Cancertope

In silico Platform for designing genome-based
Personalized immunotherapy or Vaccine against Cancer

Browse Results ...


The result page of search shows exclusive peptide/epitopes generated due to mutation [Neoepitope], the tissue of origin [Tissue], position of peptide in protein [Position], number of mismatches counted by aligning mutated and normal protein sequence [Num Mismatch, percentage of cell lines with this peptide over total number of cell lines [Promiscuity %]. The immune information include CTL epitopes (Yes/No), MHC I binders, MHC II binders (both given as number of alleles) and B cell epitopes (Yes/No). For more information, please click HERE


Result Reset Search:
ProteinNeoepitopesTissuePositionProt MutationcDNA MutationMutation TypeNum MismatchPromiscuity (%)Cell LineCTLMHC INHLApredMHC IIBcell
AAK1DRGRYVLCDPANCREAS186p.H189Rc.566A>GMissense_Mutation10.22PSN1N000N
AAK1GRYVLCDFGPANCREAS188p.H189Rc.566A>GMissense_Mutation10.22PSN1N200N
AAK1HDRGRYVLCPANCREAS185p.H189Rc.566A>GMissense_Mutation10.22PSN1N200N
AAK1ILLHDRGRYPANCREAS182p.H189Rc.566A>GMissense_Mutation10.22PSN1N5013N
AAK1LHDRGRYVLPANCREAS184p.H189Rc.566A>GMissense_Mutation10.22PSN1N600N
AAK1LLHDRGRYVPANCREAS183p.H189Rc.566A>GMissense_Mutation10.22PSN1Y9120N
AAK1NILLHDRGRPANCREAS181p.H189Rc.566A>GMissense_Mutation10.22PSN1N400N
AAK1RGRYVLCDFPANCREAS187p.H189Rc.566A>GMissense_Mutation10.22PSN1N800N
AAK1RYVLCDFGSPANCREAS189p.H189Rc.566A>GMissense_Mutation10.22PSN1N200N
ABL1ADKNLYTFCPANCREAS1078p.G1079Dc.3236G>AMissense_Mutation10.11CAPAN2N200N
ABL1AVLEADKNLPANCREAS1074p.G1079Dc.3236G>AMissense_Mutation10.11CAPAN2N1400N
ABL1DKNLYTFCVPANCREAS1079p.G1079Dc.3236G>AMissense_Mutation10.11CAPAN2N300Y
ABL1EADKNLYTFPANCREAS1077p.G1079Dc.3236G>AMissense_Mutation10.11CAPAN2N400N
ABL1HSAVLEADKPANCREAS1072p.G1079Dc.3236G>AMissense_Mutation10.11CAPAN2N200N
ABL1LEADKNLYTPANCREAS1076p.G1079Dc.3236G>AMissense_Mutation10.11CAPAN2N600N
ABL1SAVLEADKNPANCREAS1073p.G1079Dc.3236G>AMissense_Mutation10.11CAPAN2N200N
ABL1SHSAVLEADPANCREAS1071p.G1079Dc.3236G>AMissense_Mutation10.11CAPAN2N000N
ABL1VLEADKNLYPANCREAS1075p.G1079Dc.3236G>AMissense_Mutation10.11CAPAN2N500Y
ABL1DEHLLPKDKPANCREAS606p.R608Hc.1823G>AMissense_Mutation10.22HS766TN100N
ABL1EDEHLLPKDPANCREAS605p.R608Hc.1823G>AMissense_Mutation10.22HS766TN000N
ABL1EGGLNEDEHPANCREAS600p.R608Hc.1823G>AMissense_Mutation10.22HS766TN000N
ABL1EHLLPKDKKPANCREAS607p.R608Hc.1823G>AMissense_Mutation10.22HS766TN000N
ABL1GGLNEDEHLPANCREAS601p.R608Hc.1823G>AMissense_Mutation10.22HS766TN1200N
ABL1GLNEDEHLLPANCREAS602p.R608Hc.1823G>AMissense_Mutation10.22HS766TY12110N
ABL1HLLPKDKKTPANCREAS608p.R608Hc.1823G>AMissense_Mutation10.22HS766TN100N
ABL1LNEDEHLLPPANCREAS603p.R608Hc.1823G>AMissense_Mutation10.22HS766TN000N
ABL1NEDEHLLPKPANCREAS604p.R608Hc.1823G>AMissense_Mutation10.22HS766TN200N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86BXPC3N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAPAN1N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAPAN2N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86DANGN000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HPAFIIN000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS766TN000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HUPT3N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HUPT4N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KP1NLN000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KP1NN000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KP3N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KP4N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86L33N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MIAPACA2N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86PANC0203N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86PANC0213N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86PANC0813N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86PATU8902N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86PK45HN000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86PK59N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86PSN1N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86QGP1N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU213N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU324N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SU8686N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SW1990N000N
AKAP12AIEEDLEPEPANCREAS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86YAPCN000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86BXPC3N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAPAN1N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAPAN2N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86DANGN000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HPAFIIN000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS766TN000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HUPT3N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HUPT4N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KP1NLN000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KP1NN000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KP3N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KP4N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86L33N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MIAPACA2N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86PANC0203N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86PANC0213N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86PANC0813N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86PATU8902N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86PK45HN000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86PK59N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86PSN1N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86QGP1N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU213N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU324N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SU8686N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SW1990N000N
AKAP12EEDLEPENGPANCREAS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86YAPCN000N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86BXPC3N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAPAN1N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAPAN2N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86DANGN200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HPAFIIN200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS766TN200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HUPT3N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HUPT4N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KP1NLN200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KP1NN200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KP3N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KP4N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86L33N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MIAPACA2N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86PANC0203N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86PANC0213N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86PANC0813N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86PATU8902N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86PK45HN200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86PK59N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86PSN1N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86QGP1N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU213N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU324N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SU8686N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SW1990N200N
AKAP12IEEDLEPENPANCREAS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86YAPCN200N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86BXPC3N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAPAN1N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAPAN2N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86DANGN000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HPAFIIN000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS766TN000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HUPT3N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HUPT4N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KP1NLN000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KP1NN000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KP3N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KP4N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86L33N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MIAPACA2N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86PANC0203N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86PANC0213N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86PANC0813N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86PATU8902N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86PK45HN000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86PK59N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86PSN1N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86QGP1N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU213N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU324N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SU8686N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SW1990N000N
AKAP12KVSVAIEEDPANCREAS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86YAPCN000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86BXPC3N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAPAN1N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAPAN2N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86DANGN000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HPAFIIN000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS766TN000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HUPT3N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HUPT4N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KP1NLN000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KP1NN000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KP3N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KP4N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86L33N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MIAPACA2N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86PANC0203N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86PANC0213N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86PANC0813N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86PATU8902N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86PK45HN000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86PK59N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86PSN1N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86QGP1N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU213N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU324N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SU8686N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SW1990N000N
