400N
MLL3KAQCMFLRTPROSTATE4490p.F4496fsc.13488_13488delTFrame_Shift_Del30.55LNCAPCLONEFGCN400N
MLL3KLCFAPCTNPROSTATE4499p.F4496fsc.13488_13488delTFrame_Shift_Del50.55DU145N000N
MLL3KLCFAPCTNPROSTATE4499p.F4496fsc.13488_13488delTFrame_Shift_Del50.55LNCAPCLONEFGCN000N
MLL3LCFAPCTNQPROSTATE4500p.F4496fsc.13488_13488delTFrame_Shift_Del40.55DU145N001N
MLL3LCFAPCTNQPROSTATE4500p.F4496fsc.13488_13488delTFrame_Shift_Del40.55LNCAPCLONEFGCN001N
MLL3LRTKLCFAPPROSTATE4496p.F4496fsc.13488_13488delTFrame_Shift_Del50.55DU145N1015N
MLL3LRTKLCFAPPROSTATE4496p.F4496fsc.13488_13488delTFrame_Shift_Del50.55LNCAPCLONEFGCN1015N
MLL3MFLRTKLCFPROSTATE4494p.F4496fsc.13488_13488delTFrame_Shift_Del60.55DU145N6026N
MLL3MFLRTKLCFPROSTATE4494p.F4496fsc.13488_13488delTFrame_Shift_Del60.55LNCAPCLONEFGCN6026N
MLL3NQREFMSKNPROSTATE4507p.F4496fsc.13488_13488delTFrame_Shift_Del50.55DU145N100N
MLL3NQREFMSKNPROSTATE4507p.F4496fsc.13488_13488delTFrame_Shift_Del50.55LNCAPCLONEFGCN100N
MLL3PCTNQREFMPROSTATE4504p.F4496fsc.13488_13488delTFrame_Shift_Del40.55DU145N000N
MLL3PCTNQREFMPROSTATE4504p.F4496fsc.13488_13488delTFrame_Shift_Del40.55LNCAPCLONEFGCN000N
MLL3QCMFLRTKLPROSTATE4492p.F4496fsc.13488_13488delTFrame_Shift_Del40.55DU145N900N
MLL3QCMFLRTKLPROSTATE4492p.F4496fsc.13488_13488delTFrame_Shift_Del40.55LNCAPCLONEFGCN900N
MLL3RTKLCFAPCPROSTATE4497p.F4496fsc.13488_13488delTFrame_Shift_Del50.55DU145Y290N
MLL3RTKLCFAPCPROSTATE4497p.F4496fsc.13488_13488delTFrame_Shift_Del50.55LNCAPCLONEFGCY290N
MLL3TKLCFAPCTPROSTATE4498p.F4496fsc.13488_13488delTFrame_Shift_Del50.55DU145N100N
MLL3TKLCFAPCTPROSTATE4498p.F4496fsc.13488_13488delTFrame_Shift_Del50.55LNCAPCLONEFGCN100N
MLL3TNQREFMSKPROSTATE4506p.F4496fsc.13488_13488delTFrame_Shift_Del50.55DU145N000N
MLL3TNQREFMSKPROSTATE4506p.F4496fsc.13488_13488delTFrame_Shift_Del50.55LNCAPCLONEFGCN000N
MLL3GTRKQNSGSPROSTATE2798p.K2797fsc.8390_8391insAFrame_Shift_Ins41.11LNCAPCLONEFGCN000Y
MLL3KGTRKQNSGPROSTATE2797p.K2797fsc.8390_8391insAFrame_Shift_Ins51.11LNCAPCLONEFGCN000N
MLL3KKGTRKQNSPROSTATE2796p.K2797fsc.8390_8391insAFrame_Shift_Ins41.11LNCAPCLONEFGCN100N
MLL3TRKQNSGSLPROSTATE2799p.K2797fsc.8390_8391insAFrame_Shift_Ins41.11LNCAPCLONEFGCN500Y
MLL3EPKKKGTRKPROSTATE2793p.K2797fsc.8390_8391insAFrame_Shift_Ins30.77LNCAPCLONEFGCN200Y
MLL3KKKGTRKQNPROSTATE2795p.K2797fsc.8390_8391insAFrame_Shift_Ins30.77LNCAPCLONEFGCN200Y
MLL3PKKKGTRKQPROSTATE2794p.K2797fsc.8390_8391insAFrame_Shift_Ins30.77LNCAPCLONEFGCN000Y
MLL3SVEPKKKGTPROSTATE2791p.K2797fsc.8390_8391insAFrame_Shift_Ins20.77LNCAPCLONEFGCN200N
MLL3VEPKKKGTRPROSTATE2792p.K2797fsc.8390_8391insAFrame_Shift_Ins30.77LNCAPCLONEFGCN003Y
MLL3VSVEPKKKGPROSTATE2790p.K2797fsc.8390_8391insAFrame_Shift_Ins10.77LNCAPCLONEFGCN000N
MLL3AHQISRPNPPROSTATE3156p.T3156Ac.9466A>GMissense_Mutation10.1122RV1N000N
MLL3AIPQDGSIAPROSTATE3148p.T3156Ac.9466A>GMissense_Mutation10.1122RV1N100N
MLL3DGSIAHQISPROSTATE3152p.T3156Ac.9466A>GMissense_Mutation10.1122RV1N100N
MLL3DYNNETEVEPROSTATE541p.M546Tc.1637T>CMissense_Mutation10.1122RV1N000N
MLL3EPGTLYFVSPROSTATE4058p.A4065Vc.12194C>TMissense_Mutation10.1122RV1N600N
MLL3ETEVEGPEDPROSTATE545p.M546Tc.1637T>CMissense_Mutation10.1122RV1N000Y
MLL3ETLVSPYEEPROSTATE697p.H703Yc.2107C>TMissense_Mutation10.11MDAPCA2BN000N
MLL3EYRQHSLLRPROSTATE4137p.L4142Sc.12425T>CMissense_Mutation10.11LNCAPCLONEFGCN200N
MLL3FGFQHLLVQPROSTATE1788p.S1790Fc.5369C>TMissense_Mutation10.11LNCAPCLONEFGCN2020N
MLL3FQHLLVQSGPROSTATE1790p.S1790Fc.5369C>TMissense_Mutation10.11LNCAPCLONEFGCN2019N
MLL3FVSPFGPSPPROSTATE4064p.A4065Vc.12194C>TMissense_Mutation10.1122RV1N200N
MLL3GFQHLLVQSPROSTATE1789p.S1790Fc.5369C>TMissense_Mutation10.11LNCAPCLONEFGCN000N
MLL3GLEYRQHSLPROSTATE4135p.L4142Sc.12425T>CMissense_Mutation10.11LNCAPCLONEFGCN1000N
MLL3GSIAHQISRPROSTATE3153p.T3156Ac.9466A>GMissense_Mutation10.1122RV1N400N
MLL3GTLYFVSPFPROSTATE4060p.A4065Vc.12194C>TMissense_Mutation10.1122RV1N600N
MLL3HSKSSQYQKPROSTATE4756p.R4763Qc.14288G>AMissense_Mutation10.1122RV1Y1130N
MLL3HSLLRGPPPPROSTATE4141p.L4142Sc.12425T>CMissense_Mutation10.11LNCAPCLONEFGCN100N
MLL3IAHQISRPNPROSTATE3155p.T3156Ac.9466A>GMissense_Mutation10.1122RV1N100N
MLL3IPQDGSIAHPROSTATE3149p.T3156Ac.9466A>GMissense_Mutation10.1122RV1N201N
MLL3KSSQYQKMKPROSTATE4758p.R4763Qc.14288G>AMissense_Mutation10.1122RV1N200N
MLL3LETLVSPYEPROSTATE696p.H703Yc.2107C>TMissense_Mutation10.11MDAPCA2BN000N
MLL3LEYRQHSLLPROSTATE4136p.L4142Sc.12425T>CMissense_Mutation10.11LNCAPCLONEFGCN1500N
MLL3LTTDYNNETPROSTATE538p.M546Tc.1637T>CMissense_Mutation10.1122RV1N100N
MLL3LVSPYEESIPROSTATE699p.H703Yc.2107C>TMissense_Mutation10.11MDAPCA2BN800N
MLL3LYFVSPFGPPROSTATE4062p.A4065Vc.12194C>TMissense_Mutation10.1122RV1N002N
MLL3NETEVEGPEPROSTATE544p.M546Tc.1637T>CMissense_Mutation10.1122RV1N000N
MLL3NNETEVEGPPROSTATE543p.M546Tc.1637T>CMissense_Mutation10.1122RV1N000N
MLL3PGLEYRQHSPROSTATE4134p.L4142Sc.12425T>CMissense_Mutation10.11LNCAPCLONEFGCN000N
MLL3PGTLYFVSPPROSTATE4059p.A4065Vc.12194C>TMissense_Mutation10.1122RV1N000N
MLL3PLETLVSPYPROSTATE695p.H703Yc.2107C>TMissense_Mutation10.11MDAPCA2BN300N
MLL3PQDGSIAHQPROSTATE3150p.T3156Ac.9466A>GMissense_Mutation10.1122RV1N000N
MLL3PYEESISLCPROSTATE702p.H703Yc.2107C>TMissense_Mutation10.11MDAPCA2BN000N
MLL3QDGSIAHQIPROSTATE3151p.T3156Ac.9466A>GMissense_Mutation10.1122RV1N200N
MLL3QFGFQHLLVPROSTATE1787p.S1790Fc.5369C>TMissense_Mutation10.11LNCAPCLONEFGCN200N
MLL3QHSLLRGPPPROSTATE4140p.L4142Sc.12425T>CMissense_Mutation10.11LNCAPCLONEFGCN000N
MLL3QKMKTEWKSPROSTATE4763p.R4763Qc.14288G>AMissense_Mutation10.1122RV1N100N
MLL3QQFGFQHLLPROSTATE1786p.S1790Fc.5369C>TMissense_Mutation10.11LNCAPCLONEFGCY17120N
MLL3QQQFGFQHLPROSTATE1785p.S1790Fc.5369C>TMissense_Mutation10.11LNCAPCLONEFGCY13110N
MLL3QQQQFGFQHPROSTATE1784p.S1790Fc.5369C>TMissense_Mutation10.11LNCAPCLONEFGCN100Y
MLL3QQQQQFGFQPROSTATE1783p.S1790Fc.5369C>TMissense_Mutation10.11LNCAPCLONEFGCN000Y
MLL3QQQQQQFGFPROSTATE1782p.S1790Fc.5369C>TMissense_Mutation10.11LNCAPCLONEFGCN500Y
MLL3QYQKMKTEWPROSTATE4761p.R4763Qc.14288G>AMissense_Mutation10.1122RV1N400N
MLL3RQHSLLRGPPROSTATE4139p.L4142Sc.12425T>CMissense_Mutation10.11LNCAPCLONEFGCN000N
MLL3SIAHQISRPPROSTATE3154p.T3156Ac.9466A>GMissense_Mutation10.1122RV1N000N
MLL3SKSSQYQKMPROSTATE4757p.R4763Qc.14288G>AMissense_Mutation10.1122RV1N400N
MLL3SLLRGPPPGPROSTATE4142p.L4142Sc.12425T>CMissense_Mutation10.11LNCAPCLONEFGCN000N
MLL3SPYEESISLPROSTATE701p.H703Yc.2107C>TMissense_Mutation10.11MDAPCA2BY20100N
MLL3SQYQKMKTEPROSTATE4760p.R4763Qc.14288G>AMissense_Mutation10.1122RV1N000N
MLL3SSQYQKMKTPROSTATE4759p.R4763Qc.14288G>AMissense_Mutation10.1122RV1N100N
MLL3TDYNNETEVPROSTATE540p.M546Tc.1637T>CMissense_Mutation10.1122RV1N500N
MLL3TEPGTLYFVPROSTATE4057p.A4065Vc.12194C>TMissense_Mutation10.1122RV1Y9100N
MLL3TEVEGPEDQPROSTATE546p.M546Tc.1637T>CMissense_Mutation10.1122RV1N100N
MLL3TLVSPYEESPROSTATE698p.H703Yc.2107C>TMissense_Mutation10.11MDAPCA2BN100N
MLL3TLYFVSPFGPROSTATE4061p.A4065Vc.12194C>TMissense_Mutation10.1122RV1N100N
MLL3TTDYNNETEPROSTATE539p.M546Tc.1637T>CMissense_Mutation10.1122RV1N000N
MLL3VHSKSSQYQPROSTATE4755p.R4763Qc.14288G>AMissense_Mutation10.1122RV1N0010N
MLL3VSPFGPSPNPROSTATE4065p.A4065Vc.12194C>TMissense_Mutation10.1122RV1N100N
MLL3VSPYEESISPROSTATE700p.H703Yc.2107C>TMissense_Mutation10.11MDAPCA2BN000N
MLL3YEESISLCPPROSTATE703p.H703Yc.2107C>TMissense_Mutation10.11MDAPCA2BN200N
MLL3YFVSPFGPSPROSTATE4063p.A4065Vc.12194C>TMissense_Mutation10.1122RV1N200N
MLL3YNNETEVEGPROSTATE542p.M546Tc.1637T>CMissense_Mutation10.1122RV1N100N
MLL3YQKMKTEWKPROSTATE4762p.R4763Qc.14288G>AMissense_Mutation10.1122RV1N5013N
MLL3YRQHSLLRGPROSTATE4138p.L4142Sc.12425T>CMissense_Mutation10.11LNCAPCLONEFGCN3023N
MSH2ASIIRSATKPROSTATE733p.L736Ic.2206C>AMissense_Mutation10.11DU145Y2110N
MSH2EMLETASIIPROSTATE728p.L736Ic.2206C>AMissense_Mutation10.11DU145N1200N
MSH2ETASIIRSAPROSTATE731p.L736Ic.2206C>AMissense_Mutation10.11DU145N300N
MSH2IIRSATKDSPROSTATE735p.L736Ic.2206C>AMissense_Mutation10.11DU145N0031N
MSH2IRSATKDSLPROSTATE736p.L736Ic.2206C>AMissense_Mutation10.11DU145N606N
MSH2LETASIIRSPROSTATE730p.L736Ic.2206C>AMissense_Mutation10.11DU145N404N
MSH2MLETASIIRPROSTATE729p.L736Ic.2206C>AMissense_Mutation10.11DU145N702N
MSH2SIIRSATKDPROSTATE734p.L736Ic.2206C>AMissense_Mutation10.11DU145N000N
MSH2TASIIRSATPROSTATE732p.L736Ic.2206C>AMissense_Mutation10.11DU145N300N
MSH3ALWECSLPQPROSTATE389p.K381fsc.1141_1141delAFrame_Shift_Del62.6522RV1N000N
MSH3ALWECSLPQPROSTATE389p.K381fsc.1141_1141delAFrame_Shift_Del62.65DU145N000N
MSH3ALWECSLPQPROSTATE389p.K381fsc.1141_1141delAFrame_Shift_Del62.65LNCAPCLONEFGCN000N
MSH3ARLCLIVSRPROSTATE398p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1Y390N
MSH3ARLCLIVSRPROSTATE398p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145Y390N
MSH3ARLCLIVSRPROSTATE398p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCY390N
MSH3ATFLLALWEPROSTATE384p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1N000N
MSH3ATFLLALWEPROSTATE384p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145N000N
MSH3ATFLLALWEPROSTATE384p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCN000N
MSH3CLIVSRTLLPROSTATE401p.K381fsc.1141_1141delAFrame_Shift_Del62.6522RV1N1400N
MSH3CLIVSRTLLPROSTATE401p.K381fsc.1141_1141delAFrame_Shift_Del62.65DU145N1400N
MSH3CLIVSRTLLPROSTATE401p.K381fsc.1141_1141delAFrame_Shift_Del62.65LNCAPCLONEFGCN1400N
MSH3CSLPQARLCPROSTATE393p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1N200N
MSH3CSLPQARLCPROSTATE393p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145N200N
MSH3CSLPQARLCPROSTATE393p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCN200N
MSH3DKKRATFLLPROSTATE380p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1N500N
MSH3DKKRATFLLPROSTATE380p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145N500N
MSH3DKKRATFLLPROSTATE380p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCN500N
MSH3ECSLPQARLPROSTATE392p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1Y490N
MSH3ECSLPQARLPROSTATE392p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145Y490N
MSH3ECSLPQARLPROSTATE392p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCY490N
MSH3ENVRDKKRAPROSTATE376p.K381fsc.1141_1141delAFrame_Shift_Del22.6522RV1N100N
MSH3ENVRDKKRAPROSTATE376p.K381fsc.1141_1141delAFrame_Shift_Del22.65DU145N100N
MSH3ENVRDKKRAPROSTATE376p.K381fsc.1141_1141delAFrame_Shift_Del22.65LNCAPCLONEFGCN100N
MSH3FLLALWECSPROSTATE386p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1N203N
MSH3FLLALWECSPROSTATE386p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145N203N
MSH3FLLALWECSPROSTATE386p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCN203N
MSH3IVSRTLLLVPROSTATE403p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1Y4927N
MSH3IVSRTLLLVPROSTATE403p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145Y4927N
MSH3IVSRTLLLVPROSTATE403p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCY4927N
MSH3KENVRDKKRPROSTATE375p.K381fsc.1141_1141delAFrame_Shift_Del12.6522RV1Y090Y
MSH3KENVRDKKRPROSTATE375p.K381fsc.1141_1141delAFrame_Shift_Del12.65DU145Y090Y
MSH3KENVRDKKRPROSTATE375p.K381fsc.1141_1141delAFrame_Shift_Del12.65LNCAPCLONEFGCY090Y
MSH3KKRATFLLAPROSTATE381p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1N200N
MSH3KKRATFLLAPROSTATE381p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145N200N
MSH3KKRATFLLAPROSTATE381p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCN200N
MSH3KRATFLLALPROSTATE382p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1Y990N
MSH3KRATFLLALPROSTATE382p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145Y990N
MSH3KRATFLLALPROSTATE382p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCY990N
MSH3LALWECSLPPROSTATE388p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1N000N
MSH3LALWECSLPPROSTATE388p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145N000N
MSH3LALWECSLPPROSTATE388p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCN000N
MSH3LCLIVSRTLPROSTATE400p.K381fsc.1141_1141delAFrame_Shift_Del62.6522RV1N1207N
MSH3LCLIVSRTLPROSTATE400p.K381fsc.1141_1141delAFrame_Shift_Del62.65DU145N1207N
MSH3LCLIVSRTLPROSTATE400p.K381fsc.1141_1141delAFrame_Shift_Del62.65LNCAPCLONEFGCN1207N
MSH3LIVSRTLLLPROSTATE402p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1Y15924N
MSH3LIVSRTLLLPROSTATE402p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145Y15924N
MSH3LIVSRTLLLPROSTATE402p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCY15924N
MSH3LLALWECSLPROSTATE387p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1N1000N
MSH3LLALWECSLPROSTATE387p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145N1000N
MSH3LLALWECSLPROSTATE387p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCN1000N
MSH3LPQARLCLIPROSTATE395p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1N1700N
MSH3LPQARLCLIPROSTATE395p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145N1700N
MSH3LPQARLCLIPROSTATE395p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCN1700N
MSH3LWECSLPQAPROSTATE390p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1N100N
MSH3LWECSLPQAPROSTATE390p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145N100N
MSH3LWECSLPQAPROSTATE390p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCN100N
MSH3NVRDKKRATPROSTATE377p.K381fsc.1141_1141delAFrame_Shift_Del32.6522RV1N200N
MSH3NVRDKKRATPROSTATE377p.K381fsc.1141_1141delAFrame_Shift_Del32.65DU145N200N
MSH3NVRDKKRATPROSTATE377p.K381fsc.1141_1141delAFrame_Shift_Del32.65LNCAPCLONEFGCN200N
MSH3PQARLCLIVPROSTATE396p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1N200N
MSH3PQARLCLIVPROSTATE396p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145N200N
MSH3PQARLCLIVPROSTATE396p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCN200N
MSH3QARLCLIVSPROSTATE397p.K381fsc.1141_1141delAFrame_Shift_Del62.6522RV1N100N
MSH3QARLCLIVSPROSTATE397p.K381fsc.1141_1141delAFrame_Shift_Del62.65DU145N100N
MSH3QARLCLIVSPROSTATE397p.K381fsc.1141_1141delAFrame_Shift_Del62.65LNCAPCLONEFGCN100N
MSH3RATFLLALWPROSTATE383p.K381fsc.1141_1141delAFrame_Shift_Del62.6522RV1N400N
MSH3RATFLLALWPROSTATE383p.K381fsc.1141_1141delAFrame_Shift_Del62.65DU145N400N
MSH3RATFLLALWPROSTATE383p.K381fsc.1141_1141delAFrame_Shift_Del62.65LNCAPCLONEFGCN400N
MSH3RDKKRATFLPROSTATE379p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1Y7130N
MSH3RDKKRATFLPROSTATE379p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145Y7130N
MSH3RDKKRATFLPROSTATE379p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCY7130N
MSH3RLCLIVSRTPROSTATE399p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1N400N
MSH3RLCLIVSRTPROSTATE399p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145N400N
MSH3RLCLIVSRTPROSTATE399p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCN400N
MSH3SLPQARLCLPROSTATE394p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1Y12100N
MSH3SLPQARLCLPROSTATE394p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145Y12100N
MSH3SLPQARLCLPROSTATE394p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCY12100N
MSH3SRTLLLVQSPROSTATE405p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1N200N
MSH3SRTLLLVQSPROSTATE405p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145N200N
MSH3SRTLLLVQSPROSTATE405p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCN200N
MSH3TFLLALWECPROSTATE385p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1N100N
MSH3TFLLALWECPROSTATE385p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145N100N
MSH3TFLLALWECPROSTATE385p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCN100N
MSH3VRDKKRATFPROSTATE378p.K381fsc.1141_1141delAFrame_Shift_Del42.6522RV1Y4912N
MSH3VRDKKRATFPROSTATE378p.K381fsc.1141_1141delAFrame_Shift_Del42.65DU145Y4912N
MSH3VRDKKRATFPROSTATE378p.K381fsc.1141_1141delAFrame_Shift_Del42.65LNCAPCLONEFGCY4912N
MSH3VSRTLLLVQPROSTATE404p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1N003N
MSH3VSRTLLLVQPROSTATE404p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145N003N
MSH3VSRTLLLVQPROSTATE404p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCN003N
MSH3WECSLPQARPROSTATE391p.K381fsc.1141_1141delAFrame_Shift_Del52.6522RV1N202N
MSH3WECSLPQARPROSTATE391p.K381fsc.1141_1141delAFrame_Shift_Del52.65DU145N202N
MSH3WECSLPQARPROSTATE391p.K381fsc.1141_1141delAFrame_Shift_Del52.65LNCAPCLONEFGCN202N
MSH3GAAAAAAPPPROSTATE50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.9422RV1N000N