AKAP12SVAIEEDLEPANCREAS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86YAPCN000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86BXPC3N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAPAN1N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAPAN2N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86DANGN000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HPAFIIN000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS766TN000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HUPT3N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HUPT4N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KP1NLN000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KP1NN000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KP3N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KP4N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86L33N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MIAPACA2N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86PANC0203N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86PANC0213N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86PANC0813N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86PATU8902N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86PK45HN000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86PK59N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86PSN1N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86QGP1N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU213N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU324N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SU8686N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SW1990N000N
AKAP12VAIEEDLEPPANCREAS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86YAPCN000N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86BXPC3N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAPAN1N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAPAN2N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86DANGN002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HPAFIIN002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS766TN002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HUPT3N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HUPT4N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KP1NLN002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KP1NN002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KP3N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KP4N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86L33N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MIAPACA2N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86PANC0203N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86PANC0213N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86PANC0813N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86PATU8902N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86PK45HN002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86PK59N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86PSN1N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86QGP1N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU213N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU324N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SU8686N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SW1990N002N
AKAP12VKVSVAIEEPANCREAS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86YAPCN002N
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86BXPC3N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAPAN1N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAPAN2N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86DANGN1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HPAFIIN1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS766TN1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HUPT3N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HUPT4N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KP1NLN1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KP1NN1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KP3N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KP4N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86L33N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MIAPACA2N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86PANC0203N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86PANC0213N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86PANC0813N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86PATU8902N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86PK45HN1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86PK59N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86PSN1N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86QGP1N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU213N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU324N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SU8686N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SW1990N1500Y
AKAP12VSVAIEEDLPANCREAS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86YAPCN1500Y
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CAPAN1N000N
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27DANGN000N
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HPAFIIN000N
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KP1NLN000N
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KP1NN000N
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KP2N000N
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27L33N000N
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27PANC0203N000N
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27PANC1005N000N
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27PK59N000N
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27QGP1N000N
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU410N000N
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SU8686N000N
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SW1990N000N
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27T3M4N000N
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TCCPAN2N000N
AKAP9DLEKTKQLEPANCREAS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27YAPCN000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CAPAN1N000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27DANGN000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HPAFIIN000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KP1NLN000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KP1NN000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KP2N000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27L33N000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27PANC0203N000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27PANC1005N000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27PK59N000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27QGP1N000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU410N000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SU8686N000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SW1990N000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27T3M4N000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TCCPAN2N000N
AKAP9EKTKQLEEQPANCREAS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27YAPCN000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CAPAN1N000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27DANGN000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HPAFIIN000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KP1NLN000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KP1NN000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KP2N000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27L33N000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27PANC0203N000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27PANC1005N000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27PK59N000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27QGP1N000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU410N000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SU8686N000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SW1990N000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27T3M4N000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TCCPAN2N000N
AKAP9KQLEEQVQEPANCREAS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27YAPCN000N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27CAPAN1N200N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27DANGN200N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HPAFIIN200N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27KP1NLN200N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27KP1NN200N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27KP2N200N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27L33N200N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27PANC0203N200N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27PANC1005N200N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27PK59N200N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27QGP1N200N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SNU410N200N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SU8686N200N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SW1990N200N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27T3M4N200N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27TCCPAN2N200N
AKAP9KTKQLEEQVPANCREAS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27YAPCN200N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CAPAN1N000N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27DANGN000N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HPAFIIN000N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KP1NLN000N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KP1NN000N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KP2N000N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27L33N000N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27PANC0203N000N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27PANC1005N000N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27PK59N000N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27QGP1N000N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU410N000N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SU8686N000N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SW1990N000N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27T3M4N000N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TCCPAN2N000N