MSH3GAAAAAAPPPROSTATE50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94MDAPCA2BN000N
MSH3GAAAAAAPPPROSTATE50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94PC3N000N
MSH3PGAAAAAAPPROSTATE49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.9422RV1N000N
MSH3PGAAAAAAPPROSTATE49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94MDAPCA2BN000N
MSH3PGAAAAAAPPROSTATE49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94PC3N000N
MSH3AAAAPPAPAPROSTATE53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.2322RV1N200N
MSH3AAAAPPAPAPROSTATE59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23LNCAPCLONEFGCN200N
MSH3AAAAPPAPAPROSTATE53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23MDAPCA2BN200N
MSH3AAAAPPAPAPROSTATE53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23PC3N200N
MSH3AAAAPPAPAPROSTATE59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23PC3N200N
MSH3AAAAPPAPAPROSTATE59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23VCAPN200N
MSH3AAAPPAPAFPROSTATE54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.2322RV1Y8100N
MSH3AAAPPAPAFPROSTATE60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23LNCAPCLONEFGCY8100N
MSH3AAAPPAPAFPROSTATE54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23MDAPCA2BY8100N
MSH3AAAPPAPAFPROSTATE54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23PC3Y8100N
MSH3AAAPPAPAFPROSTATE60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23PC3Y8100N
MSH3AAAPPAPAFPROSTATE60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23VCAPY8100N
MSH3AAPPAPAFPPROSTATE55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.2322RV1N000N
MSH3AAPPAPAFPPROSTATE61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23LNCAPCLONEFGCN000N
MSH3AAPPAPAFPPROSTATE55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23MDAPCA2BN000N
MSH3AAPPAPAFPPROSTATE55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23PC3N000N
MSH3AAPPAPAFPPROSTATE61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23PC3N000N
MSH3AAPPAPAFPPROSTATE61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23VCAPN000N
MSH3AATIKYLKEPROSTATE504p.I506Tc.1517T>CMissense_Mutation10.11MDAPCA2BN000N
MSH3ATIKYLKEFPROSTATE505p.I506Tc.1517T>CMissense_Mutation10.11MDAPCA2BN400N
MSH3CSLAATIKYPROSTATE501p.I506Tc.1517T>CMissense_Mutation10.11MDAPCA2BN600N
MSH3ICSLAATIKPROSTATE500p.I506Tc.1517T>CMissense_Mutation10.11MDAPCA2BN102N
MSH3LAATIKYLKPROSTATE503p.I506Tc.1517T>CMissense_Mutation10.11MDAPCA2BN300N
MSH3PVICSLAATPROSTATE498p.I506Tc.1517T>CMissense_Mutation10.11MDAPCA2BN000N
MSH3SLAATIKYLPROSTATE502p.I506Tc.1517T>CMissense_Mutation10.11MDAPCA2BY10110N
MSH3TIKYLKEFNPROSTATE506p.I506Tc.1517T>CMissense_Mutation10.11MDAPCA2BN000N
MSH3VICSLAATIPROSTATE499p.I506Tc.1517T>CMissense_Mutation10.11MDAPCA2BN603N
MSH6EDTPPLLRAPROSTATE1083p.T1085fsc.3253_3254insCFrame_Shift_Ins31.11VCAPN400Y
MSH6LLPEDTPPLPROSTATE1080p.T1085fsc.3253_3254insCFrame_Shift_Ins11.11VCAPN1603Y
MSH6LPEDTPPLLPROSTATE1081p.T1085fsc.3253_3254insCFrame_Shift_Ins11.11VCAPN1600Y
MSH6PEDTPPLLRPROSTATE1082p.T1085fsc.3253_3254insCFrame_Shift_Ins21.11VCAPN000Y
MSH6ANYIRGGDGPROSTATE1064p.S1067Ic.3200G>TMissense_Mutation10.11DU145N000N
MSH6CLANYIRGGPROSTATE1062p.S1067Ic.3200G>TMissense_Mutation10.11DU145N000N
MSH6IRGGDGPMCPROSTATE1067p.S1067Ic.3200G>TMissense_Mutation10.11DU145N205N
MSH6LANYIRGGDPROSTATE1063p.S1067Ic.3200G>TMissense_Mutation10.11DU145N003N
MSH6LCLANYIRGPROSTATE1061p.S1067Ic.3200G>TMissense_Mutation10.11DU145N000N
MSH6LLCLANYIRPROSTATE1060p.S1067Ic.3200G>TMissense_Mutation10.11DU145N604N
MSH6NYIRGGDGPPROSTATE1065p.S1067Ic.3200G>TMissense_Mutation10.11DU145N000Y
MSH6VLLCLANYIPROSTATE1059p.S1067Ic.3200G>TMissense_Mutation10.11DU145Y131123N
MSH6YIRGGDGPMPROSTATE1066p.S1067Ic.3200G>TMissense_Mutation10.11DU145N600N
MYLKDRGKYTYEAPROSTATE100p.C106Yc.317G>AMissense_Mutation10.1122RV1N100N
MYLKEDRGKYTYEPROSTATE99p.C106Yc.317G>AMissense_Mutation10.1122RV1N000N
MYLKEEDRGKYTYPROSTATE98p.C106Yc.317G>AMissense_Mutation10.1122RV1Y6130N
MYLKGKYTYEATNPROSTATE102p.C106Yc.317G>AMissense_Mutation10.1122RV1N100N
MYLKKYTYEATNGPROSTATE103p.C106Yc.317G>AMissense_Mutation10.1122RV1N000N
MYLKRGKYTYEATPROSTATE101p.C106Yc.317G>AMissense_Mutation10.1122RV1N200N
MYLKTYEATNGSGPROSTATE105p.C106Yc.317G>AMissense_Mutation10.1122RV1N000N
MYLKYEATNGSGAPROSTATE106p.C106Yc.317G>AMissense_Mutation10.1122RV1N900N
MYLKYTYEATNGSPROSTATE104p.C106Yc.317G>AMissense_Mutation10.1122RV1N3010N
MYST4GPPHQGRGAPROSTATE644p.T640fsc.1919_1919delCFrame_Shift_Del50.11NCIH660N800Y
MYST4GRLKYKVTLPROSTATE633p.T640fsc.1919_1919delCFrame_Shift_Del10.11NCIH660Y7110N
MYST4KVTLRWGPPPROSTATE638p.T640fsc.1919_1919delCFrame_Shift_Del40.11NCIH660N100N
MYST4KYKVTLRWGPROSTATE636p.T640fsc.1919_1919delCFrame_Shift_Del30.11NCIH660N100N
MYST4LKYKVTLRWPROSTATE635p.T640fsc.1919_1919delCFrame_Shift_Del30.11NCIH660N5021N
MYST4LRWGPPHQGPROSTATE641p.T640fsc.1919_1919delCFrame_Shift_Del50.11NCIH660N204N
MYST4RLKYKVTLRPROSTATE634p.T640fsc.1919_1919delCFrame_Shift_Del20.11NCIH660N800Y
MYST4RWGPPHQGRPROSTATE642p.T640fsc.1919_1919delCFrame_Shift_Del60.11NCIH660N100N
MYST4TLRWGPPHQPROSTATE640p.T640fsc.1919_1919delCFrame_Shift_Del50.11NCIH660Y0120N
MYST4VTLRWGPPHPROSTATE639p.T640fsc.1919_1919delCFrame_Shift_Del50.11NCIH660N002N
MYST4WGPPHQGRGPROSTATE643p.T640fsc.1919_1919delCFrame_Shift_Del50.11NCIH660N300N
MYST4YKVTLRWGPPROSTATE637p.T640fsc.1919_1919delCFrame_Shift_Del40.11NCIH660N300N
MYST4AEIPKTSNAPROSTATE1782p.E1786Kc.5356G>AMissense_Mutation10.11LNCAPCLONEFGCN500N
MYST4EIPKTSNANPROSTATE1783p.E1786Kc.5356G>AMissense_Mutation10.11LNCAPCLONEFGCN000N
MYST4IPKTSNANIPROSTATE1784p.E1786Kc.5356G>AMissense_Mutation10.11LNCAPCLONEFGCY15100N
MYST4KTSNANIGLPROSTATE1786p.E1786Kc.5356G>AMissense_Mutation10.11LNCAPCLONEFGCN1000N
MYST4LAEIPKTSNPROSTATE1781p.E1786Kc.5356G>AMissense_Mutation10.11LNCAPCLONEFGCN200N
MYST4MQLAEIPKTPROSTATE1779p.E1786Kc.5356G>AMissense_Mutation10.11LNCAPCLONEFGCN402Y
MYST4PKTSNANIGPROSTATE1785p.E1786Kc.5356G>AMissense_Mutation10.11LNCAPCLONEFGCN000N
MYST4PMQLAEIPKPROSTATE1778p.E1786Kc.5356G>AMissense_Mutation10.11LNCAPCLONEFGCN100N
MYST4QLAEIPKTSPROSTATE1780p.E1786Kc.5356G>AMissense_Mutation10.11LNCAPCLONEFGCN000N
NCOA3FSSSSQCPAPROSTATE518p.S521fsc.1563_1564delCTFrame_Shift_Del40.11LNCAPCLONEFGCN500N
NCOA3HSFSSSSQCPROSTATE516p.S521fsc.1563_1564delCTFrame_Shift_Del20.11LNCAPCLONEFGCN100N
NCOA3NHSFSSSSQPROSTATE515p.S521fsc.1563_1564delCTFrame_Shift_Del10.11LNCAPCLONEFGCN000N
NCOA3SFSSSSQCPPROSTATE517p.S521fsc.1563_1564delCTFrame_Shift_Del30.11LNCAPCLONEFGCN000N
NCOA3SSQCPASHQPROSTATE521p.S521fsc.1563_1564delCTFrame_Shift_Del40.11LNCAPCLONEFGCN000N
NCOA3SSSQCPASHPROSTATE520p.S521fsc.1563_1564delCTFrame_Shift_Del50.11LNCAPCLONEFGCN000N
NCOA3SSSSQCPASPROSTATE519p.S521fsc.1563_1564delCTFrame_Shift_Del50.11LNCAPCLONEFGCN000N
NF1AQTKLEVVLPROSTATE683p.A690Vc.2069C>TMissense_Mutation10.11LNCAPCLONEFGCN900N
NF1DISMENVHMPROSTATE2465p.P2472Hc.7415C>AMissense_Mutation10.11DU145N200N
NF1DVVYCHSVEPROSTATE430p.A431Vc.1292C>TMissense_Mutation10.11LNCAPCLONEFGCN000N
NF1DWWPKIDVVPROSTATE424p.A431Vc.1292C>TMissense_Mutation10.11LNCAPCLONEFGCN400N
NF1ENVHMDTYPPROSTATE2469p.P2472Hc.7415C>AMissense_Mutation10.11DU145N000N
NF1EVVLYMFLWPROSTATE688p.A690Vc.2069C>TMissense_Mutation10.11LNCAPCLONEFGCY0100N
NF1HMDTYPIHHPROSTATE2472p.P2472Hc.7415C>AMissense_Mutation10.11DU145N300N
NF1IDVVYCHSVPROSTATE429p.A431Vc.1292C>TMissense_Mutation10.11LNCAPCLONEFGCN800N
NF1ISMENVHMDPROSTATE2466p.P2472Hc.7415C>AMissense_Mutation10.11DU145N200N
NF1KIDVVYCHSPROSTATE428p.A431Vc.1292C>TMissense_Mutation10.11LNCAPCLONEFGCN000N
NF1KLEVVLYMFPROSTATE686p.A690Vc.2069C>TMissense_Mutation10.11LNCAPCLONEFGCY12100N
NF1LDWWPKIDVPROSTATE423p.A431Vc.1292C>TMissense_Mutation10.11LNCAPCLONEFGCN800N
NF1LEVVLYMFLPROSTATE687p.A690Vc.2069C>TMissense_Mutation10.11LNCAPCLONEFGCY1794N
NF1MENVHMDTYPROSTATE2468p.P2472Hc.7415C>AMissense_Mutation10.11DU145Y790N
NF1NVHMDTYPIPROSTATE2470p.P2472Hc.7415C>AMissense_Mutation10.11DU145N400N
NF1PKIDVVYCHPROSTATE427p.A431Vc.1292C>TMissense_Mutation10.11LNCAPCLONEFGCN000N
NF1QAQTKLEVVPROSTATE682p.A690Vc.2069C>TMissense_Mutation10.11LNCAPCLONEFGCN700N
NF1QTKLEVVLYPROSTATE684p.A690Vc.2069C>TMissense_Mutation10.11LNCAPCLONEFGCY5160N
NF1SMENVHMDTPROSTATE2467p.P2472Hc.7415C>AMissense_Mutation10.11DU145N100N
NF1TDISMENVHPROSTATE2464p.P2472Hc.7415C>AMissense_Mutation10.11DU145N000N
NF1TKLEVVLYMPROSTATE685p.A690Vc.2069C>TMissense_Mutation10.11LNCAPCLONEFGCY6100N
NF1VHMDTYPIHPROSTATE2471p.P2472Hc.7415C>AMissense_Mutation10.11DU145N007N
NF1VLYMFLWNPPROSTATE690p.A690Vc.2069C>TMissense_Mutation10.11LNCAPCLONEFGCN406N
NF1VVLYMFLWNPROSTATE689p.A690Vc.2069C>TMissense_Mutation10.11LNCAPCLONEFGCN009N
NF1VVYCHSVELPROSTATE431p.A431Vc.1292C>TMissense_Mutation10.11LNCAPCLONEFGCY151223N
NF1WPKIDVVYCPROSTATE426p.A431Vc.1292C>TMissense_Mutation10.11LNCAPCLONEFGCY7101N
NF1WWPKIDVVYPROSTATE425p.A431Vc.1292C>TMissense_Mutation10.11LNCAPCLONEFGCN500N
NR1H2IRKQQQQQEPROSTATE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.1322RV1N101Y
NR1H2IRKQQQQQEPROSTATE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13DU145N101Y
NR1H2IRKQQQQQEPROSTATE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13LNCAPCLONEFGCN101Y
NR1H2IRKQQQQQEPROSTATE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13MDAPCA2BN101Y
NR1H2IRKQQQQQEPROSTATE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13NCIH660N101Y
NR1H2IRKQQQQQEPROSTATE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13PC3N101Y
NR1H2IRKQQQQQEPROSTATE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13PC3N101Y
NR1H2IRKQQQQQEPROSTATE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13VCAPN101Y
NR1H2KIRKQQQQQPROSTATE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.1322RV1N000Y
NR1H2KIRKQQQQQPROSTATE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13DU145N000Y
NR1H2KIRKQQQQQPROSTATE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13LNCAPCLONEFGCN000Y
NR1H2KIRKQQQQQPROSTATE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13MDAPCA2BN000Y
NR1H2KIRKQQQQQPROSTATE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13NCIH660N000Y
NR1H2KIRKQQQQQPROSTATE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13PC3N000Y
NR1H2KIRKQQQQQPROSTATE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13PC3N000Y
NR1H2KIRKQQQQQPROSTATE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13VCAPN000Y
NR1H2KQQQQQESQPROSTATE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.1322RV1N000Y
NR1H2KQQQQQESQPROSTATE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13DU145N000Y
NR1H2KQQQQQESQPROSTATE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13LNCAPCLONEFGCN000Y
NR1H2KQQQQQESQPROSTATE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13MDAPCA2BN000Y
NR1H2KQQQQQESQPROSTATE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13NCIH660N000Y
NR1H2KQQQQQESQPROSTATE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13PC3N000Y
NR1H2KQQQQQESQPROSTATE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13PC3N000Y
NR1H2KQQQQQESQPROSTATE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13VCAPN000Y
NR1H2QQQQQESQSPROSTATE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.1322RV1N000Y
NR1H2QQQQQESQSPROSTATE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13DU145N000Y
NR1H2QQQQQESQSPROSTATE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13LNCAPCLONEFGCN000Y
NR1H2QQQQQESQSPROSTATE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13MDAPCA2BN000Y
NR1H2QQQQQESQSPROSTATE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13NCIH660N000Y
NR1H2QQQQQESQSPROSTATE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13PC3N000Y
NR1H2QQQQQESQSPROSTATE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13PC3N000Y
NR1H2QQQQQESQSPROSTATE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13VCAPN000Y
NR1H2RKQQQQQESPROSTATE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.1322RV1N100Y
NR1H2RKQQQQQESPROSTATE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13DU145N100Y
NR1H2RKQQQQQESPROSTATE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13LNCAPCLONEFGCN100Y
NR1H2RKQQQQQESPROSTATE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13MDAPCA2BN100Y
NR1H2RKQQQQQESPROSTATE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13NCIH660N100Y
NR1H2RKQQQQQESPROSTATE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13PC3N100Y
NR1H2RKQQQQQESPROSTATE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13PC3N100Y
NR1H2RKQQQQQESPROSTATE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13VCAPN100Y
PDE4DIPDKAVLWSGLPROSTATE483p.V486fsc.1458_1458delTFrame_Shift_Del518.58NCIH660N400N
PDE4DIPDKAVLWSGLPROSTATE483p.V486fsc.1458_1458delTFrame_Shift_Del518.58PC3N400N
PDE4DIPHDKAVLWSGPROSTATE482p.V486fsc.1458_1458delTFrame_Shift_Del418.58NCIH660N000N
PDE4DIPHDKAVLWSGPROSTATE482p.V486fsc.1458_1458delTFrame_Shift_Del418.58PC3N000N
PDE4DIPIHDKAVLWSPROSTATE481p.V486fsc.1458_1458delTFrame_Shift_Del318.58NCIH660N2020N
PDE4DIPIHDKAVLWSPROSTATE481p.V486fsc.1458_1458delTFrame_Shift_Del318.58PC3N2020N
PDE4DIPQRIHDKAVLPROSTATE479p.V486fsc.1458_1458delTFrame_Shift_Del118.58NCIH660N600N
PDE4DIPQRIHDKAVLPROSTATE479p.V486fsc.1458_1458delTFrame_Shift_Del118.58PC3N600N
PDE4DIPRIHDKAVLWPROSTATE480p.V486fsc.1458_1458delTFrame_Shift_Del218.58NCIH660N400N
PDE4DIPRIHDKAVLWPROSTATE480p.V486fsc.1458_1458delTFrame_Shift_Del218.58PC3N400N
PDE4DIPAAVRHQWSPPROSTATE1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCN000N
PDE4DIPAAVRHQWSPPROSTATE1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BN000N
PDE4DIPAAVRHQWSPPROSTATE1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660N000N
PDE4DIPAAVRHQWSPPROSTATE1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3N000N
PDE4DIPACQLPRIPPPROSTATE1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCN000N
PDE4DIPACQLPRIPPPROSTATE1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BN000N
PDE4DIPACQLPRIPPPROSTATE1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660N000N
PDE4DIPACQLPRIPPPROSTATE1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3N000N
PDE4DIPAFIFTPYPSPROSTATE1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPAFIFTPYPSPROSTATE1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPAFIFTPYPSPROSTATE1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPAFIFTPYPSPROSTATE1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPAFLRHHCPQPROSTATE1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPAFLRHHCPQPROSTATE1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPAFLRHHCPQPROSTATE1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPAFLRHHCPQPROSTATE1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPALFLLLPQLPROSTATE1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCY16110N
PDE4DIPALFLLLPQLPROSTATE1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BY16110N
PDE4DIPALFLLLPQLPROSTATE1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660Y16110N
PDE4DIPALFLLLPQLPROSTATE1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3Y16110N
PDE4DIPALSSLAAVRPROSTATE1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCY6100N
PDE4DIPALSSLAAVRPROSTATE1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BY6100N
PDE4DIPALSSLAAVRPROSTATE1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660Y6100N
PDE4DIPALSSLAAVRPROSTATE1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3Y6100N
PDE4DIPAPLALSSLAPROSTATE1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN1000N
PDE4DIPAPLALSSLAPROSTATE1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN1000N
PDE4DIPAPLALSSLAPROSTATE1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N1000N
PDE4DIPAPLALSSLAPROSTATE1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N1000N
PDE4DIPASCLSAPLAPROSTATE1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCN100N
PDE4DIPASCLSAPLAPROSTATE1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BN100N
PDE4DIPASCLSAPLAPROSTATE1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660N100N
PDE4DIPASCLSAPLAPROSTATE1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3N100N
PDE4DIPASRGLRPNPPROSTATE1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000Y
PDE4DIPASRGLRPNPPROSTATE1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000Y
PDE4DIPASRGLRPNPPROSTATE1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000Y
PDE4DIPASRGLRPNPPROSTATE1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000Y
PDE4DIPATPSACQLPPROSTATE1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPATPSACQLPPROSTATE1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPATPSACQLPPROSTATE1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPATPSACQLPPROSTATE1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPAVRHQWSPWPROSTATE1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCN100N
PDE4DIPAVRHQWSPWPROSTATE1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BN100N
PDE4DIPAVRHQWSPWPROSTATE1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660N100N
PDE4DIPAVRHQWSPWPROSTATE1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3N100N
PDE4DIPCCRSSWEKVPROSTATE1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN100N
PDE4DIPCCRSSWEKVPROSTATE1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN100N
PDE4DIPCCRSSWEKVPROSTATE1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N100N
PDE4DIPCCRSSWEKVPROSTATE1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N100N
PDE4DIPCLSAPLALSPROSTATE1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPCLSAPLALSPROSTATE1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPCLSAPLALSPROSTATE1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPCLSAPLALSPROSTATE1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPCPQLHPASCPROSTATE1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN400N
PDE4DIPCPQLHPASCPROSTATE1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN400N
PDE4DIPCPQLHPASCPROSTATE1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N400N
PDE4DIPCPQLHPASCPROSTATE1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N400N
PDE4DIPCQLPRIPPRPROSTATE1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN600Y
PDE4DIPCQLPRIPPRPROSTATE1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN600Y
PDE4DIPCQLPRIPPRPROSTATE1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N600Y
PDE4DIPCQLPRIPPRPROSTATE1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N600Y
PDE4DIPCRSSWEKVPPROSTATE1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPCRSSWEKVPPROSTATE1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPCRSSWEKVPPROSTATE1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPCRSSWEKVPPROSTATE1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPEKVPALFLLPROSTATE1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCN800N
PDE4DIPEKVPALFLLPROSTATE1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BN800N
PDE4DIPEKVPALFLLPROSTATE1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660N800N
PDE4DIPEKVPALFLLPROSTATE1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3N800N
PDE4DIPFIFTPYPSWPROSTATE1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCN500N
PDE4DIPFIFTPYPSWPROSTATE1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BN500N
PDE4DIPFIFTPYPSWPROSTATE1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660N500N
PDE4DIPFIFTPYPSWPROSTATE1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3N500N
PDE4DIPFLLLPQLHCPROSTATE1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN7023N
PDE4DIPFLLLPQLHCPROSTATE1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN7023N
PDE4DIPFLLLPQLHCPROSTATE1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N7023N
PDE4DIPFLLLPQLHCPROSTATE1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N7023N
PDE4DIPFLRHHCPQLPROSTATE1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCY1399N
PDE4DIPFLRHHCPQLPROSTATE1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BY1399N
PDE4DIPFLRHHCPQLPROSTATE1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660Y1399N
PDE4DIPFLRHHCPQLPROSTATE1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3Y1399N
PDE4DIPFTPYPSWLAPROSTATE1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCN602N
PDE4DIPFTPYPSWLAPROSTATE1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BN602N
PDE4DIPFTPYPSWLAPROSTATE1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660N602N
PDE4DIPFTPYPSWLAPROSTATE1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3N602N
PDE4DIPGLRPNPTATPROSTATE1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN200N
PDE4DIPGLRPNPTATPROSTATE1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN200N
PDE4DIPGLRPNPTATPROSTATE1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N200N
PDE4DIPGLRPNPTATPROSTATE1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N200N
PDE4DIPHCPQLHPASPROSTATE1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN100N
PDE4DIPHCPQLHPASPROSTATE1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN100N
PDE4DIPHCPQLHPASPROSTATE1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N100N
PDE4DIPHCPQLHPASPROSTATE1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N100N
PDE4DIPHHCPQLHPAPROSTATE1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCN200N
PDE4DIPHHCPQLHPAPROSTATE1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BN200N
PDE4DIPHHCPQLHPAPROSTATE1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660N200N
PDE4DIPHHCPQLHPAPROSTATE1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3N200N
PDE4DIPHPASCLSAPPROSTATE1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN100N
PDE4DIPHPASCLSAPPROSTATE1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN100N
PDE4DIPHPASCLSAPPROSTATE1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N100N
PDE4DIPHPASCLSAPPROSTATE1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N100N
PDE4DIPHQWSPWLRLPROSTATE1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCY14120Y
PDE4DIPHQWSPWLRLPROSTATE1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BY14120Y
PDE4DIPHQWSPWLRLPROSTATE1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660Y14120Y
PDE4DIPHQWSPWLRLPROSTATE1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3Y14120Y
PDE4DIPIFTPYPSWLPROSTATE1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCN900N
PDE4DIPIFTPYPSWLPROSTATE1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BN900N
PDE4DIPIFTPYPSWLPROSTATE1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660N900N
PDE4DIPIFTPYPSWLPROSTATE1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3N900N
PDE4DIPIPPRRPTRPPROSTATE1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN100N
PDE4DIPIPPRRPTRPPROSTATE1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN100N
PDE4DIPIPPRRPTRPPROSTATE1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N100N
PDE4DIPIPPRRPTRPPROSTATE1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N100N
PDE4DIPIQAFIFTPYPROSTATE1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCN900N
PDE4DIPIQAFIFTPYPROSTATE1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BN900N
PDE4DIPIQAFIFTPYPROSTATE1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660N900N
PDE4DIPIQAFIFTPYPROSTATE1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3N900N
PDE4DIPKPSSTSASRPROSTATE1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35LNCAPCLONEFGCY490N
PDE4DIPKPSSTSASRPROSTATE1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35MDAPCA2BY490N
PDE4DIPKPSSTSASRPROSTATE1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35NCIH660Y490N
PDE4DIPKPSSTSASRPROSTATE1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35PC3Y490N
PDE4DIPKVPALFLLLPROSTATE1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCY1890N
PDE4DIPKVPALFLLLPROSTATE1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BY1890N
PDE4DIPKVPALFLLLPROSTATE1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660Y1890N
PDE4DIPKVPALFLLLPROSTATE1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3Y1890N
PDE4DIPLAAVRHQWSPROSTATE1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN100N
PDE4DIPLAAVRHQWSPROSTATE1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN100N
PDE4DIPLAAVRHQWSPROSTATE1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N100N
PDE4DIPLAAVRHQWSPROSTATE1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N100N
PDE4DIPLAFLRHHCPPROSTATE1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCN000N
PDE4DIPLAFLRHHCPPROSTATE1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BN000N
PDE4DIPLAFLRHHCPPROSTATE1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660N000N
PDE4DIPLAFLRHHCPPROSTATE1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3N000N
PDE4DIPLALSSLAAVPROSTATE1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCN1000N
PDE4DIPLALSSLAAVPROSTATE1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BN1000N
PDE4DIPLALSSLAAVPROSTATE1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660N1000N
PDE4DIPLALSSLAAVPROSTATE1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3N1000N
PDE4DIPLFLLLPQLHPROSTATE1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN0032N
PDE4DIPLFLLLPQLHPROSTATE1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN0032N
PDE4DIPLFLLLPQLHPROSTATE1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N0032N
PDE4DIPLFLLLPQLHPROSTATE1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N0032N
PDE4DIPLHPASCLSAPROSTATE1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCN307N
PDE4DIPLHPASCLSAPROSTATE1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BN307N
PDE4DIPLHPASCLSAPROSTATE1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660N307N
PDE4DIPLHPASCLSAPROSTATE1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3N307N
PDE4DIPLPRIPPRRPPROSTATE1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN100N
PDE4DIPLPRIPPRRPPROSTATE1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN100N
PDE4DIPLPRIPPRRPPROSTATE1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N100N
PDE4DIPLPRIPPRRPPROSTATE1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N100N
PDE4DIPLRHHCPQLHPROSTATE1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN2020N
PDE4DIPLRHHCPQLHPROSTATE1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN2020N
PDE4DIPLRHHCPQLHPROSTATE1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N2020N
PDE4DIPLRHHCPQLHPROSTATE1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N2020N
PDE4DIPLRLSRSYRCPROSTATE1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCN3033N
PDE4DIPLRLSRSYRCPROSTATE1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BN3033N
PDE4DIPLRLSRSYRCPROSTATE1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660N3033N
PDE4DIPLRLSRSYRCPROSTATE1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3N3033N
PDE4DIPLRPNPTATPPROSTATE1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN1029N
PDE4DIPLRPNPTATPPROSTATE1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN1029N
PDE4DIPLRPNPTATPPROSTATE1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N1029N
PDE4DIPLRPNPTATPPROSTATE1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N1029N
PDE4DIPLSAPLALSSPROSTATE1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCN200N
PDE4DIPLSAPLALSSPROSTATE1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BN200N
PDE4DIPLSAPLALSSPROSTATE1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660N200N
PDE4DIPLSAPLALSSPROSTATE1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3N200N
PDE4DIPLSRSYRCCRPROSTATE1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN300N
PDE4DIPLSRSYRCCRPROSTATE1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN300N
PDE4DIPLSRSYRCCRPROSTATE1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N300N
PDE4DIPLSRSYRCCRPROSTATE1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N300N
PDE4DIPLSSLAAVRHPROSTATE1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPLSSLAAVRHPROSTATE1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPLSSLAAVRHPROSTATE1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPLSSLAAVRHPROSTATE1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPNPTATPSACPROSTATE1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCN400N
PDE4DIPNPTATPSACPROSTATE1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BN400N
PDE4DIPNPTATPSACPROSTATE1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660N400N
PDE4DIPNPTATPSACPROSTATE1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3N400N
PDE4DIPPALFLLLPQPROSTATE1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPPALFLLLPQPROSTATE1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPPALFLLLPQPROSTATE1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPPALFLLLPQPROSTATE1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPPASCLSAPLPROSTATE1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCN000N
PDE4DIPPASCLSAPLPROSTATE1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BN000N
PDE4DIPPASCLSAPLPROSTATE1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660N000N
PDE4DIPPASCLSAPLPROSTATE1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3N000N
PDE4DIPPIQAFIFTPPROSTATE1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCN000N
PDE4DIPPIQAFIFTPPROSTATE1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BN000N
PDE4DIPPIQAFIFTPPROSTATE1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660N000N
PDE4DIPPIQAFIFTPPROSTATE1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3N000N
PDE4DIPPLALSSLAAPROSTATE1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCN100N
PDE4DIPPLALSSLAAPROSTATE1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BN100N
PDE4DIPPLALSSLAAPROSTATE1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660N100N
PDE4DIPPLALSSLAAPROSTATE1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3N100N
PDE4DIPPNPTATPSAPROSTATE1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPPNPTATPSAPROSTATE1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPPNPTATPSAPROSTATE1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPPNPTATPSAPROSTATE1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPPPRRPTRPIPROSTATE1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN900N
PDE4DIPPPRRPTRPIPROSTATE1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN900N
PDE4DIPPPRRPTRPIPROSTATE1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N900N
PDE4DIPPPRRPTRPIPROSTATE1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N900N
PDE4DIPPQLHPASCLPROSTATE1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN200N
PDE4DIPPQLHPASCLPROSTATE1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN200N
PDE4DIPPQLHPASCLPROSTATE1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N200N
PDE4DIPPQLHPASCLPROSTATE1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N200N
PDE4DIPPRIPPRRPTPROSTATE1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPPRIPPRRPTPROSTATE1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPPRIPPRRPTPROSTATE1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPPRIPPRRPTPROSTATE1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPPRRPTRPIQPROSTATE1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPPRRPTRPIQPROSTATE1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPPRRPTRPIQPROSTATE1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPPRRPTRPIQPROSTATE1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPPSACQLPRIPROSTATE1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPPSACQLPRIPROSTATE1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPPSACQLPRIPROSTATE1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPPSACQLPRIPROSTATE1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPPSSTSASRGPROSTATE1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35LNCAPCLONEFGCN000Y
PDE4DIPPSSTSASRGPROSTATE1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35MDAPCA2BN000Y
PDE4DIPPSSTSASRGPROSTATE1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35NCIH660N000Y
PDE4DIPPSSTSASRGPROSTATE1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35PC3N000Y
PDE4DIPPSWLAFLRHPROSTATE1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPPSWLAFLRHPROSTATE1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPPSWLAFLRHPROSTATE1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPPSWLAFLRHPROSTATE1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPPTATPSACQPROSTATE1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPPTATPSACQPROSTATE1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPPTATPSACQPROSTATE1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPPTATPSACQPROSTATE1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPPTRPIQAFIPROSTATE1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPPTRPIQAFIPROSTATE1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPPTRPIQAFIPROSTATE1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPPTRPIQAFIPROSTATE1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPPWLRLSRSYPROSTATE1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCN000N