AKAP9LEKTKQLEEPANCREAS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27YAPCN000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27CAPAN1N000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27DANGN000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HPAFIIN000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KP1NLN000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KP1NN000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KP2N000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27L33N000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27PANC0203N000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27PANC1005N000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27PK59N000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27QGP1N000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SNU410N000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SU8686N000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SW1990N000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27T3M4N000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27TCCPAN2N000N
AKAP9LQDLEKTKQPANCREAS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27YAPCN000N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CAPAN1N900N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27DANGN900N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HPAFIIN900N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KP1NLN900N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KP1NN900N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KP2N900N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27L33N900N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27PANC0203N900N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27PANC1005N900N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27PK59N900N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27QGP1N900N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU410N900N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SU8686N900N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SW1990N900N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27T3M4N900N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TCCPAN2N900N
AKAP9QDLEKTKQLPANCREAS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27YAPCN900N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27CAPAN1N1200N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27DANGN1200N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HPAFIIN1200N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KP1NLN1200N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KP1NN1200N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KP2N1200N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27L33N1200N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27PANC0203N1200N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27PANC1005N1200N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27PK59N1200N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27QGP1N1200N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SNU410N1200N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SU8686N1200N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SW1990N1200N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27T3M4N1200N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27TCCPAN2N1200N
AKAP9QLEEQVQELPANCREAS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27YAPCN1200N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CAPAN1N000N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27DANGN000N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HPAFIIN000N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KP1NLN000N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KP1NN000N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KP2N000N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27L33N000N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27PANC0203N000N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27PANC1005N000N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27PK59N000N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27QGP1N000N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU410N000N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SU8686N000N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SW1990N000N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27T3M4N000N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TCCPAN2N000N
AKAP9TKQLEEQVQPANCREAS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27YAPCN000N
AKAP9EIQKTESTTPANCREAS2234p.K2238Tc.6713A>CMissense_Mutation10.11SNU324N100N
AKAP9FSHKEELSKPANCREAS631p.E634Kc.1900G>AMissense_Mutation10.11SNU324N300N
AKAP9HKEELSKLKPANCREAS633p.E634Kc.1900G>AMissense_Mutation10.11SNU324N200N
AKAP9HMQLEIQKTPANCREAS2230p.K2238Tc.6713A>CMissense_Mutation10.11SNU324N100N
AKAP9IQKTESTTRPANCREAS2235p.K2238Tc.6713A>CMissense_Mutation10.11SNU324N603N
AKAP9KEELSKLKEPANCREAS634p.E634Kc.1900G>AMissense_Mutation10.11SNU324N000N
AKAP9KTESTTRLQPANCREAS2237p.K2238Tc.6713A>CMissense_Mutation10.11SNU324N100N
AKAP9LEIQKTESTPANCREAS2233p.K2238Tc.6713A>CMissense_Mutation10.11SNU324N503N
AKAP9LFSHKEELSPANCREAS630p.E634Kc.1900G>AMissense_Mutation10.11SNU324N000N
AKAP9LLFSHKEELPANCREAS629p.E634Kc.1900G>AMissense_Mutation10.11SNU324N1309N
AKAP9MQLEIQKTEPANCREAS2231p.K2238Tc.6713A>CMissense_Mutation10.11SNU324N000N
AKAP9QKTESTTRLPANCREAS2236p.K2238Tc.6713A>CMissense_Mutation10.11SNU324N400N
AKAP9QLEIQKTESPANCREAS2232p.K2238Tc.6713A>CMissense_Mutation10.11SNU324N100N
AKAP9QLLFSHKEEPANCREAS628p.E634Kc.1900G>AMissense_Mutation10.11SNU324N000N
AKAP9RTQLLFSHKPANCREAS626p.E634Kc.1900G>AMissense_Mutation10.11SNU324N600N
AKAP9SHKEELSKLPANCREAS632p.E634Kc.1900G>AMissense_Mutation10.11SNU324Y2110N
AKAP9TESTTRLQEPANCREAS2238p.K2238Tc.6713A>CMissense_Mutation10.11SNU324N000N
AKAP9TQLLFSHKEPANCREAS627p.E634Kc.1900G>AMissense_Mutation10.11SNU324N000N
ALKAKREERSPAPANCREAS1430p.E1435delc.4303_4305delGAGIn_Frame_Del30.33L33N200N
ALKKREERSPAAPANCREAS1431p.E1435delc.4303_4305delGAGIn_Frame_Del20.33L33N300N
ALKQAKREERSPPANCREAS1429p.E1435delc.4303_4305delGAGIn_Frame_Del30.33L33N000N
ALKQQAKREERSPANCREAS1428p.E1435delc.4303_4305delGAGIn_Frame_Del20.33L33N000N
ALKREERSPAAPPANCREAS1432p.E1435delc.4303_4305delGAGIn_Frame_Del10.33L33N000N
ALKSQQAKREERPANCREAS1427p.E1435delc.4303_4305delGAGIn_Frame_Del10.33L33N500N
ALKESPTNVPSPPANCREAS228p.M233Vc.697A>GMissense_Mutation10.11SNU213N000N
ALKLESPTNVPSPANCREAS227p.M233Vc.697A>GMissense_Mutation10.11SNU213N300N
ALKNVPSPSPDYPANCREAS232p.M233Vc.697A>GMissense_Mutation10.11SNU213N400N
ALKPTNVPSPSPPANCREAS230p.M233Vc.697A>GMissense_Mutation10.11SNU213N000N
ALKSLESPTNVPPANCREAS226p.M233Vc.697A>GMissense_Mutation10.11SNU213N000N
ALKSPTNVPSPSPANCREAS229p.M233Vc.697A>GMissense_Mutation10.11SNU213N300N
ALKSSLESPTNVPANCREAS225p.M233Vc.697A>GMissense_Mutation10.11SNU213N700N
ALKTNVPSPSPDPANCREAS231p.M233Vc.697A>GMissense_Mutation10.11SNU213N000N
ALKVPSPSPDYFPANCREAS233p.M233Vc.697A>GMissense_Mutation10.11SNU213N1200N
ALKAVEGGHVNTPANCREAS1470p.M1478Tc.4433T>CMissense_Mutation10.55KP2N100N
ALKAVEGGHVNTPANCREAS1470p.M1478Tc.4433T>CMissense_Mutation10.55KP3N100N
ALKEGGHVNTAFPANCREAS1472p.M1478Tc.4433T>CMissense_Mutation10.55KP2N600N
ALKEGGHVNTAFPANCREAS1472p.M1478Tc.4433T>CMissense_Mutation10.55KP3N600N
ALKGGHVNTAFSPANCREAS1473p.M1478Tc.4433T>CMissense_Mutation10.55KP2N100N
ALKGGHVNTAFSPANCREAS1473p.M1478Tc.4433T>CMissense_Mutation10.55KP3N100N
ALKGHVNTAFSQPANCREAS1474p.M1478Tc.4433T>CMissense_Mutation10.55KP2N000N
ALKGHVNTAFSQPANCREAS1474p.M1478Tc.4433T>CMissense_Mutation10.55KP3N000N
ALKHVNTAFSQSPANCREAS1475p.M1478Tc.4433T>CMissense_Mutation10.55KP2N000N
ALKHVNTAFSQSPANCREAS1475p.M1478Tc.4433T>CMissense_Mutation10.55KP3N000N
ALKNTAFSQSNPPANCREAS1477p.M1478Tc.4433T>CMissense_Mutation10.55KP2N000N
ALKNTAFSQSNPPANCREAS1477p.M1478Tc.4433T>CMissense_Mutation10.55KP3N000N
ALKTAFSQSNPPPANCREAS1478p.M1478Tc.4433T>CMissense_Mutation10.55KP2N000N
ALKTAFSQSNPPPANCREAS1478p.M1478Tc.4433T>CMissense_Mutation10.55KP3N000N
ALKVEGGHVNTAPANCREAS1471p.M1478Tc.4433T>CMissense_Mutation10.55KP2Y694N
ALKVEGGHVNTAPANCREAS1471p.M1478Tc.4433T>CMissense_Mutation10.55KP3Y694N
ALKVNTAFSQSNPANCREAS1476p.M1478Tc.4433T>CMissense_Mutation10.55KP2N000N
ALKVNTAFSQSNPANCREAS1476p.M1478Tc.4433T>CMissense_Mutation10.55KP3N000N
ALPK2AFKKFLTCPPANCREAS1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27CAPAN1N000N
ALPK2AFKKFLTCPPANCREAS1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27CAPAN2N000N
ALPK2AFKKFLTCPPANCREAS1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HPAFIIN000N
ALPK2AFKKFLTCPPANCREAS1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HUPT3N000N
ALPK2DHTAFKKFLPANCREAS1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27CAPAN1N600N
ALPK2DHTAFKKFLPANCREAS1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27CAPAN2N600N
ALPK2DHTAFKKFLPANCREAS1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HPAFIIN600N
ALPK2DHTAFKKFLPANCREAS1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HUPT3N600N
ALPK2HTAFKKFLTPANCREAS1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27CAPAN1N100N
ALPK2HTAFKKFLTPANCREAS1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27CAPAN2N100N
ALPK2HTAFKKFLTPANCREAS1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HPAFIIN100N
ALPK2HTAFKKFLTPANCREAS1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HUPT3N100N
ALPK2KMDHTAFKKPANCREAS1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27CAPAN1N600N
ALPK2KMDHTAFKKPANCREAS1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27CAPAN2N600N
ALPK2KMDHTAFKKPANCREAS1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HPAFIIN600N
ALPK2KMDHTAFKKPANCREAS1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HUPT3N600N
ALPK2LKMDHTAFKPANCREAS1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27CAPAN1N1017N
ALPK2LKMDHTAFKPANCREAS1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27CAPAN2N1017N
ALPK2LKMDHTAFKPANCREAS1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HPAFIIN1017N
ALPK2LKMDHTAFKPANCREAS1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HUPT3N1017N
ALPK2MDHTAFKKFPANCREAS1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27CAPAN1N600N
ALPK2MDHTAFKKFPANCREAS1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27CAPAN2N600N
ALPK2MDHTAFKKFPANCREAS1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HPAFIIN600N
ALPK2MDHTAFKKFPANCREAS1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HUPT3N600N
ALPK2TAFKKFLTCPANCREAS1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27CAPAN1N600N
ALPK2TAFKKFLTCPANCREAS1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27CAPAN2N600N
ALPK2TAFKKFLTCPANCREAS1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HPAFIIN600N
ALPK2TAFKKFLTCPANCREAS1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HUPT3N600N
ALPK2ATRETVTIAPANCREAS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74ASPC1Y1140N
ALPK2ATRETVTIAPANCREAS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74BXPC3Y1140N
ALPK2ATRETVTIAPANCREAS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HS766TY1140N
ALPK2ATRETVTIAPANCREAS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74KP2Y1140N
ALPK2ATRETVTIAPANCREAS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74KP3Y1140N