PDE4DIPPWLRLSRSYPROSTATE1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BN000N
PDE4DIPPWLRLSRSYPROSTATE1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660N000N
PDE4DIPPWLRLSRSYPROSTATE1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3N000N
PDE4DIPPYPSWLAFLPROSTATE1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCY4100N
PDE4DIPPYPSWLAFLPROSTATE1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BY4100N
PDE4DIPPYPSWLAFLPROSTATE1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660Y4100N
PDE4DIPPYPSWLAFLPROSTATE1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3Y4100N
PDE4DIPQAFIFTPYPPROSTATE1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCN000N
PDE4DIPQAFIFTPYPPROSTATE1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BN000N
PDE4DIPQAFIFTPYPPROSTATE1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660N000N
PDE4DIPQAFIFTPYPPROSTATE1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3N000N
PDE4DIPQLHPASCLSPROSTATE1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPQLHPASCLSPROSTATE1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPQLHPASCLSPROSTATE1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPQLHPASCLSPROSTATE1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPQLPRIPPRRPROSTATE1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN500Y
PDE4DIPQLPRIPPRRPROSTATE1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN500Y
PDE4DIPQLPRIPPRRPROSTATE1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N500Y
PDE4DIPQLPRIPPRRPROSTATE1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N500Y
PDE4DIPQWSPWLRLSPROSTATE1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPQWSPWLRLSPROSTATE1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPQWSPWLRLSPROSTATE1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPQWSPWLRLSPROSTATE1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPRCCRSSWEKPROSTATE1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCY4100N
PDE4DIPRCCRSSWEKPROSTATE1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BY4100N
PDE4DIPRCCRSSWEKPROSTATE1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660Y4100N
PDE4DIPRCCRSSWEKPROSTATE1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3Y4100N
PDE4DIPRGLRPNPTAPROSTATE1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCN400N
PDE4DIPRGLRPNPTAPROSTATE1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BN400N
PDE4DIPRGLRPNPTAPROSTATE1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660N400N
PDE4DIPRGLRPNPTAPROSTATE1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3N400N
PDE4DIPRHHCPQLHPPROSTATE1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCN000N
PDE4DIPRHHCPQLHPPROSTATE1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BN000N
PDE4DIPRHHCPQLHPPROSTATE1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660N000N
PDE4DIPRHHCPQLHPPROSTATE1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3N000N
PDE4DIPRHQWSPWLRPROSTATE1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN100Y
PDE4DIPRHQWSPWLRPROSTATE1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN100Y
PDE4DIPRHQWSPWLRPROSTATE1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N100Y
PDE4DIPRHQWSPWLRPROSTATE1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N100Y
PDE4DIPRIPPRRPTRPROSTATE1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCY790N
PDE4DIPRIPPRRPTRPROSTATE1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BY790N
PDE4DIPRIPPRRPTRPROSTATE1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660Y790N
PDE4DIPRIPPRRPTRPROSTATE1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3Y790N
PDE4DIPRLSRSYRCCPROSTATE1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCY290N
PDE4DIPRLSRSYRCCPROSTATE1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BY290N
PDE4DIPRLSRSYRCCPROSTATE1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660Y290N
PDE4DIPRLSRSYRCCPROSTATE1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3Y290N
PDE4DIPRPIQAFIFTPROSTATE1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCN500N
PDE4DIPRPIQAFIFTPROSTATE1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BN500N
PDE4DIPRPIQAFIFTPROSTATE1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660N500N
PDE4DIPRPIQAFIFTPROSTATE1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3N500N
PDE4DIPRPNPTATPSPROSTATE1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN300N
PDE4DIPRPNPTATPSPROSTATE1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN300N
PDE4DIPRPNPTATPSPROSTATE1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N300N
PDE4DIPRPNPTATPSPROSTATE1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N300N
PDE4DIPRPTRPIQAFPROSTATE1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCY12100N
PDE4DIPRPTRPIQAFPROSTATE1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BY12100N
PDE4DIPRPTRPIQAFPROSTATE1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660Y12100N
PDE4DIPRPTRPIQAFPROSTATE1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3Y12100N
PDE4DIPRRPTRPIQAPROSTATE1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN500N
PDE4DIPRRPTRPIQAPROSTATE1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN500N
PDE4DIPRRPTRPIQAPROSTATE1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N500N
PDE4DIPRRPTRPIQAPROSTATE1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N500N
PDE4DIPRSSWEKVPAPROSTATE1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN200N
PDE4DIPRSSWEKVPAPROSTATE1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN200N
PDE4DIPRSSWEKVPAPROSTATE1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N200N
PDE4DIPRSSWEKVPAPROSTATE1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N200N
PDE4DIPRSYRCCRSSPROSTATE1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN100N
PDE4DIPRSYRCCRSSPROSTATE1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN100N
PDE4DIPRSYRCCRSSPROSTATE1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N100N
PDE4DIPRSYRCCRSSPROSTATE1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N100N
PDE4DIPSACQLPRIPPROSTATE1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPSACQLPRIPPROSTATE1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPSACQLPRIPPROSTATE1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPSACQLPRIPPROSTATE1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPSAPLALSSLPROSTATE1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCY15100N
PDE4DIPSAPLALSSLPROSTATE1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BY15100N
PDE4DIPSAPLALSSLPROSTATE1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660Y15100N
PDE4DIPSAPLALSSLPROSTATE1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3Y15100N
PDE4DIPSASRGLRPNPROSTATE1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN100Y
PDE4DIPSASRGLRPNPROSTATE1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN100Y
PDE4DIPSASRGLRPNPROSTATE1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N100Y
PDE4DIPSASRGLRPNPROSTATE1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N100Y
PDE4DIPSCLSAPLALPROSTATE1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN1000N
PDE4DIPSCLSAPLALPROSTATE1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN1000N
PDE4DIPSCLSAPLALPROSTATE1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N1000N
PDE4DIPSCLSAPLALPROSTATE1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N1000N
PDE4DIPSLAAVRHQWPROSTATE1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCN300N
PDE4DIPSLAAVRHQWPROSTATE1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BN300N
PDE4DIPSLAAVRHQWPROSTATE1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660N300N
PDE4DIPSLAAVRHQWPROSTATE1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3N300N
PDE4DIPSPWLRLSRSPROSTATE1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCN500Y
PDE4DIPSPWLRLSRSPROSTATE1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BN500Y
PDE4DIPSPWLRLSRSPROSTATE1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660N500Y
PDE4DIPSPWLRLSRSPROSTATE1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3N500Y
PDE4DIPSRGLRPNPTPROSTATE1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN300Y
PDE4DIPSRGLRPNPTPROSTATE1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN300Y
PDE4DIPSRGLRPNPTPROSTATE1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N300Y
PDE4DIPSRGLRPNPTPROSTATE1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N300Y
PDE4DIPSRSYRCCRSPROSTATE1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN300N
PDE4DIPSRSYRCCRSPROSTATE1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN300N
PDE4DIPSRSYRCCRSPROSTATE1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N300N
PDE4DIPSRSYRCCRSPROSTATE1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N300N
PDE4DIPSSLAAVRHQPROSTATE1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCN000Y
PDE4DIPSSLAAVRHQPROSTATE1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BN000Y
PDE4DIPSSLAAVRHQPROSTATE1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660N000Y
PDE4DIPSSLAAVRHQPROSTATE1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3N000Y
PDE4DIPSSTSASRGLPROSTATE1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35LNCAPCLONEFGCN700N
PDE4DIPSSTSASRGLPROSTATE1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35MDAPCA2BN700N
PDE4DIPSSTSASRGLPROSTATE1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35NCIH660N700N
PDE4DIPSSTSASRGLPROSTATE1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35PC3N700N
PDE4DIPSSWEKVPALPROSTATE1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCY1990N
PDE4DIPSSWEKVPALPROSTATE1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BY1990N
PDE4DIPSSWEKVPALPROSTATE1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660Y1990N
PDE4DIPSSWEKVPALPROSTATE1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3Y1990N
PDE4DIPSTSASRGLRPROSTATE1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35LNCAPCLONEFGCN400N
PDE4DIPSTSASRGLRPROSTATE1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35MDAPCA2BN400N
PDE4DIPSTSASRGLRPROSTATE1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35NCIH660N400N
PDE4DIPSTSASRGLRPROSTATE1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35PC3N400N
PDE4DIPSWEKVPALFPROSTATE1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN300N
PDE4DIPSWEKVPALFPROSTATE1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN300N
PDE4DIPSWEKVPALFPROSTATE1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N300N
PDE4DIPSWEKVPALFPROSTATE1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N300N
PDE4DIPSWLAFLRHHPROSTATE1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN000N
PDE4DIPSWLAFLRHHPROSTATE1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN000N
PDE4DIPSWLAFLRHHPROSTATE1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N000N
PDE4DIPSWLAFLRHHPROSTATE1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N000N
PDE4DIPSYRCCRSSWPROSTATE1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCY2100N
PDE4DIPSYRCCRSSWPROSTATE1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BY2100N
PDE4DIPSYRCCRSSWPROSTATE1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660Y2100N
PDE4DIPSYRCCRSSWPROSTATE1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3Y2100N
PDE4DIPTATPSACQLPROSTATE1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCN1100N
PDE4DIPTATPSACQLPROSTATE1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BN1100N
PDE4DIPTATPSACQLPROSTATE1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660N1100N
PDE4DIPTATPSACQLPROSTATE1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3N1100N
PDE4DIPTPSACQLPRPROSTATE1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN500N
PDE4DIPTPSACQLPRPROSTATE1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN500N
PDE4DIPTPSACQLPRPROSTATE1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N500N
PDE4DIPTPSACQLPRPROSTATE1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N500N
PDE4DIPTPYPSWLAFPROSTATE1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCY19100N
PDE4DIPTPYPSWLAFPROSTATE1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BY19100N
PDE4DIPTPYPSWLAFPROSTATE1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660Y19100N
PDE4DIPTPYPSWLAFPROSTATE1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3Y19100N
PDE4DIPTRPIQAFIFPROSTATE1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN400N
PDE4DIPTRPIQAFIFPROSTATE1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN400N
PDE4DIPTRPIQAFIFPROSTATE1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N400N
PDE4DIPTRPIQAFIFPROSTATE1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N400N
PDE4DIPTSASRGLRPPROSTATE1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCN000N
PDE4DIPTSASRGLRPPROSTATE1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BN000N
PDE4DIPTSASRGLRPPROSTATE1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660N000N
PDE4DIPTSASRGLRPPROSTATE1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3N000N
PDE4DIPVPALFLLLPPROSTATE1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN200N
PDE4DIPVPALFLLLPPROSTATE1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN200N
PDE4DIPVPALFLLLPPROSTATE1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N200N
PDE4DIPVPALFLLLPPROSTATE1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N200N
PDE4DIPVRHQWSPWLPROSTATE1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCN905Y
PDE4DIPVRHQWSPWLPROSTATE1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BN905Y
PDE4DIPVRHQWSPWLPROSTATE1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660N905Y
PDE4DIPVRHQWSPWLPROSTATE1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3N905Y
PDE4DIPWEKVPALFLPROSTATE1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCY12125N
PDE4DIPWEKVPALFLPROSTATE1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BY12125N
PDE4DIPWEKVPALFLPROSTATE1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660Y12125N
PDE4DIPWEKVPALFLPROSTATE1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3Y12125N
PDE4DIPWLAFLRHHCPROSTATE1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35LNCAPCLONEFGCY41017N
PDE4DIPWLAFLRHHCPROSTATE1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MDAPCA2BY41017N
PDE4DIPWLAFLRHHCPROSTATE1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35NCIH660Y41017N
PDE4DIPWLAFLRHHCPROSTATE1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PC3Y41017N
PDE4DIPWLRLSRSYRPROSTATE1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCY71012N
PDE4DIPWLRLSRSYRPROSTATE1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BY71012N
PDE4DIPWLRLSRSYRPROSTATE1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660Y71012N
PDE4DIPWLRLSRSYRPROSTATE1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3Y71012N
PDE4DIPWSPWLRLSRPROSTATE1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35LNCAPCLONEFGCN605Y
PDE4DIPWSPWLRLSRPROSTATE1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MDAPCA2BN605Y
PDE4DIPWSPWLRLSRPROSTATE1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35NCIH660N605Y
PDE4DIPWSPWLRLSRPROSTATE1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PC3N605Y
PDE4DIPYPSWLAFLRPROSTATE1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN702N
PDE4DIPYPSWLAFLRPROSTATE1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN702N
PDE4DIPYPSWLAFLRPROSTATE1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N702N
PDE4DIPYPSWLAFLRPROSTATE1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N702N
PDE4DIPYRCCRSSWEPROSTATE1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35LNCAPCLONEFGCN305N
PDE4DIPYRCCRSSWEPROSTATE1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MDAPCA2BN305N
PDE4DIPYRCCRSSWEPROSTATE1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35NCIH660N305N
PDE4DIPYRCCRSSWEPROSTATE1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PC3N305N
PDE4DIPDHDLERLHDPROSTATE517p.R524Hc.1571G>AMissense_Mutation10.11MDAPCA2BN000N
PDE4DIPDLERLHDVLPROSTATE519p.R524Hc.1571G>AMissense_Mutation10.11MDAPCA2BN600N
PDE4DIPDLLMSNDIDPROSTATE1515p.R1518Mc.4553G>TMissense_Mutation10.11DU145N000N
PDE4DIPEDLLMSNDIPROSTATE1514p.R1518Mc.4553G>TMissense_Mutation10.11DU145N300N
PDE4DIPERLHDVLSSPROSTATE521p.R524Hc.1571G>AMissense_Mutation10.11MDAPCA2BN200N
PDE4DIPFEDLLMSNDPROSTATE1513p.R1518Mc.4553G>TMissense_Mutation10.11DU145N200N
PDE4DIPHDLERLHDVPROSTATE518p.R524Hc.1571G>AMissense_Mutation10.11MDAPCA2BN500N
PDE4DIPHDVLSSNEAPROSTATE524p.R524Hc.1571G>AMissense_Mutation10.11MDAPCA2BN400N
PDE4DIPKSFEDLLMSPROSTATE1511p.R1518Mc.4553G>TMissense_Mutation10.11DU145N200N
PDE4DIPLERLHDVLSPROSTATE520p.R524Hc.1571G>AMissense_Mutation10.11MDAPCA2BN400N
PDE4DIPLHDVLSSNEPROSTATE523p.R524Hc.1571G>AMissense_Mutation10.11MDAPCA2BN001N
PDE4DIPLLMSNDIDYPROSTATE1516p.R1518Mc.4553G>TMissense_Mutation10.11DU145N800N
PDE4DIPLMSNDIDYYPROSTATE1517p.R1518Mc.4553G>TMissense_Mutation10.11DU145N700N
PDE4DIPMSNDIDYYLPROSTATE1518p.R1518Mc.4553G>TMissense_Mutation10.11DU145Y1590N
PDE4DIPRDHDLERLHPROSTATE516p.R524Hc.1571G>AMissense_Mutation10.11MDAPCA2BN100N
PDE4DIPRLHDVLSSNPROSTATE522p.R524Hc.1571G>AMissense_Mutation10.11MDAPCA2BY0110N
PDE4DIPSFEDLLMSNPROSTATE1512p.R1518Mc.4553G>TMissense_Mutation10.11DU145N000N
PDE4DIPVKSFEDLLMPROSTATE1510p.R1518Mc.4553G>TMissense_Mutation10.11DU145N403N
PDGFRAAVFNNDVVDPROSTATE236p.E241Dc.723G>TMissense_Mutation10.11DU145N200N
PDGFRACAVFNNDVVPROSTATE235p.E241Dc.723G>TMissense_Mutation10.11DU145N700N
PDGFRACFGESEVSRPROSTATE49p.W57Rc.169T>CMissense_Mutation10.1122RV1N200N
PDGFRADVVDLQWTYPROSTATE241p.E241Dc.723G>TMissense_Mutation10.11DU145N500N
PDGFRAESEVSRQYPPROSTATE52p.W57Rc.169T>CMissense_Mutation10.1122RV1N000N
PDGFRAEVSRQYPMSPROSTATE54p.W57Rc.169T>CMissense_Mutation10.1122RV1N200N
PDGFRAFGESEVSRQPROSTATE50p.W57Rc.169T>CMissense_Mutation10.1122RV1N201N
PDGFRAFNNDVVDLQPROSTATE238p.E241Dc.723G>TMissense_Mutation10.11DU145N2011N
PDGFRAGESEVSRQYPROSTATE51p.W57Rc.169T>CMissense_Mutation10.1122RV1N500N
PDGFRANDVVDLQWTPROSTATE240p.E241Dc.723G>TMissense_Mutation10.11DU145N300N
PDGFRANNDVVDLQWPROSTATE239p.E241Dc.723G>TMissense_Mutation10.11DU145N200N
PDGFRARQYPMSEEEPROSTATE57p.W57Rc.169T>CMissense_Mutation10.1122RV1N200N
PDGFRASEVSRQYPMPROSTATE53p.W57Rc.169T>CMissense_Mutation10.1122RV1Y790N
PDGFRASRQYPMSEEPROSTATE56p.W57Rc.169T>CMissense_Mutation10.1122RV1N100N
PDGFRATCAVFNNDVPROSTATE234p.E241Dc.723G>TMissense_Mutation10.11DU145N100N
PDGFRAVFNNDVVDLPROSTATE237p.E241Dc.723G>TMissense_Mutation10.11DU145N704N
PDGFRAVSRQYPMSEPROSTATE55p.W57Rc.169T>CMissense_Mutation10.1122RV1N001N
PDGFRAVTCAVFNNDPROSTATE233p.E241Dc.723G>TMissense_Mutation10.11DU145N000N
PIK3C2GCSWGSIGKHPROSTATE124p.P129delc.384_386delCCCIn_Frame_Del447.23MDAPCA2BN000N
PIK3C2GCSWGSIGKHPROSTATE124p.P129delc.384_386delCCCIn_Frame_Del447.23PC3N000N
PIK3C2GECSWGSIGKPROSTATE123p.P129delc.384_386delCCCIn_Frame_Del347.23MDAPCA2BN100N
PIK3C2GECSWGSIGKPROSTATE123p.P129delc.384_386delCCCIn_Frame_Del347.23PC3N100N
PIK3C2GGSIGKHHGAPROSTATE127p.P129delc.384_386delCCCIn_Frame_Del247.23MDAPCA2BN300N
PIK3C2GGSIGKHHGAPROSTATE127p.P129delc.384_386delCCCIn_Frame_Del247.23PC3N300N
PIK3C2GKECSWGSIGPROSTATE122p.P129delc.384_386delCCCIn_Frame_Del247.23MDAPCA2BN000N
PIK3C2GKECSWGSIGPROSTATE122p.P129delc.384_386delCCCIn_Frame_Del247.23PC3N000N
PIK3C2GNKECSWGSIPROSTATE121p.P129delc.384_386delCCCIn_Frame_Del147.23MDAPCA2BN100N
PIK3C2GNKECSWGSIPROSTATE121p.P129delc.384_386delCCCIn_Frame_Del147.23PC3N100N
PIK3C2GSIGKHHGADPROSTATE128p.P129delc.384_386delCCCIn_Frame_Del147.23MDAPCA2BN000N
PIK3C2GSIGKHHGADPROSTATE128p.P129delc.384_386delCCCIn_Frame_Del147.23PC3N000N
PIK3C2GSWGSIGKHHPROSTATE125p.P129delc.384_386delCCCIn_Frame_Del447.23MDAPCA2BN000N
PIK3C2GSWGSIGKHHPROSTATE125p.P129delc.384_386delCCCIn_Frame_Del447.23PC3N000N
PIK3C2GWGSIGKHHGPROSTATE126p.P129delc.384_386delCCCIn_Frame_Del347.23MDAPCA2BN107Y
PIK3C2GWGSIGKHHGPROSTATE126p.P129delc.384_386delCCCIn_Frame_Del347.23PC3N107Y
PIK3C2GDPTYNEIVGPROSTATE1389p.P1397Rc.4190C>GMissense_Mutation10.11MDAPCA2BN000N
PIK3C2GEIVGYDEVTPROSTATE1394p.P1397Rc.4190C>GMissense_Mutation10.11MDAPCA2BN100N
PIK3C2GGYDEVTELQPROSTATE1397p.P1397Rc.4190C>GMissense_Mutation10.11MDAPCA2BN000N
PIK3C2GIVGYDEVTEPROSTATE1395p.P1397Rc.4190C>GMissense_Mutation10.11MDAPCA2BN003N
PIK3C2GNEIVGYDEVPROSTATE1393p.P1397Rc.4190C>GMissense_Mutation10.11MDAPCA2BN800N
PIK3C2GPTYNEIVGYPROSTATE1390p.P1397Rc.4190C>GMissense_Mutation10.11MDAPCA2BN100N
PIK3C2GTYNEIVGYDPROSTATE1391p.P1397Rc.4190C>GMissense_Mutation10.11MDAPCA2BN000N
PIK3C2GVGYDEVTELPROSTATE1396p.P1397Rc.4190C>GMissense_Mutation10.11MDAPCA2BY191210N
PIK3C2GYNEIVGYDEPROSTATE1392p.P1397Rc.4190C>GMissense_Mutation10.11MDAPCA2BN200N
PIK3CADPLSEITERPROSTATE538p.Q546Rc.1637A>GMissense_Mutation10.2222RV1Y4100N
PIK3CAEITEREKDFPROSTATE542p.Q546Rc.1637A>GMissense_Mutation10.2222RV1N400N
PIK3CAEREKDFLWSPROSTATE545p.Q546Rc.1637A>GMissense_Mutation10.2222RV1N100N
PIK3CAITEREKDFLPROSTATE543p.Q546Rc.1637A>GMissense_Mutation10.2222RV1N600N
PIK3CALSEITEREKPROSTATE540p.Q546Rc.1637A>GMissense_Mutation10.2222RV1N200N
PIK3CAPLSEITEREPROSTATE539p.Q546Rc.1637A>GMissense_Mutation10.2222RV1N000N
PIK3CAREKDFLWSHPROSTATE546p.Q546Rc.1637A>GMissense_Mutation10.2222RV1Y0110N
PIK3CASEITEREKDPROSTATE541p.Q546Rc.1637A>GMissense_Mutation10.2222RV1N200N
PIK3CATEREKDFLWPROSTATE544p.Q546Rc.1637A>GMissense_Mutation10.2222RV1N600N
PRKDCAKTPVNKKKPROSTATE3597p.N3605fsc.10814_10815insAFrame_Shift_Ins10.11DU145N100N
PRKDCKTPVNKKKHPROSTATE3598p.N3605fsc.10814_10815insAFrame_Shift_Ins20.11DU145N100N
PRKDCAGHAMLAGPPROSTATE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N000N
PRKDCAGHAMLAGPPROSTATE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN000N
PRKDCAGHAMLAGPPROSTATE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN000N
PRKDCAGHAMLAGPPROSTATE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N000N
PRKDCAGHAMLAGPPROSTATE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N000N
PRKDCAGHAMLAGPPROSTATE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN000N
PRKDCAGPAPGRVGPROSTATE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N100N
PRKDCAGPAPGRVGPROSTATE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN100N
PRKDCAGPAPGRVGPROSTATE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN100N
PRKDCAGPAPGRVGPROSTATE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N100N
PRKDCAGPAPGRVGPROSTATE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N100N
PRKDCAGPAPGRVGPROSTATE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN100N
PRKDCAIQPAGHAMPROSTATE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1Y290N
PRKDCAIQPAGHAMPROSTATE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCY290N
PRKDCAIQPAGHAMPROSTATE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BY290N
PRKDCAIQPAGHAMPROSTATE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660Y290N
PRKDCAIQPAGHAMPROSTATE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3Y290N
PRKDCAIQPAGHAMPROSTATE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPY290N
PRKDCAMLAGPAPGPROSTATE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N000N
PRKDCAMLAGPAPGPROSTATE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN000N
PRKDCAMLAGPAPGPROSTATE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN000N
PRKDCAMLAGPAPGPROSTATE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N000N
PRKDCAMLAGPAPGPROSTATE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N000N
PRKDCAMLAGPAPGPROSTATE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN000N
PRKDCAPGRVGVLQPROSTATE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N000N
PRKDCAPGRVGVLQPROSTATE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN000N
PRKDCAPGRVGVLQPROSTATE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN000N
PRKDCAPGRVGVLQPROSTATE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N000N
PRKDCAPGRVGVLQPROSTATE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N000N
PRKDCAPGRVGVLQPROSTATE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN000N
PRKDCAQPTLLYPSPROSTATE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.4822RV1N000Y
PRKDCAQPTLLYPSPROSTATE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48LNCAPCLONEFGCN000Y
PRKDCAQPTLLYPSPROSTATE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48MDAPCA2BN000Y
PRKDCAQPTLLYPSPROSTATE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48NCIH660N000Y
PRKDCAQPTLLYPSPROSTATE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48PC3N000Y
PRKDCAQPTLLYPSPROSTATE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48VCAPN000Y
PRKDCCRSAPGPRYPROSTATE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N300N
PRKDCCRSAPGPRYPROSTATE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN300N
PRKDCCRSAPGPRYPROSTATE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN300N
PRKDCCRSAPGPRYPROSTATE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N300N
PRKDCCRSAPGPRYPROSTATE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N300N
PRKDCCRSAPGPRYPROSTATE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN300N
PRKDCENCRSAPGPPROSTATE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.4822RV1N000N
PRKDCENCRSAPGPPROSTATE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48LNCAPCLONEFGCN000N
PRKDCENCRSAPGPPROSTATE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48MDAPCA2BN000N
PRKDCENCRSAPGPPROSTATE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48NCIH660N000N
PRKDCENCRSAPGPPROSTATE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48PC3N000N
PRKDCENCRSAPGPPROSTATE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48VCAPN000N
PRKDCGAIQPAGHAPROSTATE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N400N
PRKDCGAIQPAGHAPROSTATE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN400N
PRKDCGAIQPAGHAPROSTATE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN400N
PRKDCGAIQPAGHAPROSTATE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N400N
PRKDCGAIQPAGHAPROSTATE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N400N
PRKDCGAIQPAGHAPROSTATE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN400N
PRKDCGHAMLAGPAPROSTATE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N100N
PRKDCGHAMLAGPAPROSTATE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN100N
PRKDCGHAMLAGPAPROSTATE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN100N
PRKDCGHAMLAGPAPROSTATE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N100N
PRKDCGHAMLAGPAPROSTATE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N100N
PRKDCGHAMLAGPAPROSTATE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN100N
PRKDCGPAPGRVGVPROSTATE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1Y13150N
PRKDCGPAPGRVGVPROSTATE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCY13150N
PRKDCGPAPGRVGVPROSTATE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BY13150N
PRKDCGPAPGRVGVPROSTATE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660Y13150N
PRKDCGPAPGRVGVPROSTATE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3Y13150N
PRKDCGPAPGRVGVPROSTATE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPY13150N
PRKDCGRVGVLQHVPROSTATE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1Y490N
PRKDCGRVGVLQHVPROSTATE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCY490N
PRKDCGRVGVLQHVPROSTATE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BY490N
PRKDCGRVGVLQHVPROSTATE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660Y490N
PRKDCGRVGVLQHVPROSTATE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3Y490N
PRKDCGRVGVLQHVPROSTATE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPY490N
PRKDCGVLQHVHWRPROSTATE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1Y690N
PRKDCGVLQHVHWRPROSTATE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCY690N
PRKDCGVLQHVHWRPROSTATE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BY690N
PRKDCGVLQHVHWRPROSTATE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660Y690N
PRKDCGVLQHVHWRPROSTATE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3Y690N
PRKDCGVLQHVHWRPROSTATE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPY690N
PRKDCHAMLAGPAPPROSTATE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N000N
PRKDCHAMLAGPAPPROSTATE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN000N
PRKDCHAMLAGPAPPROSTATE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN000N
PRKDCHAMLAGPAPPROSTATE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N000N
PRKDCHAMLAGPAPPROSTATE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N000N
PRKDCHAMLAGPAPPROSTATE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN000N
PRKDCHVHWRENCRPROSTATE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.4822RV1Y690N
PRKDCHVHWRENCRPROSTATE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48LNCAPCLONEFGCY690N
PRKDCHVHWRENCRPROSTATE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48MDAPCA2BY690N
PRKDCHVHWRENCRPROSTATE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48NCIH660Y690N
PRKDCHVHWRENCRPROSTATE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48PC3Y690N
PRKDCHVHWRENCRPROSTATE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48VCAPY690N
PRKDCHWRENCRSAPROSTATE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.4822RV1N100N
PRKDCHWRENCRSAPROSTATE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48LNCAPCLONEFGCN100N
PRKDCHWRENCRSAPROSTATE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48MDAPCA2BN100N
PRKDCHWRENCRSAPROSTATE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48NCIH660N100N
PRKDCHWRENCRSAPROSTATE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48PC3N100N
PRKDCHWRENCRSAPROSTATE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48VCAPN100N
PRKDCIQPAGHAMLPROSTATE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N1400N
PRKDCIQPAGHAMLPROSTATE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN1400N
PRKDCIQPAGHAMLPROSTATE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN1400N
PRKDCIQPAGHAMLPROSTATE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N1400N
PRKDCIQPAGHAMLPROSTATE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N1400N
PRKDCIQPAGHAMLPROSTATE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN1400N
PRKDCLAGPAPGRVPROSTATE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.4822RV1N500N
PRKDCLAGPAPGRVPROSTATE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48LNCAPCLONEFGCN500N
PRKDCLAGPAPGRVPROSTATE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48MDAPCA2BN500N
PRKDCLAGPAPGRVPROSTATE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48NCIH660N500N
PRKDCLAGPAPGRVPROSTATE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48PC3N500N
PRKDCLAGPAPGRVPROSTATE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48VCAPN500N
PRKDCLAQPTLLYPPROSTATE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.4822RV1N000N
PRKDCLAQPTLLYPPROSTATE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48LNCAPCLONEFGCN000N
PRKDCLAQPTLLYPPROSTATE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48MDAPCA2BN000N
PRKDCLAQPTLLYPPROSTATE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48NCIH660N000N
PRKDCLAQPTLLYPPROSTATE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48PC3N000N
PRKDCLAQPTLLYPPROSTATE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48VCAPN000N
PRKDCLLYPSGAIQPROSTATE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N100N
PRKDCLLYPSGAIQPROSTATE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN100N
PRKDCLLYPSGAIQPROSTATE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN100N
PRKDCLLYPSGAIQPROSTATE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N100N
PRKDCLLYPSGAIQPROSTATE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N100N
PRKDCLLYPSGAIQPROSTATE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN100N
PRKDCLQHVHWRENPROSTATE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N000N
PRKDCLQHVHWRENPROSTATE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN000N
PRKDCLQHVHWRENPROSTATE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN000N
PRKDCLQHVHWRENPROSTATE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N000N
PRKDCLQHVHWRENPROSTATE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N000N
PRKDCLQHVHWRENPROSTATE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN000N
PRKDCLYPSGAIQPPROSTATE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N000N
PRKDCLYPSGAIQPPROSTATE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN000N
PRKDCLYPSGAIQPPROSTATE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN000N
PRKDCLYPSGAIQPPROSTATE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N000N
PRKDCLYPSGAIQPPROSTATE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N000N
PRKDCLYPSGAIQPPROSTATE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN000N
PRKDCMLAGPAPGRPROSTATE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N500N
PRKDCMLAGPAPGRPROSTATE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN500N