ALPK2ATRETVTIAPANCREAS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74PANC0203Y1140N
ALPK2ATRETVTIAPANCREAS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74PANC0213Y1140N
ALPK2ATRETVTIAPANCREAS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74PANC1005Y1140N
ALPK2ATRETVTIAPANCREAS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SW1990Y1140N
ALPK2CFQATRETVPANCREAS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74ASPC1Y2110N
ALPK2CFQATRETVPANCREAS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74BXPC3Y2110N
ALPK2CFQATRETVPANCREAS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HS766TY2110N
ALPK2CFQATRETVPANCREAS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KP2Y2110N
ALPK2CFQATRETVPANCREAS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KP3Y2110N
ALPK2CFQATRETVPANCREAS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74PANC0203Y2110N
ALPK2CFQATRETVPANCREAS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74PANC0213Y2110N
ALPK2CFQATRETVPANCREAS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74PANC1005Y2110N
ALPK2CFQATRETVPANCREAS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SW1990Y2110N
ALPK2ETVTIATEVPANCREAS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74ASPC1N400N
ALPK2ETVTIATEVPANCREAS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74BXPC3N400N
ALPK2ETVTIATEVPANCREAS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HS766TN400N
ALPK2ETVTIATEVPANCREAS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KP2N400N
ALPK2ETVTIATEVPANCREAS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KP3N400N
ALPK2ETVTIATEVPANCREAS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74PANC0203N400N
ALPK2ETVTIATEVPANCREAS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74PANC0213N400N
ALPK2ETVTIATEVPANCREAS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74PANC1005N400N
ALPK2ETVTIATEVPANCREAS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SW1990N400N
ALPK2FQATRETVTPANCREAS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74ASPC1N600N
ALPK2FQATRETVTPANCREAS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74BXPC3N600N
ALPK2FQATRETVTPANCREAS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HS766TN600N
ALPK2FQATRETVTPANCREAS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KP2N600N
ALPK2FQATRETVTPANCREAS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KP3N600N
ALPK2FQATRETVTPANCREAS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74PANC0203N600N
ALPK2FQATRETVTPANCREAS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74PANC0213N600N
ALPK2FQATRETVTPANCREAS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74PANC1005N600N
ALPK2FQATRETVTPANCREAS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SW1990N600N
ALPK2QATRETVTIPANCREAS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74ASPC1N600N
ALPK2QATRETVTIPANCREAS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74BXPC3N600N
ALPK2QATRETVTIPANCREAS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HS766TN600N
ALPK2QATRETVTIPANCREAS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KP2N600N
ALPK2QATRETVTIPANCREAS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KP3N600N
ALPK2QATRETVTIPANCREAS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74PANC0203N600N
ALPK2QATRETVTIPANCREAS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74PANC0213N600N
ALPK2QATRETVTIPANCREAS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74PANC1005N600N
ALPK2QATRETVTIPANCREAS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SW1990N600N
ALPK2RETVTIATEPANCREAS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74ASPC1N100N
ALPK2RETVTIATEPANCREAS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74BXPC3N100N
ALPK2RETVTIATEPANCREAS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HS766TN100N
ALPK2RETVTIATEPANCREAS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KP2N100N
ALPK2RETVTIATEPANCREAS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KP3N100N
ALPK2RETVTIATEPANCREAS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74PANC0203N100N
ALPK2RETVTIATEPANCREAS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74PANC0213N100N
ALPK2RETVTIATEPANCREAS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74PANC1005N100N
ALPK2RETVTIATEPANCREAS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SW1990N100N
ALPK2TRETVTIATPANCREAS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74ASPC1N200N
ALPK2TRETVTIATPANCREAS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74BXPC3N200N
ALPK2TRETVTIATPANCREAS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HS766TN200N
ALPK2TRETVTIATPANCREAS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KP2N200N
ALPK2TRETVTIATPANCREAS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KP3N200N
ALPK2TRETVTIATPANCREAS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74PANC0203N200N
ALPK2TRETVTIATPANCREAS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74PANC0213N200N
ALPK2TRETVTIATPANCREAS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74PANC1005N200N
ALPK2TRETVTIATPANCREAS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SW1990N200N
ALPK2ATEVRPAKYPANCREAS1014p.H1018Rc.3053A>GMissense_Mutation10.11SNU324Y3150N
ALPK2EVRPAKYLAPANCREAS1016p.H1018Rc.3053A>GMissense_Mutation10.11SNU324N300N
ALPK2IATEVRPAKPANCREAS1013p.H1018Rc.3053A>GMissense_Mutation10.11SNU324N200N
ALPK2RPAKYLAVSPANCREAS1018p.H1018Rc.3053A>GMissense_Mutation10.11SNU324N300N
ALPK2TEVRPAKYLPANCREAS1015p.H1018Rc.3053A>GMissense_Mutation10.11SNU324Y890N
ALPK2TIATEVRPAPANCREAS1012p.H1018Rc.3053A>GMissense_Mutation10.11SNU324N100N
ALPK2TVTIATEVRPANCREAS1010p.H1018Rc.3053A>GMissense_Mutation10.11SNU324N500N
ALPK2VRPAKYLAVPANCREAS1017p.H1018Rc.3053A>GMissense_Mutation10.11SNU324Y6116N
ALPK2VTIATEVRPPANCREAS1011p.H1018Rc.3053A>GMissense_Mutation10.11SNU324N000N
ATMKMMEVQKKVPANCREAS2804p.Q2809fsc.8425_8426insAFrame_Shift_Ins10.11SNU324N600N
ATMMMEVQKKVFPANCREAS2805p.Q2809fsc.8425_8426insAFrame_Shift_Ins10.11SNU324N500N
ATMAETCLGNPAPANCREAS2346p.E2351Gc.7052A>GMissense_Mutation10.11PANC0327N500N
ATMCLGNPAVIMPANCREAS2349p.E2351Gc.7052A>GMissense_Mutation10.11PANC0327N200N
ATMDTEYNLSSSPANCREAS1226p.F1234Sc.3701T>CMissense_Mutation10.11PANC0813N100N
ATMETCLGNPAVPANCREAS2347p.E2351Gc.7052A>GMissense_Mutation10.11PANC0327Y0100Y
ATMEYNLSSSPFPANCREAS1228p.F1234Sc.3701T>CMissense_Mutation10.11PANC0813N400N
ATMGNPAVIMQTPANCREAS2351p.E2351Gc.7052A>GMissense_Mutation10.11PANC0327N000N
ATMIKYSSGPFSPANCREAS1581p.R1585Sc.4755A>CMissense_Mutation10.11CAPAN1N104N
ATMKIKYSSGPFPANCREAS1580p.R1585Sc.4755A>CMissense_Mutation10.11CAPAN1N500N
ATMKYSSGPFSLPANCREAS1582p.R1585Sc.4755A>CMissense_Mutation10.11CAPAN1Y7110N
ATMLAETCLGNPPANCREAS2345p.E2351Gc.7052A>GMissense_Mutation10.11PANC0327N000N
ATMLGNPAVIMQPANCREAS2350p.E2351Gc.7052A>GMissense_Mutation10.11PANC0327N001N
ATMLSSSPFILLPANCREAS1231p.F1234Sc.3701T>CMissense_Mutation10.11PANC0813Y1392N
ATMNLSSSPFILPANCREAS1230p.F1234Sc.3701T>CMissense_Mutation10.11PANC0813N900N
ATMNWLAETCLGPANCREAS2343p.E2351Gc.7052A>GMissense_Mutation10.11PANC0327N000N
ATMQKIKYSSGPPANCREAS1579p.R1585Sc.4755A>CMissense_Mutation10.11CAPAN1N000N
ATMQQKIKYSSGPANCREAS1578p.R1585Sc.4755A>CMissense_Mutation10.11CAPAN1N000N
ATMSGPFSLLEEPANCREAS1585p.R1585Sc.4755A>CMissense_Mutation10.11CAPAN1N100N
ATMSPFILLNYTPANCREAS1234p.F1234Sc.3701T>CMissense_Mutation10.11PANC0813N500N
ATMSSGPFSLLEPANCREAS1584p.R1585Sc.4755A>CMissense_Mutation10.11CAPAN1N000N
ATMSSPFILLNYPANCREAS1233p.F1234Sc.3701T>CMissense_Mutation10.11PANC0813N900N
ATMSSSPFILLNPANCREAS1232p.F1234Sc.3701T>CMissense_Mutation10.11PANC0813N200N
ATMTCLGNPAVIPANCREAS2348p.E2351Gc.7052A>GMissense_Mutation10.11PANC0327N700N
ATMTEYNLSSSPPANCREAS1227p.F1234Sc.3701T>CMissense_Mutation10.11PANC0813N000N
ATMTQQKIKYSSPANCREAS1577p.R1585Sc.4755A>CMissense_Mutation10.11CAPAN1N000Y
ATMWLAETCLGNPANCREAS2344p.E2351Gc.7052A>GMissense_Mutation10.11PANC0327N203N
ATMYNLSSSPFIPANCREAS1229p.F1234Sc.3701T>CMissense_Mutation10.11PANC0813N1008N
ATMYSSGPFSLLPANCREAS1583p.R1585Sc.4755A>CMissense_Mutation10.11CAPAN1Y1690N
ATMETRKRILTIPANCREAS2744p.K2749Ic.8246A>TMissense_Mutation10.22QGP1Y8160N
ATMILTICTYKVPANCREAS2749p.K2749Ic.8246A>TMissense_Mutation10.22QGP1Y8119N
ATMKRILTICTYPANCREAS2747p.K2749Ic.8246A>TMissense_Mutation10.22QGP1N600N
ATMNTETRKRILPANCREAS2742p.K2749Ic.8246A>TMissense_Mutation10.22QGP1N600N
ATMRILTICTYKPANCREAS2748p.K2749Ic.8246A>TMissense_Mutation10.22QGP1Y590N
ATMRKRILTICTPANCREAS2746p.K2749Ic.8246A>TMissense_Mutation10.22QGP1N100N
ATMRNTETRKRIPANCREAS2741p.K2749Ic.8246A>TMissense_Mutation10.22QGP1N200N
ATMTETRKRILTPANCREAS2743p.K2749Ic.8246A>TMissense_Mutation10.22QGP1N600N
ATMTRKRILTICPANCREAS2745p.K2749Ic.8246A>TMissense_Mutation10.22QGP1N300N
CARD10AQPATPGLRPANCREAS897p.G905Rc.2713G>CMissense_Mutation10.11PK1N500N
CARD10ATPGLRSRIPANCREAS900p.G905Rc.2713G>CMissense_Mutation10.11PK1Y5130N
CARD10GLRSRIRAIPANCREAS903p.G905Rc.2713G>CMissense_Mutation10.11PK1Y7130N
CARD10LRSRIRAIQPANCREAS904p.G905Rc.2713G>CMissense_Mutation10.11PK1N1029N
CARD10PATPGLRSRPANCREAS899p.G905Rc.2713G>CMissense_Mutation10.11PK1N000N
CARD10PGLRSRIRAPANCREAS902p.G905Rc.2713G>CMissense_Mutation10.11PK1N000N
CARD10QPATPGLRSPANCREAS898p.G905Rc.2713G>CMissense_Mutation10.11PK1N300N
CARD10RSRIRAIQEPANCREAS905p.G905Rc.2713G>CMissense_Mutation10.11PK1N100N
CARD10TPGLRSRIRPANCREAS901p.G905Rc.2713G>CMissense_Mutation10.11PK1Y390N
CDH1AAGVCRKPQPANCREAS691p.A698Pc.2092G>CMissense_Mutation10.11KP4N000N
CDH1AGVCRKPQPPANCREAS692p.A698Pc.2092G>CMissense_Mutation10.11KP4N000N
CDH1CRKPQPVEAPANCREAS695p.A698Pc.2092G>CMissense_Mutation10.11KP4Y2100N
CDH1GAAGVCRKPPANCREAS690p.A698Pc.2092G>CMissense_Mutation10.11KP4N000N
CDH1GVCRKPQPVPANCREAS693p.A698Pc.2092G>CMissense_Mutation10.11KP4N500N
CDH1KPQPVEAGLPANCREAS697p.A698Pc.2092G>CMissense_Mutation10.11KP4Y19110N
CDH1PQPVEAGLQPANCREAS698p.A698Pc.2092G>CMissense_Mutation10.11KP4N000N
CDH1RKPQPVEAGPANCREAS696p.A698Pc.2092G>CMissense_Mutation10.11KP4N000N
CDH1VCRKPQPVEPANCREAS694p.A698Pc.2092G>CMissense_Mutation10.11KP4N003N
CHD1DQRSYGSRSPANCREAS1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86BXPC3N100N
CHD1DQRSYGSRSPANCREAS1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86CAPAN1N100N
CHD1DQRSYGSRSPANCREAS1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86L33N100N
CHD1DQRSYGSRSPANCREAS1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86PANC0203N100N
CHD1DQRSYGSRSPANCREAS1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86PANC0327N100N
CHD1DQRSYGSRSPANCREAS1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86PANC1005N100N
CHD1DQRSYGSRSPANCREAS1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SW1990N100N
CHD1LDQRSYGSRPANCREAS1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86BXPC3N000N
CHD1LDQRSYGSRPANCREAS1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86CAPAN1N000N
CHD1LDQRSYGSRPANCREAS1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86L33N000N
CHD1LDQRSYGSRPANCREAS1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86PANC0203N000N
CHD1LDQRSYGSRPANCREAS1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86PANC0327N000N
CHD1LDQRSYGSRPANCREAS1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86PANC1005N000N
CHD1LDQRSYGSRPANCREAS1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SW1990N000N
CHD1PLDQRSYGSPANCREAS1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86BXPC3N000N
CHD1PLDQRSYGSPANCREAS1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86CAPAN1N000N
CHD1PLDQRSYGSPANCREAS1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86L33N000N
CHD1PLDQRSYGSPANCREAS1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86PANC0203N000N
CHD1PLDQRSYGSPANCREAS1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86PANC0327N000N
CHD1PLDQRSYGSPANCREAS1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86PANC1005N000N
CHD1PLDQRSYGSPANCREAS1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SW1990N000N
CHD1QRSYGSRSPPANCREAS1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86BXPC3N000N
CHD1QRSYGSRSPPANCREAS1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86CAPAN1N000N
CHD1QRSYGSRSPPANCREAS1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86L33N000N
CHD1QRSYGSRSPPANCREAS1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86PANC0203N000N
CHD1QRSYGSRSPPANCREAS1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86PANC0327N000N
CHD1QRSYGSRSPPANCREAS1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86PANC1005N000N
CHD1QRSYGSRSPPANCREAS1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SW1990N000N
CHD1RSPLDQRSYPANCREAS1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86BXPC3N600N
CHD1RSPLDQRSYPANCREAS1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86CAPAN1N600N
CHD1RSPLDQRSYPANCREAS1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86L33N600N
CHD1RSPLDQRSYPANCREAS1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86PANC0203N600N
CHD1RSPLDQRSYPANCREAS1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86PANC0327N600N
CHD1RSPLDQRSYPANCREAS1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86PANC1005N600N
CHD1RSPLDQRSYPANCREAS1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SW1990N600N
CHD1RSYGSRSPFPANCREAS1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86BXPC3N900N
CHD1RSYGSRSPFPANCREAS1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86CAPAN1N900N
CHD1RSYGSRSPFPANCREAS1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86L33N900N
CHD1RSYGSRSPFPANCREAS1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86PANC0203N900N
CHD1RSYGSRSPFPANCREAS1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86PANC0327N900N
CHD1RSYGSRSPFPANCREAS1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86PANC1005N900N
CHD1RSYGSRSPFPANCREAS1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SW1990N900N
CHD1SPLDQRSYGPANCREAS1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86BXPC3N000N
CHD1SPLDQRSYGPANCREAS1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86CAPAN1N000N
CHD1SPLDQRSYGPANCREAS1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86L33N000N
CHD1SPLDQRSYGPANCREAS1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86PANC0203N000N
CHD1SPLDQRSYGPANCREAS1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86PANC0327N000N
CHD1SPLDQRSYGPANCREAS1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86PANC1005N000N
CHD1SPLDQRSYGPANCREAS1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SW1990N000N
CHD1SYGSRSPFEPANCREAS1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86BXPC3N000N
CHD1SYGSRSPFEPANCREAS1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86CAPAN1N000N
CHD1SYGSRSPFEPANCREAS1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86L33N000N
CHD1SYGSRSPFEPANCREAS1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86PANC0203N000N
CHD1SYGSRSPFEPANCREAS1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86PANC0327N000N
CHD1SYGSRSPFEPANCREAS1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86PANC1005N000N
CHD1SYGSRSPFEPANCREAS1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SW1990N000N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47BXPC3N801N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47CAPAN1N801N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47CAPAN2N801N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47HUPT4N801N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47KP3N801N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47KP4N801N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47L33N801N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47PANC0203N801N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47PANC0213N801N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47PANC0403N801N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47PATU8902N801N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47PK1N801N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47PK45HN801N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47PK59N801N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47PSN1N801N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47QGP1N801N
CREB3L2FTHITSDSFPANCREAS95p.T100delc.299_301delCCAIn_Frame_Del444.47YAPCN801N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47BXPC3N000N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47CAPAN1N000N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47CAPAN2N000N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47HUPT4N000N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47KP3N000N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47KP4N000N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47L33N000N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47PANC0203N000N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47PANC0213N000N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47PANC0403N000N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47PATU8902N000N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47PK1N000N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47PK45HN000N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47PK59N000N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47PSN1N000N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47QGP1N000N
CREB3L2HITSDSFNDPANCREAS97p.T100delc.299_301delCCAIn_Frame_Del244.47YAPCN000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47BXPC3N000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47CAPAN1N000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47CAPAN2N000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47HUPT4N000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47KP3N000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47KP4N000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47L33N000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47PANC0203N000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47PANC0213N000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47PANC0403N000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47PATU8902N000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47PK1N000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47PK45HN000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47PK59N000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47PSN1N000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47QGP1N000N
CREB3L2ITSDSFNDDPANCREAS98p.T100delc.299_301delCCAIn_Frame_Del144.47YAPCN000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47BXPC3N000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47CAPAN1N000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47CAPAN2N000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47HUPT4N000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47KP3N000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47KP4N000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47L33N000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47PANC0203N000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47PANC0213N000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47PANC0403N000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47PATU8902N000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47PK1N000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47PK45HN000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47PK59N000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47PSN1N000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47QGP1N000N
CREB3L2PFTHITSDSPANCREAS94p.T100delc.299_301delCCAIn_Frame_Del344.47YAPCN000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47BXPC3N000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47CAPAN1N000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47CAPAN2N000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47HUPT4N000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47KP3N000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47KP4N000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47L33N000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47PANC0203N000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47PANC0213N000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47PANC0403N000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47PATU8902N000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47PK1N000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47PK45HN000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47PK59N000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47PSN1N000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47QGP1N000N
CREB3L2QSPFTHITSPANCREAS92p.T100delc.299_301delCCAIn_Frame_Del144.47YAPCN000N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47BXPC3N100N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47CAPAN1N100N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47CAPAN2N100N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47HUPT4N100N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47KP3N100N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47KP4N100N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47L33N100N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47PANC0203N100N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47PANC0213N100N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47PANC0403N100N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47PATU8902N100N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47PK1N100N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47PK45HN100N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47PK59N100N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47PSN1N100N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47QGP1N100N