PRKDCMLAGPAPGRPROSTATE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN500N
PRKDCMLAGPAPGRPROSTATE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N500N
PRKDCMLAGPAPGRPROSTATE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N500N
PRKDCMLAGPAPGRPROSTATE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN500N
PRKDCNCRSAPGPRPROSTATE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N300N
PRKDCNCRSAPGPRPROSTATE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN300N
PRKDCNCRSAPGPRPROSTATE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN300N
PRKDCNCRSAPGPRPROSTATE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N300N
PRKDCNCRSAPGPRPROSTATE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N300N
PRKDCNCRSAPGPRPROSTATE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN300N
PRKDCPAGHAMLAGPROSTATE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N000N
PRKDCPAGHAMLAGPROSTATE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN000N
PRKDCPAGHAMLAGPROSTATE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN000N
PRKDCPAGHAMLAGPROSTATE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N000N
PRKDCPAGHAMLAGPROSTATE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N000N
PRKDCPAGHAMLAGPROSTATE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN000N
PRKDCPAPGRVGVLPROSTATE1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N400N
PRKDCPAPGRVGVLPROSTATE1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN400N
PRKDCPAPGRVGVLPROSTATE1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN400N
PRKDCPAPGRVGVLPROSTATE1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N400N
PRKDCPAPGRVGVLPROSTATE1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N400N
PRKDCPAPGRVGVLPROSTATE1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN400N
PRKDCPGRVGVLQHPROSTATE1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N000N
PRKDCPGRVGVLQHPROSTATE1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN000N
PRKDCPGRVGVLQHPROSTATE1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN000N
PRKDCPGRVGVLQHPROSTATE1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N000N
PRKDCPGRVGVLQHPROSTATE1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N000N
PRKDCPGRVGVLQHPROSTATE1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN000N
PRKDCPSGAIQPAGPROSTATE1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N000N
PRKDCPSGAIQPAGPROSTATE1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN000N
PRKDCPSGAIQPAGPROSTATE1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN000N
PRKDCPSGAIQPAGPROSTATE1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N000N
PRKDCPSGAIQPAGPROSTATE1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N000N
PRKDCPSGAIQPAGPROSTATE1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN000N
PRKDCPTLLYPSGAPROSTATE1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.4822RV1N100N
PRKDCPTLLYPSGAPROSTATE1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48LNCAPCLONEFGCN100N
PRKDCPTLLYPSGAPROSTATE1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48MDAPCA2BN100N
PRKDCPTLLYPSGAPROSTATE1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48NCIH660N100N
PRKDCPTLLYPSGAPROSTATE1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48PC3N100N
PRKDCPTLLYPSGAPROSTATE1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48VCAPN100N
PRKDCQHVHWRENCPROSTATE1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N100N
PRKDCQHVHWRENCPROSTATE1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN100N
PRKDCQHVHWRENCPROSTATE1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN100N
PRKDCQHVHWRENCPROSTATE1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N100N
PRKDCQHVHWRENCPROSTATE1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N100N
PRKDCQHVHWRENCPROSTATE1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN100N
PRKDCQPAGHAMLAPROSTATE1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N800N
PRKDCQPAGHAMLAPROSTATE1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN800N
PRKDCQPAGHAMLAPROSTATE1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN800N
PRKDCQPAGHAMLAPROSTATE1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N800N
PRKDCQPAGHAMLAPROSTATE1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N800N
PRKDCQPAGHAMLAPROSTATE1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN800N
PRKDCQPTLLYPSGPROSTATE1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.4822RV1N000N
PRKDCQPTLLYPSGPROSTATE1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48LNCAPCLONEFGCN000N
PRKDCQPTLLYPSGPROSTATE1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48MDAPCA2BN000N
PRKDCQPTLLYPSGPROSTATE1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48NCIH660N000N
PRKDCQPTLLYPSGPROSTATE1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48PC3N000N
PRKDCQPTLLYPSGPROSTATE1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48VCAPN000N
PRKDCRENCRSAPGPROSTATE1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.4822RV1N100N
PRKDCRENCRSAPGPROSTATE1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48LNCAPCLONEFGCN100N
PRKDCRENCRSAPGPROSTATE1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48MDAPCA2BN100N
PRKDCRENCRSAPGPROSTATE1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48NCIH660N100N
PRKDCRENCRSAPGPROSTATE1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48PC3N100N
PRKDCRENCRSAPGPROSTATE1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48VCAPN100N
PRKDCRVGVLQHVHPROSTATE1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N100N
PRKDCRVGVLQHVHPROSTATE1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN100N
PRKDCRVGVLQHVHPROSTATE1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN100N
PRKDCRVGVLQHVHPROSTATE1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N100N
PRKDCRVGVLQHVHPROSTATE1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N100N
PRKDCRVGVLQHVHPROSTATE1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN100N
PRKDCSGAIQPAGHPROSTATE1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N000N
PRKDCSGAIQPAGHPROSTATE1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN000N
PRKDCSGAIQPAGHPROSTATE1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN000N
PRKDCSGAIQPAGHPROSTATE1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N000N
PRKDCSGAIQPAGHPROSTATE1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N000N
PRKDCSGAIQPAGHPROSTATE1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN000N
PRKDCTLLYPSGAIPROSTATE1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.4822RV1N1000N
PRKDCTLLYPSGAIPROSTATE1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48LNCAPCLONEFGCN1000N
PRKDCTLLYPSGAIPROSTATE1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48MDAPCA2BN1000N
PRKDCTLLYPSGAIPROSTATE1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48NCIH660N1000N
PRKDCTLLYPSGAIPROSTATE1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48PC3N1000N
PRKDCTLLYPSGAIPROSTATE1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48VCAPN1000N
PRKDCVGVLQHVHWPROSTATE1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N400N
PRKDCVGVLQHVHWPROSTATE1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN400N
PRKDCVGVLQHVHWPROSTATE1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN400N
PRKDCVGVLQHVHWPROSTATE1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N400N
PRKDCVGVLQHVHWPROSTATE1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N400N
PRKDCVGVLQHVHWPROSTATE1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN400N
PRKDCVHWRENCRSPROSTATE1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N106N
PRKDCVHWRENCRSPROSTATE1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN106N
PRKDCVHWRENCRSPROSTATE1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN106N
PRKDCVHWRENCRSPROSTATE1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N106N
PRKDCVHWRENCRSPROSTATE1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N106N
PRKDCVHWRENCRSPROSTATE1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN106N
PRKDCVLQHVHWREPROSTATE1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N001N
PRKDCVLQHVHWREPROSTATE1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN001N
PRKDCVLQHVHWREPROSTATE1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN001N
PRKDCVLQHVHWREPROSTATE1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N001N
PRKDCVLQHVHWREPROSTATE1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N001N
PRKDCVLQHVHWREPROSTATE1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN001N
PRKDCWRENCRSAPPROSTATE1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1N300N
PRKDCWRENCRSAPPROSTATE1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCN300N
PRKDCWRENCRSAPPROSTATE1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BN300N
PRKDCWRENCRSAPPROSTATE1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660N300N
PRKDCWRENCRSAPPROSTATE1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3N300N
PRKDCWRENCRSAPPROSTATE1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPN300N
PRKDCYPSGAIQPAPROSTATE1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.4822RV1Y990N
PRKDCYPSGAIQPAPROSTATE1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LNCAPCLONEFGCY990N
PRKDCYPSGAIQPAPROSTATE1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MDAPCA2BY990N
PRKDCYPSGAIQPAPROSTATE1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH660Y990N
PRKDCYPSGAIQPAPROSTATE1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48PC3Y990N
PRKDCYPSGAIQPAPROSTATE1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48VCAPY990N
PTENAANHCKAGKPROSTATE120p.I122Nc.365T>AMissense_Mutation10.11MDAPCA2BN100N
PTENANHCKAGKGPROSTATE121p.I122Nc.365T>AMissense_Mutation10.11MDAPCA2BN000N
PTENDDNHVAANHPROSTATE115p.I122Nc.365T>AMissense_Mutation10.11MDAPCA2BN000N
PTENDNHVAANHCPROSTATE116p.I122Nc.365T>AMissense_Mutation10.11MDAPCA2BN000N
PTENEDDNHVAANPROSTATE114p.I122Nc.365T>AMissense_Mutation10.11MDAPCA2BN100N
PTENHVAANHCKAPROSTATE118p.I122Nc.365T>AMissense_Mutation10.11MDAPCA2BN300N
PTENNHCKAGKGRPROSTATE122p.I122Nc.365T>AMissense_Mutation10.11MDAPCA2BN100N
PTENNHVAANHCKPROSTATE117p.I122Nc.365T>AMissense_Mutation10.11MDAPCA2BN000N
PTENVAANHCKAGPROSTATE119p.I122Nc.365T>AMissense_Mutation10.11MDAPCA2BN000N
PTENAGKGQTGVMPROSTATE126p.R130Qc.389G>AMissense_Mutation10.55MDAPCA2BN500N
PTENCKAGKGQTGPROSTATE124p.R130Qc.389G>AMissense_Mutation10.55MDAPCA2BN000N
PTENGKGQTGVMIPROSTATE127p.R130Qc.389G>AMissense_Mutation10.55MDAPCA2BN200N
PTENGQTGVMICAPROSTATE129p.R130Qc.389G>AMissense_Mutation10.55MDAPCA2BN200N
PTENHCKAGKGQTPROSTATE123p.R130Qc.389G>AMissense_Mutation10.55MDAPCA2BN200N
PTENKAGKGQTGVPROSTATE125p.R130Qc.389G>AMissense_Mutation10.55MDAPCA2BN600N
PTENKGQTGVMICPROSTATE128p.R130Qc.389G>AMissense_Mutation10.55MDAPCA2BN300N
PTENQTGVMICAYPROSTATE130p.R130Qc.389G>AMissense_Mutation10.55MDAPCA2BN700N
PTENIHCKAGKGQPROSTATE122p.R130Qc.389G>AMissense_Mutation10.66MDAPCA2BN004N
RECQL4ADMCTPTARPROSTATE829p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4ADMCTPTARPROSTATE829p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4ADMCTPTARPROSTATE829p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4ADMCTPTARPROSTATE829p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4ADMCTPTARPROSTATE829p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4AFMQGQLGWPROSTATE759p.R766fsc.2296_2296delCFrame_Shift_Del274.3422RV1N200N
RECQL4AFMQGQLGWPROSTATE759p.R766fsc.2296_2296delCFrame_Shift_Del274.34LNCAPCLONEFGCN200N
RECQL4AFMQGQLGWPROSTATE759p.R766fsc.2296_2296delCFrame_Shift_Del274.34MDAPCA2BN200N
RECQL4AFMQGQLGWPROSTATE759p.R766fsc.2296_2296delCFrame_Shift_Del274.34NCIH660N200N
RECQL4AFMQGQLGWPROSTATE759p.R766fsc.2296_2296delCFrame_Shift_Del274.34PC3N200N
RECQL4AGPGVTGSLPROSTATE803p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N1200N
RECQL4AGPGVTGSLPROSTATE803p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN1200N
RECQL4AGPGVTGSLPROSTATE803p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN1200N
RECQL4AGPGVTGSLPROSTATE803p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N1200N
RECQL4AGPGVTGSLPROSTATE803p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N1200N
RECQL4AKTCESCADPROSTATE822p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4AKTCESCADPROSTATE822p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4AKTCESCADPROSTATE822p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4AKTCESCADPROSTATE822p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4AKTCESCADPROSTATE822p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4ASRATCRPWPROSTATE794p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1Y3110N
RECQL4ASRATCRPWPROSTATE794p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCY3110N
RECQL4ASRATCRPWPROSTATE794p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BY3110N
RECQL4ASRATCRPWPROSTATE794p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660Y3110N
RECQL4ASRATCRPWPROSTATE794p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3Y3110N
RECQL4ATCRPWAGPPROSTATE797p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4ATCRPWAGPPROSTATE797p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4ATCRPWAGPPROSTATE797p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4ATCRPWAGPPROSTATE797p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4ATCRPWAGPPROSTATE797p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4ATSSCSPRAPROSTATE814p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N100Y
RECQL4ATSSCSPRAPROSTATE814p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN100Y
RECQL4ATSSCSPRAPROSTATE814p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN100Y
RECQL4ATSSCSPRAPROSTATE814p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N100Y
RECQL4ATSSCSPRAPROSTATE814p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N100Y
RECQL4CADMCTPTAPROSTATE828p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N300N
RECQL4CADMCTPTAPROSTATE828p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN300N
RECQL4CADMCTPTAPROSTATE828p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN300N
RECQL4CADMCTPTAPROSTATE828p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N300N
RECQL4CADMCTPTAPROSTATE828p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N300N
RECQL4CCIWGCPQAPROSTATE786p.R766fsc.2296_2296delCFrame_Shift_Del674.3422RV1N100N
RECQL4CCIWGCPQAPROSTATE786p.R766fsc.2296_2296delCFrame_Shift_Del674.34LNCAPCLONEFGCN100N
RECQL4CCIWGCPQAPROSTATE786p.R766fsc.2296_2296delCFrame_Shift_Del674.34MDAPCA2BN100N
RECQL4CCIWGCPQAPROSTATE786p.R766fsc.2296_2296delCFrame_Shift_Del674.34NCIH660N100N
RECQL4CCIWGCPQAPROSTATE786p.R766fsc.2296_2296delCFrame_Shift_Del674.34PC3N100N
RECQL4CESCADMCTPROSTATE825p.R766fsc.2296_2296delCFrame_Shift_Del674.3422RV1N500N
RECQL4CESCADMCTPROSTATE825p.R766fsc.2296_2296delCFrame_Shift_Del674.34LNCAPCLONEFGCN500N
RECQL4CESCADMCTPROSTATE825p.R766fsc.2296_2296delCFrame_Shift_Del674.34MDAPCA2BN500N
RECQL4CESCADMCTPROSTATE825p.R766fsc.2296_2296delCFrame_Shift_Del674.34NCIH660N500N
RECQL4CESCADMCTPROSTATE825p.R766fsc.2296_2296delCFrame_Shift_Del674.34PC3N500N
RECQL4CGLCCIWGCPROSTATE783p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N100N
RECQL4CGLCCIWGCPROSTATE783p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN100N
RECQL4CGLCCIWGCPROSTATE783p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN100N
RECQL4CGLCCIWGCPROSTATE783p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N100N
RECQL4CGLCCIWGCPROSTATE783p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N100N
RECQL4CIWGCPQASPROSTATE787p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4CIWGCPQASPROSTATE787p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4CIWGCPQASPROSTATE787p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4CIWGCPQASPROSTATE787p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4CIWGCPQASPROSTATE787p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4CPQASRATCPROSTATE791p.R766fsc.2296_2296delCFrame_Shift_Del674.3422RV1N400Y
RECQL4CPQASRATCPROSTATE791p.R766fsc.2296_2296delCFrame_Shift_Del674.34LNCAPCLONEFGCN400Y
RECQL4CPQASRATCPROSTATE791p.R766fsc.2296_2296delCFrame_Shift_Del674.34MDAPCA2BN400Y
RECQL4CPQASRATCPROSTATE791p.R766fsc.2296_2296delCFrame_Shift_Del674.34NCIH660N400Y
RECQL4CPQASRATCPROSTATE791p.R766fsc.2296_2296delCFrame_Shift_Del674.34PC3N400Y
RECQL4CRPWAGPGVPROSTATE799p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N400N
RECQL4CRPWAGPGVPROSTATE799p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN400N
RECQL4CRPWAGPGVPROSTATE799p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN400N
RECQL4CRPWAGPGVPROSTATE799p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N400N
RECQL4CRPWAGPGVPROSTATE799p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N400N
RECQL4CSPRAKTCEPROSTATE818p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4CSPRAKTCEPROSTATE818p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4CSPRAKTCEPROSTATE818p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4CSPRAKTCEPROSTATE818p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4CSPRAKTCEPROSTATE818p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4CTPTARTSWPROSTATE832p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N100N
RECQL4CTPTARTSWPROSTATE832p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN100N
RECQL4CTPTARTSWPROSTATE832p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN100N
RECQL4CTPTARTSWPROSTATE832p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N100N
RECQL4CTPTARTSWPROSTATE832p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N100N
RECQL4DMCTPTARTPROSTATE830p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N200N
RECQL4DMCTPTARTPROSTATE830p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN200N
RECQL4DMCTPTARTPROSTATE830p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN200N
RECQL4DMCTPTARTPROSTATE830p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N200N
RECQL4DMCTPTARTPROSTATE830p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N200N
RECQL4ESCADMCTPPROSTATE826p.R766fsc.2296_2296delCFrame_Shift_Del674.3422RV1N000N
RECQL4ESCADMCTPPROSTATE826p.R766fsc.2296_2296delCFrame_Shift_Del674.34LNCAPCLONEFGCN000N
RECQL4ESCADMCTPPROSTATE826p.R766fsc.2296_2296delCFrame_Shift_Del674.34MDAPCA2BN000N
RECQL4ESCADMCTPPROSTATE826p.R766fsc.2296_2296delCFrame_Shift_Del674.34NCIH660N000N
RECQL4ESCADMCTPPROSTATE826p.R766fsc.2296_2296delCFrame_Shift_Del674.34PC3N000N
RECQL4FMQGQLGWWPROSTATE760p.R766fsc.2296_2296delCFrame_Shift_Del374.3422RV1N500N
RECQL4FMQGQLGWWPROSTATE760p.R766fsc.2296_2296delCFrame_Shift_Del374.34LNCAPCLONEFGCN500N
RECQL4FMQGQLGWWPROSTATE760p.R766fsc.2296_2296delCFrame_Shift_Del374.34MDAPCA2BN500N
RECQL4FMQGQLGWWPROSTATE760p.R766fsc.2296_2296delCFrame_Shift_Del374.34NCIH660N500N
RECQL4FMQGQLGWWPROSTATE760p.R766fsc.2296_2296delCFrame_Shift_Del374.34PC3N500N
RECQL4GCPQASRATPROSTATE790p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N100N
RECQL4GCPQASRATPROSTATE790p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN100N
RECQL4GCPQASRATPROSTATE790p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN100N
RECQL4GCPQASRATPROSTATE790p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N100N
RECQL4GCPQASRATPROSTATE790p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N100N
RECQL4GLCCIWGCPPROSTATE784p.R766fsc.2296_2296delCFrame_Shift_Del674.3422RV1N100N
RECQL4GLCCIWGCPPROSTATE784p.R766fsc.2296_2296delCFrame_Shift_Del674.34LNCAPCLONEFGCN100N
RECQL4GLCCIWGCPPROSTATE784p.R766fsc.2296_2296delCFrame_Shift_Del674.34MDAPCA2BN100N
RECQL4GLCCIWGCPPROSTATE784p.R766fsc.2296_2296delCFrame_Shift_Del674.34NCIH660N100N
RECQL4GLCCIWGCPPROSTATE784p.R766fsc.2296_2296delCFrame_Shift_Del674.34PC3N100N
RECQL4GPGVTGSLPPROSTATE804p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4GPGVTGSLPPROSTATE804p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4GPGVTGSLPPROSTATE804p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4GPGVTGSLPPROSTATE804p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4GPGVTGSLPPROSTATE804p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4GQLGWWWPRPROSTATE763p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N700N
RECQL4GQLGWWWPRPROSTATE763p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN700N
RECQL4GQLGWWWPRPROSTATE763p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN700N
RECQL4GQLGWWWPRPROSTATE763p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N700N
RECQL4GQLGWWWPRPROSTATE763p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N700N
RECQL4GQMCGLCCIPROSTATE780p.R766fsc.2296_2296delCFrame_Shift_Del674.3422RV1N1000N
RECQL4GQMCGLCCIPROSTATE780p.R766fsc.2296_2296delCFrame_Shift_Del674.34LNCAPCLONEFGCN1000N
RECQL4GQMCGLCCIPROSTATE780p.R766fsc.2296_2296delCFrame_Shift_Del674.34MDAPCA2BN1000N
RECQL4GQMCGLCCIPROSTATE780p.R766fsc.2296_2296delCFrame_Shift_Del674.34NCIH660N1000N
RECQL4GQMCGLCCIPROSTATE780p.R766fsc.2296_2296delCFrame_Shift_Del674.34PC3N1000N
RECQL4GSLPTATSSPROSTATE809p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4GSLPTATSSPROSTATE809p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4GSLPTATSSPROSTATE809p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4GSLPTATSSPROSTATE809p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4GSLPTATSSPROSTATE809p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4GVTGSLPTAPROSTATE806p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N100N
RECQL4GVTGSLPTAPROSTATE806p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN100N
RECQL4GVTGSLPTAPROSTATE806p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN100N
RECQL4GVTGSLPTAPROSTATE806p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N100N
RECQL4GVTGSLPTAPROSTATE806p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N100N
RECQL4GWGWTGQMCPROSTATE775p.R766fsc.2296_2296delCFrame_Shift_Del674.3422RV1N000N
RECQL4GWGWTGQMCPROSTATE775p.R766fsc.2296_2296delCFrame_Shift_Del674.34LNCAPCLONEFGCN000N
RECQL4GWGWTGQMCPROSTATE775p.R766fsc.2296_2296delCFrame_Shift_Del674.34MDAPCA2BN000N
RECQL4GWGWTGQMCPROSTATE775p.R766fsc.2296_2296delCFrame_Shift_Del674.34NCIH660N000N
RECQL4GWGWTGQMCPROSTATE775p.R766fsc.2296_2296delCFrame_Shift_Del674.34PC3N000N
RECQL4GWTGQMCGLPROSTATE777p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N400N
RECQL4GWTGQMCGLPROSTATE777p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN400N
RECQL4GWTGQMCGLPROSTATE777p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN400N
RECQL4GWTGQMCGLPROSTATE777p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N400N
RECQL4GWTGQMCGLPROSTATE777p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N400N
RECQL4GWWWPRWPLPROSTATE766p.R766fsc.2296_2296delCFrame_Shift_Del674.3422RV1Y8120N
RECQL4GWWWPRWPLPROSTATE766p.R766fsc.2296_2296delCFrame_Shift_Del674.34LNCAPCLONEFGCY8120N
RECQL4GWWWPRWPLPROSTATE766p.R766fsc.2296_2296delCFrame_Shift_Del674.34MDAPCA2BY8120N
RECQL4GWWWPRWPLPROSTATE766p.R766fsc.2296_2296delCFrame_Shift_Del674.34NCIH660Y8120N
RECQL4GWWWPRWPLPROSTATE766p.R766fsc.2296_2296delCFrame_Shift_Del674.34PC3Y8120N
RECQL4IWGCPQASRPROSTATE788p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N100N
RECQL4IWGCPQASRPROSTATE788p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN100N
RECQL4IWGCPQASRPROSTATE788p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN100N
RECQL4IWGCPQASRPROSTATE788p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N100N
RECQL4IWGCPQASRPROSTATE788p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N100N
RECQL4KTCESCADMPROSTATE823p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1Y490N
RECQL4KTCESCADMPROSTATE823p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCY490N
RECQL4KTCESCADMPROSTATE823p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BY490N
RECQL4KTCESCADMPROSTATE823p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660Y490N
RECQL4KTCESCADMPROSTATE823p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3Y490N
RECQL4LCCIWGCPQPROSTATE785p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4LCCIWGCPQPROSTATE785p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4LCCIWGCPQPROSTATE785p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4LCCIWGCPQPROSTATE785p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4LCCIWGCPQPROSTATE785p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4LGWGWTGQMPROSTATE774p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N1001N
RECQL4LGWGWTGQMPROSTATE774p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN1001N
RECQL4LGWGWTGQMPROSTATE774p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN1001N
RECQL4LGWGWTGQMPROSTATE774p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N1001N
RECQL4LGWGWTGQMPROSTATE774p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N1001N
RECQL4LGWWWPRWPPROSTATE765p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N004N
RECQL4LGWWWPRWPPROSTATE765p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN004N
RECQL4LGWWWPRWPPROSTATE765p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN004N
RECQL4LGWWWPRWPPROSTATE765p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N004N
RECQL4LGWWWPRWPPROSTATE765p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N004N
RECQL4LPTATSSCSPROSTATE811p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N501N
RECQL4LPTATSSCSPROSTATE811p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN501N
RECQL4LPTATSSCSPROSTATE811p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN501N
RECQL4LPTATSSCSPROSTATE811p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N501N
RECQL4LPTATSSCSPROSTATE811p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N501N
RECQL4MCGLCCIWGPROSTATE782p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N001N
RECQL4MCGLCCIWGPROSTATE782p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN001N
RECQL4MCGLCCIWGPROSTATE782p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN001N
RECQL4MCGLCCIWGPROSTATE782p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N001N
RECQL4MCGLCCIWGPROSTATE782p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N001N
RECQL4MCTPTARTSPROSTATE831p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000Y
RECQL4MCTPTARTSPROSTATE831p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000Y
RECQL4MCTPTARTSPROSTATE831p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000Y
RECQL4MCTPTARTSPROSTATE831p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000Y
RECQL4MCTPTARTSPROSTATE831p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000Y
RECQL4MQGQLGWWWPROSTATE761p.R766fsc.2296_2296delCFrame_Shift_Del474.3422RV1N500N
RECQL4MQGQLGWWWPROSTATE761p.R766fsc.2296_2296delCFrame_Shift_Del474.34LNCAPCLONEFGCN500N
RECQL4MQGQLGWWWPROSTATE761p.R766fsc.2296_2296delCFrame_Shift_Del474.34MDAPCA2BN500N
RECQL4MQGQLGWWWPROSTATE761p.R766fsc.2296_2296delCFrame_Shift_Del474.34NCIH660N500N
RECQL4MQGQLGWWWPROSTATE761p.R766fsc.2296_2296delCFrame_Shift_Del474.34PC3N500N
RECQL4PGVTGSLPTPROSTATE805p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4PGVTGSLPTPROSTATE805p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4PGVTGSLPTPROSTATE805p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4PGVTGSLPTPROSTATE805p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4PGVTGSLPTPROSTATE805p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4PLGWGWTGQPROSTATE773p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4PLGWGWTGQPROSTATE773p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4PLGWGWTGQPROSTATE773p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4PLGWGWTGQPROSTATE773p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4PLGWGWTGQPROSTATE773p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4PQASRATCRPROSTATE792p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1Y090Y
RECQL4PQASRATCRPROSTATE792p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCY090Y
RECQL4PQASRATCRPROSTATE792p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BY090Y
RECQL4PQASRATCRPROSTATE792p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660Y090Y
RECQL4PQASRATCRPROSTATE792p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3Y090Y
RECQL4PRAKTCESCPROSTATE820p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N100N
RECQL4PRAKTCESCPROSTATE820p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN100N
RECQL4PRAKTCESCPROSTATE820p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN100N
RECQL4PRAKTCESCPROSTATE820p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N100N
RECQL4PRAKTCESCPROSTATE820p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N100N
RECQL4PRWPLGWGWPROSTATE770p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N300N
RECQL4PRWPLGWGWPROSTATE770p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN300N
RECQL4PRWPLGWGWPROSTATE770p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN300N
RECQL4PRWPLGWGWPROSTATE770p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N300N
RECQL4PRWPLGWGWPROSTATE770p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N300N
RECQL4PTATSSCSPPROSTATE812p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4PTATSSCSPPROSTATE812p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4PTATSSCSPPROSTATE812p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4PTATSSCSPPROSTATE812p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4PTATSSCSPPROSTATE812p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4PWAGPGVTGPROSTATE801p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4PWAGPGVTGPROSTATE801p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4PWAGPGVTGPROSTATE801p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4PWAGPGVTGPROSTATE801p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4PWAGPGVTGPROSTATE801p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4QASRATCRPPROSTATE793p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4QASRATCRPPROSTATE793p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4QASRATCRPPROSTATE793p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4QASRATCRPPROSTATE793p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4QASRATCRPPROSTATE793p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4QGQLGWWWPPROSTATE762p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4QGQLGWWWPPROSTATE762p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4QGQLGWWWPPROSTATE762p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4QGQLGWWWPPROSTATE762p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4QGQLGWWWPPROSTATE762p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4QLGWWWPRWPROSTATE764p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N500N
RECQL4QLGWWWPRWPROSTATE764p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN500N
RECQL4QLGWWWPRWPROSTATE764p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN500N
RECQL4QLGWWWPRWPROSTATE764p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N500N
RECQL4QLGWWWPRWPROSTATE764p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N500N
RECQL4QMCGLCCIWPROSTATE781p.R766fsc.2296_2296delCFrame_Shift_Del674.3422RV1N200N
RECQL4QMCGLCCIWPROSTATE781p.R766fsc.2296_2296delCFrame_Shift_Del674.34LNCAPCLONEFGCN200N
RECQL4QMCGLCCIWPROSTATE781p.R766fsc.2296_2296delCFrame_Shift_Del674.34MDAPCA2BN200N
RECQL4QMCGLCCIWPROSTATE781p.R766fsc.2296_2296delCFrame_Shift_Del674.34NCIH660N200N
RECQL4QMCGLCCIWPROSTATE781p.R766fsc.2296_2296delCFrame_Shift_Del674.34PC3N200N
RECQL4RAFMQGQLGPROSTATE758p.R766fsc.2296_2296delCFrame_Shift_Del174.3422RV1N000N
RECQL4RAFMQGQLGPROSTATE758p.R766fsc.2296_2296delCFrame_Shift_Del174.34LNCAPCLONEFGCN000N
RECQL4RAFMQGQLGPROSTATE758p.R766fsc.2296_2296delCFrame_Shift_Del174.34MDAPCA2BN000N
RECQL4RAFMQGQLGPROSTATE758p.R766fsc.2296_2296delCFrame_Shift_Del174.34NCIH660N000N
RECQL4RAFMQGQLGPROSTATE758p.R766fsc.2296_2296delCFrame_Shift_Del174.34PC3N000N
RECQL4RAKTCESCAPROSTATE821p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N300N
RECQL4RAKTCESCAPROSTATE821p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN300N
RECQL4RAKTCESCAPROSTATE821p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN300N
RECQL4RAKTCESCAPROSTATE821p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N300N
RECQL4RAKTCESCAPROSTATE821p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N300N
RECQL4RATCRPWAGPROSTATE796p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4RATCRPWAGPROSTATE796p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4RATCRPWAGPROSTATE796p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4RATCRPWAGPROSTATE796p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4RATCRPWAGPROSTATE796p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4RPWAGPGVTPROSTATE800p.R766fsc.2296_2296delCFrame_Shift_Del674.3422RV1N800N
RECQL4RPWAGPGVTPROSTATE800p.R766fsc.2296_2296delCFrame_Shift_Del674.34LNCAPCLONEFGCN800N
RECQL4RPWAGPGVTPROSTATE800p.R766fsc.2296_2296delCFrame_Shift_Del674.34MDAPCA2BN800N