CREB3L2SPFTHITSDPANCREAS93p.T100delc.299_301delCCAIn_Frame_Del244.47YAPCN100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47BXPC3N100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47CAPAN1N100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47CAPAN2N100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47HUPT4N100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47KP3N100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47KP4N100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47L33N100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47PANC0203N100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47PANC0213N100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47PANC0403N100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47PATU8902N100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47PK1N100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47PK45HN100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47PK59N100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47PSN1N100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47QGP1N100N
CREB3L2THITSDSFNPANCREAS96p.T100delc.299_301delCCAIn_Frame_Del344.47YAPCN100N
CREB3L2DEPPPGHVPPANCREAS132p.L138Hc.413T>AMissense_Mutation10.11T3M4N200Y
CREB3L2EPPPGHVPSPANCREAS133p.L138Hc.413T>AMissense_Mutation10.11T3M4N400Y
CREB3L2GHVPSVTLTPANCREAS137p.L138Hc.413T>AMissense_Mutation10.11T3M4N200N
CREB3L2HVPSVTLTIPANCREAS138p.L138Hc.413T>AMissense_Mutation10.11T3M4Y790N
CREB3L2PGHVPSVTLPANCREAS136p.L138Hc.413T>AMissense_Mutation10.11T3M4N100N
CREB3L2PPGHVPSVTPANCREAS135p.L138Hc.413T>AMissense_Mutation10.11T3M4N000N
CREB3L2PPPGHVPSVPANCREAS134p.L138Hc.413T>AMissense_Mutation10.11T3M4N800N
CREB3L2TDEPPPGHVPANCREAS131p.L138Hc.413T>AMissense_Mutation10.11T3M4N300N
CREB3L2VTDEPPPGHPANCREAS130p.L138Hc.413T>AMissense_Mutation10.11T3M4N100N
CTBP2APSPNQPTNPANCREAS966p.K974fsc.2922_2922delAFrame_Shift_Del124.34HUPT3N300N
CTBP2APSPNQPTNPANCREAS966p.K974fsc.2922_2922delAFrame_Shift_Del124.34KP4N300N
CTBP2APSPNQPTNPANCREAS966p.K974fsc.2922_2922delAFrame_Shift_Del124.34PANC0213N300N
CTBP2APSPNQPTNPANCREAS966p.K974fsc.2922_2922delAFrame_Shift_Del124.34T3M4N300N
CTBP2GTIESTPTSPANCREAS976p.K974fsc.2922_2922delAFrame_Shift_Del524.34HUPT3N100N
CTBP2GTIESTPTSPANCREAS976p.K974fsc.2922_2922delAFrame_Shift_Del524.34KP4N100N
CTBP2GTIESTPTSPANCREAS976p.K974fsc.2922_2922delAFrame_Shift_Del524.34PANC0213N100N
CTBP2GTIESTPTSPANCREAS976p.K974fsc.2922_2922delAFrame_Shift_Del524.34T3M4N100N
CTBP2NQPTNTGTIPANCREAS970p.K974fsc.2922_2922delAFrame_Shift_Del424.34HUPT3N1000N
CTBP2NQPTNTGTIPANCREAS970p.K974fsc.2922_2922delAFrame_Shift_Del424.34KP4N1000N
CTBP2NQPTNTGTIPANCREAS970p.K974fsc.2922_2922delAFrame_Shift_Del424.34PANC0213N1000N
CTBP2NQPTNTGTIPANCREAS970p.K974fsc.2922_2922delAFrame_Shift_Del424.34T3M4N1000N
CTBP2NTGTIESTPPANCREAS974p.K974fsc.2922_2922delAFrame_Shift_Del524.34HUPT3N000N
CTBP2NTGTIESTPPANCREAS974p.K974fsc.2922_2922delAFrame_Shift_Del524.34KP4N000N
CTBP2NTGTIESTPPANCREAS974p.K974fsc.2922_2922delAFrame_Shift_Del524.34PANC0213N000N
CTBP2NTGTIESTPPANCREAS974p.K974fsc.2922_2922delAFrame_Shift_Del524.34T3M4N000N
CTBP2PNQPTNTGTPANCREAS969p.K974fsc.2922_2922delAFrame_Shift_Del324.34HUPT3N000N
CTBP2PNQPTNTGTPANCREAS969p.K974fsc.2922_2922delAFrame_Shift_Del324.34KP4N000N
CTBP2PNQPTNTGTPANCREAS969p.K974fsc.2922_2922delAFrame_Shift_Del324.34PANC0213N000N
CTBP2PNQPTNTGTPANCREAS969p.K974fsc.2922_2922delAFrame_Shift_Del324.34T3M4N000N
CTBP2PSPNQPTNTPANCREAS967p.K974fsc.2922_2922delAFrame_Shift_Del224.34HUPT3N000N
CTBP2PSPNQPTNTPANCREAS967p.K974fsc.2922_2922delAFrame_Shift_Del224.34KP4N000N
CTBP2PSPNQPTNTPANCREAS967p.K974fsc.2922_2922delAFrame_Shift_Del224.34PANC0213N000N
CTBP2PSPNQPTNTPANCREAS967p.K974fsc.2922_2922delAFrame_Shift_Del224.34T3M4N000N
CTBP2PTNTGTIESPANCREAS972p.K974fsc.2922_2922delAFrame_Shift_Del524.34HUPT3N000N
CTBP2PTNTGTIESPANCREAS972p.K974fsc.2922_2922delAFrame_Shift_Del524.34KP4N000N
CTBP2PTNTGTIESPANCREAS972p.K974fsc.2922_2922delAFrame_Shift_Del524.34PANC0213N000N
CTBP2PTNTGTIESPANCREAS972p.K974fsc.2922_2922delAFrame_Shift_Del524.34T3M4N000N
CTBP2QPTNTGTIEPANCREAS971p.K974fsc.2922_2922delAFrame_Shift_Del524.34HUPT3N000N
CTBP2QPTNTGTIEPANCREAS971p.K974fsc.2922_2922delAFrame_Shift_Del524.34KP4N000N
CTBP2QPTNTGTIEPANCREAS971p.K974fsc.2922_2922delAFrame_Shift_Del524.34PANC0213N000N
CTBP2QPTNTGTIEPANCREAS971p.K974fsc.2922_2922delAFrame_Shift_Del524.34T3M4N000N
CTBP2SPNQPTNTGPANCREAS968p.K974fsc.2922_2922delAFrame_Shift_Del224.34HUPT3N000N
CTBP2SPNQPTNTGPANCREAS968p.K974fsc.2922_2922delAFrame_Shift_Del224.34KP4N000N
CTBP2SPNQPTNTGPANCREAS968p.K974fsc.2922_2922delAFrame_Shift_Del224.34PANC0213N000N
CTBP2SPNQPTNTGPANCREAS968p.K974fsc.2922_2922delAFrame_Shift_Del224.34T3M4N000N
CTBP2TGTIESTPTPANCREAS975p.K974fsc.2922_2922delAFrame_Shift_Del524.34HUPT3N000N
CTBP2TGTIESTPTPANCREAS975p.K974fsc.2922_2922delAFrame_Shift_Del524.34KP4N000N
CTBP2TGTIESTPTPANCREAS975p.K974fsc.2922_2922delAFrame_Shift_Del524.34PANC0213N000N
CTBP2TGTIESTPTPANCREAS975p.K974fsc.2922_2922delAFrame_Shift_Del524.34T3M4N000N
CTBP2TIESTPTSNPANCREAS977p.K974fsc.2922_2922delAFrame_Shift_Del524.34HUPT3N100N
CTBP2TIESTPTSNPANCREAS977p.K974fsc.2922_2922delAFrame_Shift_Del524.34KP4N100N
CTBP2TIESTPTSNPANCREAS977p.K974fsc.2922_2922delAFrame_Shift_Del524.34PANC0213N100N
CTBP2TIESTPTSNPANCREAS977p.K974fsc.2922_2922delAFrame_Shift_Del524.34T3M4N100N
CTBP2TNTGTIESTPANCREAS973p.K974fsc.2922_2922delAFrame_Shift_Del524.34HUPT3N000N
CTBP2TNTGTIESTPANCREAS973p.K974fsc.2922_2922delAFrame_Shift_Del524.34KP4N000N
CTBP2TNTGTIESTPANCREAS973p.K974fsc.2922_2922delAFrame_Shift_Del524.34PANC0213N000N
CTBP2TNTGTIESTPANCREAS973p.K974fsc.2922_2922delAFrame_Shift_Del524.34T3M4N000N
EGFRAHCAQKGSHPANCREAS1155p.W1157Cc.3471G>CMissense_Mutation10.22PK59N000N
EGFRCAQKGSHQIPANCREAS1157p.W1157Cc.3471G>CMissense_Mutation10.22PK59N600N
EGFRDSPAHCAQKPANCREAS1152p.W1157Cc.3471G>CMissense_Mutation10.22PK59N300N
EGFRFDSPAHCAQPANCREAS1151p.W1157Cc.3471G>CMissense_Mutation10.22PK59N100N
EGFRHCAQKGSHQPANCREAS1156p.W1157Cc.3471G>CMissense_Mutation10.22PK59N000N
EGFRPAHCAQKGSPANCREAS1154p.W1157Cc.3471G>CMissense_Mutation10.22PK59N000N
EGFRSPAHCAQKGPANCREAS1153p.W1157Cc.3471G>CMissense_Mutation10.22PK59N000N
EGFRSTFDSPAHCPANCREAS1149p.W1157Cc.3471G>CMissense_Mutation10.22PK59Y190N
EGFRTFDSPAHCAPANCREAS1150p.W1157Cc.3471G>CMissense_Mutation10.22PK59N100N
FBXW7CCMHLHEKRPANCREAS465p.R465Cc.1393C>TMissense_Mutation10.77ASPC1N400N
FBXW7GHTSTVCCMPANCREAS459p.R465Cc.1393C>TMissense_Mutation10.77ASPC1Y290N
FBXW7HTSTVCCMHPANCREAS460p.R465Cc.1393C>TMissense_Mutation10.77ASPC1N000N
FBXW7LYGHTSTVCPANCREAS457p.R465Cc.1393C>TMissense_Mutation10.77ASPC1N203N
FBXW7STVCCMHLHPANCREAS462p.R465Cc.1393C>TMissense_Mutation10.77ASPC1N000N
FBXW7TSTVCCMHLPANCREAS461p.R465Cc.1393C>TMissense_Mutation10.77ASPC1Y790N
FBXW7TVCCMHLHEPANCREAS463p.R465Cc.1393C>TMissense_Mutation10.77ASPC1N000N
FBXW7VCCMHLHEKPANCREAS464p.R465Cc.1393C>TMissense_Mutation10.77ASPC1N102N
FBXW7YGHTSTVCCPANCREAS458p.R465Cc.1393C>TMissense_Mutation10.77ASPC1N404N
FGFR2CLPQYTHINPANCREAS809p.P814Tc.2440C>AMissense_Mutation10.11PSN1N200N
FGFR2EPCLPQYTHPANCREAS807p.P814Tc.2440C>AMissense_Mutation10.11PSN1N000N
FGFR2LPQYTHINGPANCREAS810p.P814Tc.2440C>AMissense_Mutation10.11PSN1N200N
FGFR2PCLPQYTHIPANCREAS808p.P814Tc.2440C>AMissense_Mutation10.11PSN1N100N
FGFR2PQYTHINGSPANCREAS811p.P814Tc.2440C>AMissense_Mutation10.11PSN1N000N
FGFR2QYTHINGSVPANCREAS812p.P814Tc.2440C>AMissense_Mutation10.11PSN1N300N
FGFR2THINGSVKTPANCREAS814p.P814Tc.2440C>AMissense_Mutation10.11PSN1N100N
FGFR2YEPCLPQYTPANCREAS806p.P814Tc.2440C>AMissense_Mutation10.11PSN1N801N
FGFR2YTHINGSVKPANCREAS813p.P814Tc.2440C>AMissense_Mutation10.11PSN1N302N
FLT3CSSSKHLSQPANCREAS330p.P336Lc.1007C>TMissense_Mutation10.22KP3N000N
FLT3HLSQSALVTPANCREAS335p.P336Lc.1007C>TMissense_Mutation10.22KP3N100N
FLT3KHLSQSALVPANCREAS334p.P336Lc.1007C>TMissense_Mutation10.22KP3N400N
FLT3LSQSALVTIPANCREAS336p.P336Lc.1007C>TMissense_Mutation10.22KP3N702N
FLT3SKHLSQSALPANCREAS333p.P336Lc.1007C>TMissense_Mutation10.22KP3N400N
FLT3SSKHLSQSAPANCREAS332p.P336Lc.1007C>TMissense_Mutation10.22KP3N100N
FLT3SSSKHLSQSPANCREAS331p.P336Lc.1007C>TMissense_Mutation10.22KP3N100N
FLT3TCSSSKHLSPANCREAS329p.P336Lc.1007C>TMissense_Mutation10.22KP3N000N
FLT3YTCSSSKHLPANCREAS328p.P336Lc.1007C>TMissense_Mutation10.22KP3N902N
FMN2LPPLPGAAIPANCREAS934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03CAPAN1N1401N
FMN2LPPLPGAAIPANCREAS934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03HS766TN1401N
FMN2LPPLPGAAIPANCREAS934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03HUPT4N1401N
FMN2LPPLPGAAIPANCREAS934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03PANC0203N1401N
FMN2LPPLPGAAIPANCREAS934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03PANC0213N1401N
FMN2LPPLPGAAIPANCREAS934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03PANC0327N1401N
FMN2LPPLPGAAIPANCREAS934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03PANC0403N1401N
FMN2LPPLPGAAIPANCREAS934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03PANC0813N1401N
FMN2LPPLPGAAIPANCREAS934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03PK59N1401N
FMN2PLPPLPGAAPANCREAS933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03CAPAN1N000N
FMN2PLPPLPGAAPANCREAS933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03HS766TN000N
FMN2PLPPLPGAAPANCREAS933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03HUPT4N000N
FMN2PLPPLPGAAPANCREAS933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03PANC0203N000N
FMN2PLPPLPGAAPANCREAS933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03PANC0213N000N
FMN2PLPPLPGAAPANCREAS933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03PANC0327N000N
FMN2PLPPLPGAAPANCREAS933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03PANC0403N000N
FMN2PLPPLPGAAPANCREAS933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03PANC0813N000N
FMN2PLPPLPGAAPANCREAS933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03PK59N000N
GPR112ALTITTFCVPANCREAS1369p.T1374fsc.4122_4122delTFrame_Shift_Del20.11ASPC1Y690N
GPR112ARVPFQHILPANCREAS1382p.T1374fsc.4122_4122delTFrame_Shift_Del50.11ASPC1Y990N
GPR112CVLKRKARVPANCREAS1376p.T1374fsc.4122_4122delTFrame_Shift_Del50.11ASPC1Y7100N
GPR112FCVLKRKARPANCREAS1375p.T1374fsc.4122_4122delTFrame_Shift_Del50.11ASPC1N508N
GPR112FQHILPGLWPANCREAS1386p.T1374fsc.4122_4122delTFrame_Shift_Del50.11ASPC1N605N
GPR112ITTFCVLKRPANCREAS1372p.T1374fsc.4122_4122delTFrame_Shift_Del50.11ASPC1Y799N
GPR112KARVPFQHIPANCREAS1381p.T1374fsc.4122_4122delTFrame_Shift_Del60.11ASPC1Y8100N
GPR112KRKARVPFQPANCREAS1379p.T1374fsc.4122_4122delTFrame_Shift_Del60.11ASPC1N200N
GPR112LKRKARVPFPANCREAS1378p.T1374fsc.4122_4122delTFrame_Shift_Del50.11ASPC1N3017N
GPR112LTITTFCVLPANCREAS1370p.T1374fsc.4122_4122delTFrame_Shift_Del30.11ASPC1N1602N
GPR112PFQHILPGLPANCREAS1385p.T1374fsc.4122_4122delTFrame_Shift_Del50.11ASPC1N200N
GPR112QALTITTFCPANCREAS1368p.T1374fsc.4122_4122delTFrame_Shift_Del10.11ASPC1N400N
GPR112QHILPGLWKPANCREAS1387p.T1374fsc.4122_4122delTFrame_Shift_Del40.11ASPC1N000N
GPR112RKARVPFQHPANCREAS1380p.T1374fsc.4122_4122delTFrame_Shift_Del60.11ASPC1N100N
GPR112RVPFQHILPPANCREAS1383p.T1374fsc.4122_4122delTFrame_Shift_Del50.11ASPC1N000N
GPR112TFCVLKRKAPANCREAS1374p.T1374fsc.4122_4122delTFrame_Shift_Del50.11ASPC1N100N
GPR112TITTFCVLKPANCREAS1371p.T1374fsc.4122_4122delTFrame_Shift_Del40.11ASPC1N200N
GPR112TTFCVLKRKPANCREAS1373p.T1374fsc.4122_4122delTFrame_Shift_Del50.11ASPC1Y3150N
GPR112VLKRKARVPPANCREAS1377p.T1374fsc.4122_4122delTFrame_Shift_Del50.11ASPC1N101N
GPR112VPFQHILPGPANCREAS1384p.T1374fsc.4122_4122delTFrame_Shift_Del50.11ASPC1N400N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7ASPC1N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7BXPC3N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7CAPAN1N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7CFPAC1N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7DANGN000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HPAFIIN000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HUPT3N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HUPT4N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KP2N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KP3N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KP4N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7L33N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7PANC0403N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7PANC0813N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7PANC1005N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7PK1N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7PK45HN000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7PK59N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7PSN1N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7QGP1N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU213N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU324N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SW1990N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7T3M4N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TCCPAN2N000N
GPR112ASISDMFIQPANCREAS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7YAPCN000N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7ASPC1Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7BXPC3Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7CAPAN1Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7CFPAC1Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7DANGY11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HPAFIIY11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HUPT3Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HUPT4Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KP2Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KP3Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KP4Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7L33Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7PANC0403Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7PANC0813Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7PANC1005Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7PK1Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7PK45HY11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7PK59Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7PSN1Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7QGP1Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU213Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU324Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SW1990Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7T3M4Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TCCPAN2Y11100N
GPR112ISDMFIQNLPANCREAS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7YAPCY11100N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7ASPC1N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7BXPC3N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7CAPAN1N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7CFPAC1N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7DANGN700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HPAFIIN700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HUPT3N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HUPT4N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KP2N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KP3N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KP4N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7L33N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7PANC0403N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7PANC0813N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7PANC1005N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7PK1N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7PK45HN700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7PK59N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7PSN1N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7QGP1N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU213N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU324N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SW1990N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7T3M4N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TCCPAN2N700N
GPR112SASISDMFIPANCREAS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7YAPCN700N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7ASPC1N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7BXPC3N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7CAPAN1N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7CFPAC1N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7DANGN400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HPAFIIN400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HUPT3N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HUPT4N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KP2N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KP3N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KP4N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7L33N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7PANC0403N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7PANC0813N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7PANC1005N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7PK1N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7PK45HN400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7PK59N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7PSN1N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7QGP1N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU213N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU324N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SW1990N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7T3M4N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TCCPAN2N400N
GPR112SDMFIQNLAPANCREAS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7YAPCN400N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7ASPC1N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7BXPC3N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7CAPAN1N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7CFPAC1N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7DANGN000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HPAFIIN000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HUPT3N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HUPT4N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KP2N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KP3N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KP4N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7L33N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7PANC0403N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7PANC0813N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7PANC1005N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7PK1N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7PK45HN000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7PK59N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7PSN1N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7QGP1N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU213N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU324N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SW1990N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7T3M4N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TCCPAN2N000N
GPR112SISDMFIQNPANCREAS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7YAPCN000N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7ASPC1N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7BXPC3N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7CAPAN1N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7CFPAC1N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7DANGN900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HPAFIIN900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HUPT3N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HUPT4N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KP2N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KP3N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KP4N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7L33N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7PANC0403N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7PANC0813N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7PANC1005N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7PK1N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7PK45HN900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7PK59N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7PSN1N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7QGP1N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU213N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU324N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SW1990N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7T3M4N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TCCPAN2N900N
GPR112VSASISDMFPANCREAS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7YAPCN900N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7ASPC1N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7BXPC3N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7CAPAN1N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7CFPAC1N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7DANGN5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HPAFIIN5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HUPT3N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HUPT4N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KP2N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KP3N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KP4N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7L33N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7PANC0403N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7PANC0813N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7PANC1005N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7PK1N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7PK45HN5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7PK59N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7PSN1N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7QGP1N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU213N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU324N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SW1990N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7T3M4N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TCCPAN2N5020N