RECQL4RPWAGPGVTPROSTATE800p.R766fsc.2296_2296delCFrame_Shift_Del674.34NCIH660N800N
RECQL4RPWAGPGVTPROSTATE800p.R766fsc.2296_2296delCFrame_Shift_Del674.34PC3N800N
RECQL4RWPLGWGWTPROSTATE771p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4RWPLGWGWTPROSTATE771p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4RWPLGWGWTPROSTATE771p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4RWPLGWGWTPROSTATE771p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4RWPLGWGWTPROSTATE771p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4SCADMCTPTPROSTATE827p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4SCADMCTPTPROSTATE827p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4SCADMCTPTPROSTATE827p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4SCADMCTPTPROSTATE827p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4SCADMCTPTPROSTATE827p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4SCSPRAKTCPROSTATE817p.R766fsc.2296_2296delCFrame_Shift_Del674.3422RV1N100N
RECQL4SCSPRAKTCPROSTATE817p.R766fsc.2296_2296delCFrame_Shift_Del674.34LNCAPCLONEFGCN100N
RECQL4SCSPRAKTCPROSTATE817p.R766fsc.2296_2296delCFrame_Shift_Del674.34MDAPCA2BN100N
RECQL4SCSPRAKTCPROSTATE817p.R766fsc.2296_2296delCFrame_Shift_Del674.34NCIH660N100N
RECQL4SCSPRAKTCPROSTATE817p.R766fsc.2296_2296delCFrame_Shift_Del674.34PC3N100N
RECQL4SLPTATSSCPROSTATE810p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N300N
RECQL4SLPTATSSCPROSTATE810p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN300N
RECQL4SLPTATSSCPROSTATE810p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN300N
RECQL4SLPTATSSCPROSTATE810p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N300N
RECQL4SLPTATSSCPROSTATE810p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N300N
RECQL4SPRAKTCESPROSTATE819p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N400N
RECQL4SPRAKTCESPROSTATE819p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN400N
RECQL4SPRAKTCESPROSTATE819p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN400N
RECQL4SPRAKTCESPROSTATE819p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N400N
RECQL4SPRAKTCESPROSTATE819p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N400N
RECQL4SRATCRPWAPROSTATE795p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N300N
RECQL4SRATCRPWAPROSTATE795p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN300N
RECQL4SRATCRPWAPROSTATE795p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN300N
RECQL4SRATCRPWAPROSTATE795p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N300N
RECQL4SRATCRPWAPROSTATE795p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N300N
RECQL4SSCSPRAKTPROSTATE816p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N100N
RECQL4SSCSPRAKTPROSTATE816p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN100N
RECQL4SSCSPRAKTPROSTATE816p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN100N
RECQL4SSCSPRAKTPROSTATE816p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N100N
RECQL4SSCSPRAKTPROSTATE816p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N100N
RECQL4TATSSCSPRPROSTATE813p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N300N
RECQL4TATSSCSPRPROSTATE813p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN300N
RECQL4TATSSCSPRPROSTATE813p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN300N
RECQL4TATSSCSPRPROSTATE813p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N300N
RECQL4TATSSCSPRPROSTATE813p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N300N
RECQL4TCESCADMCPROSTATE824p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N100N
RECQL4TCESCADMCPROSTATE824p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN100N
RECQL4TCESCADMCPROSTATE824p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN100N
RECQL4TCESCADMCPROSTATE824p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N100N
RECQL4TCESCADMCPROSTATE824p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N100N
RECQL4TCRPWAGPGPROSTATE798p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4TCRPWAGPGPROSTATE798p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4TCRPWAGPGPROSTATE798p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4TCRPWAGPGPROSTATE798p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4TCRPWAGPGPROSTATE798p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4TGQMCGLCCPROSTATE779p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N100N
RECQL4TGQMCGLCCPROSTATE779p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN100N
RECQL4TGQMCGLCCPROSTATE779p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN100N
RECQL4TGQMCGLCCPROSTATE779p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N100N
RECQL4TGQMCGLCCPROSTATE779p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N100N
RECQL4TGSLPTATSPROSTATE808p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N000N
RECQL4TGSLPTATSPROSTATE808p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN000N
RECQL4TGSLPTATSPROSTATE808p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN000N
RECQL4TGSLPTATSPROSTATE808p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N000N
RECQL4TGSLPTATSPROSTATE808p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N000N
RECQL4TPTARTSWLPROSTATE833p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1Y18100N
RECQL4TPTARTSWLPROSTATE833p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCY18100N
RECQL4TPTARTSWLPROSTATE833p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BY18100N
RECQL4TPTARTSWLPROSTATE833p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660Y18100N
RECQL4TPTARTSWLPROSTATE833p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3Y18100N
RECQL4TSSCSPRAKPROSTATE815p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1Y1120N
RECQL4TSSCSPRAKPROSTATE815p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCY1120N
RECQL4TSSCSPRAKPROSTATE815p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BY1120N
RECQL4TSSCSPRAKPROSTATE815p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660Y1120N
RECQL4TSSCSPRAKPROSTATE815p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3Y1120N
RECQL4VTGSLPTATPROSTATE807p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N100N
RECQL4VTGSLPTATPROSTATE807p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN100N
RECQL4VTGSLPTATPROSTATE807p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN100N
RECQL4VTGSLPTATPROSTATE807p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N100N
RECQL4VTGSLPTATPROSTATE807p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N100N
RECQL4WAGPGVTGSPROSTATE802p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N200N
RECQL4WAGPGVTGSPROSTATE802p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN200N
RECQL4WAGPGVTGSPROSTATE802p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN200N
RECQL4WAGPGVTGSPROSTATE802p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N200N
RECQL4WAGPGVTGSPROSTATE802p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N200N
RECQL4WGCPQASRAPROSTATE789p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N300N
RECQL4WGCPQASRAPROSTATE789p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN300N
RECQL4WGCPQASRAPROSTATE789p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN300N
RECQL4WGCPQASRAPROSTATE789p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N300N
RECQL4WGCPQASRAPROSTATE789p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N300N
RECQL4WGWTGQMCGPROSTATE776p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N300N
RECQL4WGWTGQMCGPROSTATE776p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN300N
RECQL4WGWTGQMCGPROSTATE776p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN300N
RECQL4WGWTGQMCGPROSTATE776p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N300N
RECQL4WGWTGQMCGPROSTATE776p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N300N
RECQL4WPLGWGWTGPROSTATE772p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N300N
RECQL4WPLGWGWTGPROSTATE772p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN300N
RECQL4WPLGWGWTGPROSTATE772p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN300N
RECQL4WPLGWGWTGPROSTATE772p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N300N
RECQL4WPLGWGWTGPROSTATE772p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N300N
RECQL4WPRWPLGWGPROSTATE769p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N400N
RECQL4WPRWPLGWGPROSTATE769p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN400N
RECQL4WPRWPLGWGPROSTATE769p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN400N
RECQL4WPRWPLGWGPROSTATE769p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N400N
RECQL4WPRWPLGWGPROSTATE769p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N400N
RECQL4WTGQMCGLCPROSTATE778p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N300N
RECQL4WTGQMCGLCPROSTATE778p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN300N
RECQL4WTGQMCGLCPROSTATE778p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN300N
RECQL4WTGQMCGLCPROSTATE778p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N300N
RECQL4WTGQMCGLCPROSTATE778p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N300N
RECQL4WWPRWPLGWPROSTATE768p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N304N
RECQL4WWPRWPLGWPROSTATE768p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN304N
RECQL4WWPRWPLGWPROSTATE768p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN304N
RECQL4WWPRWPLGWPROSTATE768p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N304N
RECQL4WWPRWPLGWPROSTATE768p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N304N
RECQL4WWWPRWPLGPROSTATE767p.R766fsc.2296_2296delCFrame_Shift_Del574.3422RV1N200N
RECQL4WWWPRWPLGPROSTATE767p.R766fsc.2296_2296delCFrame_Shift_Del574.34LNCAPCLONEFGCN200N
RECQL4WWWPRWPLGPROSTATE767p.R766fsc.2296_2296delCFrame_Shift_Del574.34MDAPCA2BN200N
RECQL4WWWPRWPLGPROSTATE767p.R766fsc.2296_2296delCFrame_Shift_Del574.34NCIH660N200N
RECQL4WWWPRWPLGPROSTATE767p.R766fsc.2296_2296delCFrame_Shift_Del574.34PC3N200N
RETAFHMKGRAGPROSTATE743p.L746Mc.2236C>AMissense_Mutation10.11DU145N000N
RETATAFHMKGRPROSTATE741p.L746Mc.2236C>AMissense_Mutation10.11DU145Y3140N
RETAWQTSQGMQPROSTATE855p.I858Tc.2573T>CMissense_Mutation10.11LNCAPCLONEFGCN000N
RETDLISFAWQTPROSTATE850p.I858Tc.2573T>CMissense_Mutation10.11LNCAPCLONEFGCN300N
RETFAWQTSQGMPROSTATE854p.I858Tc.2573T>CMissense_Mutation10.11LNCAPCLONEFGCY891N
RETFHMKGRAGYPROSTATE744p.L746Mc.2236C>AMissense_Mutation10.11DU145N5023N
RETHMKGRAGYTPROSTATE745p.L746Mc.2236C>AMissense_Mutation10.11DU145N100N
RETISFAWQTSQPROSTATE852p.I858Tc.2573T>CMissense_Mutation10.11LNCAPCLONEFGCN000N
RETKATAFHMKGPROSTATE740p.L746Mc.2236C>AMissense_Mutation10.11DU145N000N
RETLISFAWQTSPROSTATE851p.I858Tc.2573T>CMissense_Mutation10.11LNCAPCLONEFGCN003N
RETMKGRAGYTTPROSTATE746p.L746Mc.2236C>AMissense_Mutation10.11DU145N100N
RETQTSQGMQYLPROSTATE857p.I858Tc.2573T>CMissense_Mutation10.11LNCAPCLONEFGCY590N
RETSFAWQTSQGPROSTATE853p.I858Tc.2573T>CMissense_Mutation10.11LNCAPCLONEFGCN000N
RETTAFHMKGRAPROSTATE742p.L746Mc.2236C>AMissense_Mutation10.11DU145N700N
RETTSQGMQYLAPROSTATE858p.I858Tc.2573T>CMissense_Mutation10.11LNCAPCLONEFGCN100N
RETVKATAFHMKPROSTATE739p.L746Mc.2236C>AMissense_Mutation10.11DU145N102N
RETVVKATAFHMPROSTATE738p.L746Mc.2236C>AMissense_Mutation10.11DU145Y51024N
RETWQTSQGMQYPROSTATE856p.I858Tc.2573T>CMissense_Mutation10.11LNCAPCLONEFGCN903N
TNRC6BANSTWAREPPROSTATE165p.W169fsc.506_506delGFrame_Shift_Del40.1122RV1N000N
TNRC6BAPPPTQFTSPROSTATE178p.W169fsc.506_506delGFrame_Shift_Del40.1122RV1N300Y
TNRC6BAREPPPTTAPROSTATE170p.W169fsc.506_506delGFrame_Shift_Del40.1122RV1Y290Y
TNRC6BEPPPTTAPPPROSTATE172p.W169fsc.506_506delGFrame_Shift_Del30.1122RV1N000N
TNRC6BNSTWAREPPPROSTATE166p.W169fsc.506_506delGFrame_Shift_Del50.1122RV1N000N
TNRC6BNYANSTWARPROSTATE163p.W169fsc.506_506delGFrame_Shift_Del20.1122RV1Y3110N
TNRC6BPPPTQFTSGPROSTATE179p.W169fsc.506_506delGFrame_Shift_Del40.1122RV1N000Y
TNRC6BPPPTTAPPPPROSTATE173p.W169fsc.506_506delGFrame_Shift_Del30.1122RV1N000N
TNRC6BPPTQFTSGTPROSTATE180p.W169fsc.506_506delGFrame_Shift_Del50.1122RV1N000Y
TNRC6BPPTTAPPPTPROSTATE174p.W169fsc.506_506delGFrame_Shift_Del40.1122RV1N000N
TNRC6BPTQFTSGTRPROSTATE181p.W169fsc.506_506delGFrame_Shift_Del50.1122RV1N100N
TNRC6BPTTAPPPTQPROSTATE175p.W169fsc.506_506delGFrame_Shift_Del40.1122RV1N000N
TNRC6BREPPPTTAPPROSTATE171p.W169fsc.506_506delGFrame_Shift_Del30.1122RV1N200Y
TNRC6BSNYANSTWAPROSTATE162p.W169fsc.506_506delGFrame_Shift_Del10.1122RV1N300N
TNRC6BSTWAREPPPPROSTATE167p.W169fsc.506_506delGFrame_Shift_Del50.1122RV1N000Y
TNRC6BTAPPPTQFTPROSTATE177p.W169fsc.506_506delGFrame_Shift_Del50.1122RV1N300Y
TNRC6BTTAPPPTQFPROSTATE176p.W169fsc.506_506delGFrame_Shift_Del50.1122RV1Y5110Y
TNRC6BTWAREPPPTPROSTATE168p.W169fsc.506_506delGFrame_Shift_Del50.1122RV1N000Y
TNRC6BWAREPPPTTPROSTATE169p.W169fsc.506_506delGFrame_Shift_Del50.1122RV1N700Y
TNRC6BYANSTWAREPROSTATE164p.W169fsc.506_506delGFrame_Shift_Del30.1122RV1Y2110N
TNRC6BLQQQQQQQRPROSTATE1320p.Q1328delc.3960_3962delGCAIn_Frame_Del112.61MDAPCA2BN500N
TNRC6BGEVDQTKNSPROSTATE751p.E751Gc.2252A>GMissense_Mutation10.11DU145N400N
TNRC6BGGEVDQTKNPROSTATE750p.E751Gc.2252A>GMissense_Mutation10.11DU145N000N
TNRC6BGKNGWGGEVPROSTATE745p.E751Gc.2252A>GMissense_Mutation10.11DU145N200N
TNRC6BGWGGEVDQTPROSTATE748p.E751Gc.2252A>GMissense_Mutation10.11DU145N000N
TNRC6BKNGWGGEVDPROSTATE746p.E751Gc.2252A>GMissense_Mutation10.11DU145N000N
TNRC6BNGWGGEVDQPROSTATE747p.E751Gc.2252A>GMissense_Mutation10.11DU145N000N
TNRC6BSGKNGWGGEPROSTATE744p.E751Gc.2252A>GMissense_Mutation10.11DU145N000N
TNRC6BSSGKNGWGGPROSTATE743p.E751Gc.2252A>GMissense_Mutation10.11DU145N100N
TNRC6BWGGEVDQTKPROSTATE749p.E751Gc.2252A>GMissense_Mutation10.11DU145N100N
TP53ARPALCSCGPROSTATE138p.A138fsc.414_414delCFrame_Shift_Del60.11PC3N100N
TP53CQLARPALCPROSTATE135p.A138fsc.414_414delCFrame_Shift_Del50.11PC3N200Y
TP53FCQLARPALPROSTATE134p.A138fsc.414_414delCFrame_Shift_Del40.11PC3N800Y
TP53KMFCQLARPPROSTATE132p.A138fsc.414_414delCFrame_Shift_Del20.11PC3N200Y
TP53LARPALCSCPROSTATE137p.A138fsc.414_414delCFrame_Shift_Del60.11PC3N400N
TP53MFCQLARPAPROSTATE133p.A138fsc.414_414delCFrame_Shift_Del30.11PC3N3011Y
TP53NKMFCQLARPROSTATE131p.A138fsc.414_414delCFrame_Shift_Del10.11PC3N100Y
TP53QLARPALCSPROSTATE136p.A138fsc.414_414delCFrame_Shift_Del60.11PC3N000N
TP53RPALCSCGLPROSTATE139p.A138fsc.414_414delCFrame_Shift_Del50.22PC3N1700N
TP53ALCSCGLIPPROSTATE141p.A138fsc.414_414delCFrame_Shift_Del50.33PC3N100N
TP53CGLIPHPRPPROSTATE145p.A138fsc.414_414delCFrame_Shift_Del60.33PC3N000N
TP53CSCGLIPHPPROSTATE143p.A138fsc.414_414delCFrame_Shift_Del50.33PC3N000N
TP53GLIPHPRPAPROSTATE146p.A138fsc.414_414delCFrame_Shift_Del50.33PC3N200N
TP53HPRPAPASAPROSTATE150p.A138fsc.414_414delCFrame_Shift_Del40.33PC3N900N
TP53IPHPRPAPAPROSTATE148p.A138fsc.414_414delCFrame_Shift_Del40.33PC3Y9110N
TP53LCSCGLIPHPROSTATE142p.A138fsc.414_414delCFrame_Shift_Del50.33PC3N000N
TP53LIPHPRPAPPROSTATE147p.A138fsc.414_414delCFrame_Shift_Del50.33PC3N008N
TP53PALCSCGLIPROSTATE140p.A138fsc.414_414delCFrame_Shift_Del60.33PC3N300N
TP53PHPRPAPASPROSTATE149p.A138fsc.414_414delCFrame_Shift_Del40.33PC3N000N
TP53SCGLIPHPRPROSTATE144p.A138fsc.414_414delCFrame_Shift_Del50.33PC3N300N
TP53APASAPWPSPROSTATE154p.A138fsc.414_414delCFrame_Shift_Del40.77PC3N300N
TP53PAPASAPWPPROSTATE153p.A138fsc.414_414delCFrame_Shift_Del40.77PC3N000N
TP53PRPAPASAPPROSTATE151p.A138fsc.414_414delCFrame_Shift_Del40.77PC3N000N
TP53RPAPASAPWPROSTATE152p.A138fsc.414_414delCFrame_Shift_Del40.77PC3Y10120N
TP53APWPSTSSHPROSTATE158p.A138fsc.414_414delCFrame_Shift_Del50.88PC3N100N
TP53ASAPWPSTSPROSTATE156p.A138fsc.414_414delCFrame_Shift_Del40.88PC3Y1110N
TP53PASAPWPSTPROSTATE155p.A138fsc.414_414delCFrame_Shift_Del40.88PC3N000N
TP53PWPSTSSHSPROSTATE159p.A138fsc.414_414delCFrame_Shift_Del50.88PC3N000N
TP53SAPWPSTSSPROSTATE157p.A138fsc.414_414delCFrame_Shift_Del50.88PC3N200N
TP53WPSTSSHSTPROSTATE160p.A138fsc.414_414delCFrame_Shift_Del50.88PC3N700N
TP53CMGGMNWRPPROSTATE242p.R248Wc.742C>TMissense_Mutation11.99VCAPN000N
TP53GGMNWRPILPROSTATE244p.R248Wc.742C>TMissense_Mutation11.99VCAPN1300N
TP53GMNWRPILTPROSTATE245p.R248Wc.742C>TMissense_Mutation11.99VCAPN200N
TP53MGGMNWRPIPROSTATE243p.R248Wc.742C>TMissense_Mutation11.99VCAPN1000N
TP53MNWRPILTIPROSTATE246p.R248Wc.742C>TMissense_Mutation11.99VCAPY101118