GPR112VVSASISDMPANCREAS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7YAPCN5020N
HSP90B1DEEETAKESPANCREAS787p.E791delc.2362_2364delGAAIn_Frame_Del121.79ASPC1N300N
HSP90B1DEEETAKESPANCREAS787p.E791delc.2362_2364delGAAIn_Frame_Del121.79KP4N300N
HSP90B1DEEETAKESPANCREAS787p.E791delc.2362_2364delGAAIn_Frame_Del121.79PANC0403N300N
HSP90B1DEEETAKESPANCREAS787p.E791delc.2362_2364delGAAIn_Frame_Del121.79PATU8902N300N
HSP90B1DEEETAKESPANCREAS787p.E791delc.2362_2364delGAAIn_Frame_Del121.79PK1N300N
HSP90B1DEEETAKESPANCREAS787p.E791delc.2362_2364delGAAIn_Frame_Del121.79TCCPAN2N300N
HSP90B1DEEETAKESPANCREAS787p.E791delc.2362_2364delGAAIn_Frame_Del121.79YAPCN300N
HSP90B1DVGTDEEETPANCREAS783p.E791delc.2362_2364delGAAIn_Frame_Del121.79ASPC1N200N
HSP90B1DVGTDEEETPANCREAS783p.E791delc.2362_2364delGAAIn_Frame_Del121.79KP4N200N
HSP90B1DVGTDEEETPANCREAS783p.E791delc.2362_2364delGAAIn_Frame_Del121.79PANC0403N200N
HSP90B1DVGTDEEETPANCREAS783p.E791delc.2362_2364delGAAIn_Frame_Del121.79PATU8902N200N
HSP90B1DVGTDEEETPANCREAS783p.E791delc.2362_2364delGAAIn_Frame_Del121.79PK1N200N
HSP90B1DVGTDEEETPANCREAS783p.E791delc.2362_2364delGAAIn_Frame_Del121.79TCCPAN2N200N
HSP90B1DVGTDEEETPANCREAS783p.E791delc.2362_2364delGAAIn_Frame_Del121.79YAPCN200N
HSP90B1GTDEEETAKPANCREAS785p.E791delc.2362_2364delGAAIn_Frame_Del321.79ASPC1N400N
HSP90B1GTDEEETAKPANCREAS785p.E791delc.2362_2364delGAAIn_Frame_Del321.79KP4N400N
HSP90B1GTDEEETAKPANCREAS785p.E791delc.2362_2364delGAAIn_Frame_Del321.79PANC0403N400N
HSP90B1GTDEEETAKPANCREAS785p.E791delc.2362_2364delGAAIn_Frame_Del321.79PATU8902N400N
HSP90B1GTDEEETAKPANCREAS785p.E791delc.2362_2364delGAAIn_Frame_Del321.79PK1N400N
HSP90B1GTDEEETAKPANCREAS785p.E791delc.2362_2364delGAAIn_Frame_Del321.79TCCPAN2N400N
HSP90B1GTDEEETAKPANCREAS785p.E791delc.2362_2364delGAAIn_Frame_Del321.79YAPCN400N
HSP90B1TDEEETAKEPANCREAS786p.E791delc.2362_2364delGAAIn_Frame_Del221.79ASPC1N000N
HSP90B1TDEEETAKEPANCREAS786p.E791delc.2362_2364delGAAIn_Frame_Del221.79KP4N000N
HSP90B1TDEEETAKEPANCREAS786p.E791delc.2362_2364delGAAIn_Frame_Del221.79PANC0403N000N
HSP90B1TDEEETAKEPANCREAS786p.E791delc.2362_2364delGAAIn_Frame_Del221.79PATU8902N000N
HSP90B1TDEEETAKEPANCREAS786p.E791delc.2362_2364delGAAIn_Frame_Del221.79PK1N000N
HSP90B1TDEEETAKEPANCREAS786p.E791delc.2362_2364delGAAIn_Frame_Del221.79TCCPAN2N000N
HSP90B1TDEEETAKEPANCREAS786p.E791delc.2362_2364delGAAIn_Frame_Del221.79YAPCN000N
HSP90B1VGTDEEETAPANCREAS784p.E791delc.2362_2364delGAAIn_Frame_Del221.79ASPC1N100N
HSP90B1VGTDEEETAPANCREAS784p.E791delc.2362_2364delGAAIn_Frame_Del221.79KP4N100N
HSP90B1VGTDEEETAPANCREAS784p.E791delc.2362_2364delGAAIn_Frame_Del221.79PANC0403N100N
HSP90B1VGTDEEETAPANCREAS784p.E791delc.2362_2364delGAAIn_Frame_Del221.79PATU8902N100N
HSP90B1VGTDEEETAPANCREAS784p.E791delc.2362_2364delGAAIn_Frame_Del221.79PK1N100N
HSP90B1VGTDEEETAPANCREAS784p.E791delc.2362_2364delGAAIn_Frame_Del221.79TCCPAN2N100N
HSP90B1VGTDEEETAPANCREAS784p.E791delc.2362_2364delGAAIn_Frame_Del221.79YAPCN100N
KITAFKVVPVVSPANCREAS207p.A210Vc.629C>TMissense_Mutation10.11SNU410N000N
KITFKVVPVVSVPANCREAS208p.A210Vc.629C>TMissense_Mutation10.11SNU410N7017N
KITKVRPAFKVVPANCREAS203p.A210Vc.629C>TMissense_Mutation10.11SNU410Y4100N
KITKVVPVVSVSPANCREAS209p.A210Vc.629C>TMissense_Mutation10.11SNU410N000N
KITLKVRPAFKVPANCREAS202p.A210Vc.629C>TMissense_Mutation10.11SNU410N4010N
KITPAFKVVPVVPANCREAS206p.A210Vc.629C>TMissense_Mutation10.11SNU410N600N
KITRPAFKVVPVPANCREAS205p.A210Vc.629C>TMissense_Mutation10.11SNU410Y13140N
KITVRPAFKVVPPANCREAS204p.A210Vc.629C>TMissense_Mutation10.11SNU410N1019N
KITVVPVVSVSKPANCREAS210p.A210Vc.629C>TMissense_Mutation10.11SNU410Y31513Y
KITALEVVDKGFPANCREAS304p.T304Ac.910A>GMissense_Mutation10.33T3M4N400N
KITANVTTALEVPANCREAS299p.T304Ac.910A>GMissense_Mutation10.33T3M4N100N
KITFGSANVTTAPANCREAS296p.T304Ac.910A>GMissense_Mutation10.33T3M4Y695N
KITGSANVTTALPANCREAS297p.T304Ac.910A>GMissense_Mutation10.33T3M4Y10120N
KITNVTTALEVVPANCREAS300p.T304Ac.910A>GMissense_Mutation10.33T3M4N200N
KITSANVTTALEPANCREAS298p.T304Ac.910A>GMissense_Mutation10.33T3M4N000N
KITTALEVVDKGPANCREAS303p.T304Ac.910A>GMissense_Mutation10.33T3M4N000N
KITTTALEVVDKPANCREAS302p.T304Ac.910A>GMissense_Mutation10.33T3M4N200N
KITVTTALEVVDPANCREAS301p.T304Ac.910A>GMissense_Mutation10.33T3M4N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44BXPC3N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44CAPAN1N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44CAPAN2N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44CFPAC1N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HPAFIIN000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HS766TN000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KP1NLN000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KP1NN000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KP3N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KP4N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44L33N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44MIAPACA2N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44PANC0213N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44PANC0327N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44PANC0403N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44PANC0813N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44PANC1005N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44PATU8902N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44PK1N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44PK45HN000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44PSN1N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44QGP1N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SNU410N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44TCCPAN2N000N
MAP3K1STTTTTTTEPANCREAS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44YAPCN000N
MAP3K1ASKGRHSPSPANCREAS244p.R249Hc.746G>AMissense_Mutation10.22PK45HN200N
MAP3K1ASPASKGRHPANCREAS241p.R249Hc.746G>AMissense_Mutation10.22PK45HN000N
MAP3K1GRHSPSPGNPANCREAS247p.R249Hc.746G>AMissense_Mutation10.22PK45HN200N
MAP3K1HSPSPGNSPPANCREAS249p.R249Hc.746G>AMissense_Mutation10.22PK45HN000N
MAP3K1KGRHSPSPGPANCREAS246p.R249Hc.746G>AMissense_Mutation10.22PK45HN100N
MAP3K1PASKGRHSPPANCREAS243p.R249Hc.746G>AMissense_Mutation10.22PK45HN000N
MAP3K1RHSPSPGNSPANCREAS248p.R249Hc.746G>AMissense_Mutation10.22PK45HN100N
MAP3K1SKGRHSPSPPANCREAS245p.R249Hc.746G>AMissense_Mutation10.22PK45HN000N
MAP3K1SPASKGRHSPANCREAS242p.R249Hc.746G>AMissense_Mutation10.22PK45HN300N
MAP3K4DPMWGSHYVPANCREAS575p.D581Hc.1741G>CMissense_Mutation10.11PK1Y1390N
MAP3K4FPDPMWGSHPANCREAS573p.D581Hc.1741G>CMissense_Mutation10.11PK1N400N
MAP3K4GSHYVQLSRPANCREAS579p.D581Hc.1741G>CMissense_Mutation10.11PK1N400N
MAP3K4HYVQLSRTPPANCREAS581p.D581Hc.1741G>CMissense_Mutation10.11PK1N000N
MAP3K4MWGSHYVQLPANCREAS577p.D581Hc.1741G>CMissense_Mutation10.11PK1N802N
MAP3K4PDPMWGSHYPANCREAS574p.D581Hc.1741G>CMissense_Mutation10.11PK1N100N
MAP3K4PMWGSHYVQPANCREAS576p.D581Hc.1741G>CMissense_Mutation10.11PK1N000N
MAP3K4SHYVQLSRTPANCREAS580p.D581Hc.1741G>CMissense_Mutation10.11PK1N200N
MAP3K4WGSHYVQLSPANCREAS578p.D581Hc.1741G>CMissense_Mutation10.11PK1N2018N
MEN1ASWDCRWHSPANCREAS523p.R521fsc.1561_1562insCFrame_Shift_Ins60.11T3M4N000N
MEN1AVSGPPPEAPANCREAS515p.R521fsc.1561_1562insCFrame_Shift_Ins30.11T3M4N000N
MEN1DCRWHSPRPPANCREAS526p.R521fsc.1561_1562insCFrame_Shift_Ins60.11T3M4N000N
MEN1EASWDCRWHPANCREAS522p.R521fsc.1561_1562insCFrame_Shift_Ins60.11T3M4N000N
MEN1GAVSGPPPEPANCREAS514p.R521fsc.1561_1562insCFrame_Shift_Ins20.11T3M4N000N
MEN1GPPPEASWDPANCREAS518p.R521fsc.1561_1562insCFrame_Shift_Ins50.11T3M4N000N
MEN1PEASWDCRWPANCREAS521p.R521fsc.1561_1562insCFrame_Shift_Ins60.11T3M4N200N
MEN1PPEASWDCRPANCREAS520p.R521fsc.1561_1562insCFrame_Shift_Ins60.11T3M4N000N
MEN1PPPEASWDCPANCREAS519p.R521fsc.1561_1562insCFrame_Shift_Ins50.11T3M4N000N
MEN1QGAVSGPPPPANCREAS513p.R521fsc.1561_1562insCFrame_Shift_Ins10.11T3M4N000N
MEN1SGPPPEASWPANCREAS517p.R521fsc.1561_1562insCFrame_Shift_Ins50.11T3M4N300N
MEN1SWDCRWHSPPANCREAS524p.R521fsc.1561_1562insCFrame_Shift_Ins60.11T3M4N000N
MEN1VSGPPPEASPANCREAS516p.R521fsc.1561_1562insCFrame_Shift_Ins40.11T3M4N000N
MEN1WDCRWHSPRPANCREAS525p.R521fsc.1561_1562insCFrame_Shift_Ins60.11T3M4N200N
METDHPWHSISVPANCREAS208p.L211Wc.632T>GMissense_Mutation10.33PK59N400N
METFPDHPWHSIPANCREAS206p.L211Wc.632T>GMissense_Mutation10.33PK59Y13110N
METHPWHSISVRPANCREAS209p.L211Wc.632T>GMissense_Mutation10.33PK59N700N
METPDHPWHSISPANCREAS207p.L211Wc.632T>GMissense_Mutation10.33PK59N000N
METPWHSISVRRPANCREAS210p.L211Wc.632T>GMissense_Mutation10.33PK59N000N
METSSYFPDHPWPANCREAS203p.L211Wc.632T>GMissense_Mutation10.33PK59N700N
METSYFPDHPWHPANCREAS204p.L211Wc.632T>GMissense_Mutation10.33PK59N000N
METWHSISVRRLPANCREAS211p.L211Wc.632T>GMissense_Mutation10.33PK59Y61016N
METYFPDHPWHSPANCREAS205p.L211Wc.632T>GMissense_Mutation10.33PK59N2012N
MLH1EIGREDKTLPANCREAS230p.C233Rc.697T>CMissense_Mutation10.11SNU324N300N
MLH1ELIEIGREDPANCREAS227p.C233Rc.697T>CMissense_Mutation10.11SNU324N000N
MLH1ESISLRKAIPANCREAS268p.T270Ic.809C>TMissense_Mutation10.11MIAPACA2N900N
MLH1GREDKTLAFPANCREAS232p.C233Rc.697T>CMissense_Mutation10.11SNU324Y3110Y
MLH1HRLVESISLPANCREAS264p.T270Ic.809C>TMissense_Mutation10.11MIAPACA2Y890N
MLH1IEIGREDKTPANCREAS229p.C233Rc.697T>CMissense_Mutation10.11SNU324N500N
MLH1IGREDKTLAPANCREAS231p.C233Rc.697T>CMissense_Mutation10.11SNU324N200N
MLH1INHRLVESIPANCREAS262p.T270Ic.809C>TMissense_Mutation10.11MIAPACA2Y4132N
MLH1ISLRKAIETPANCREAS270p.T270Ic.809C>TMissense_Mutation10.11MIAPACA2N100N
MLH1LIEIGREDKPANCREAS228p.C233Rc.697T>CMissense_Mutation10.11SNU324N300N
MLH1LVESISLRKPANCREAS266p.T270Ic.809C>TMissense_Mutation10.11MIAPACA2N502N
MLH1NHRLVESISPANCREAS263p.T270Ic.809C>TMissense_Mutation10.11MIAPACA2N000N
MLH1REDKTLAFKPANCREAS233p.C233Rc.697T>CMissense_Mutation10.11SNU324Y2120N
MLH1RELIEIGREPANCREAS226p.C233Rc.697T>CMissense_Mutation10.11SNU324N100N
MLH1RLVESISLRPANCREAS265p.T270Ic.809C>TMissense_Mutation10.11MIAPACA2Y790N
MLH1SISLRKAIEPANCREAS269p.T270Ic.809C>TMissense_Mutation10.11MIAPACA2N000N
MLH1SRELIEIGRPANCREAS225p.C233Rc.697T>CMissense_Mutation10.11SNU324N400N
MLH1VESISLRKAPANCREAS267p.T270Ic.809C>TMissense_Mutation10.11MIAPACA2N600N
MLL3CVSVEPKKRPANCREAS2789p.K2797fsc.8390_8390delAFrame_Shift_Del12.1SNU324N400N
MLL3EPKKRNKKTPANCREAS2793p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU324N600N
MLL3FSLINIHHRPANCREAS2805p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU324Y695N
MLL3HHRKNPLLPPANCREAS2811p.K2797fsc.8390_8390delAFrame_Shift_Del42.1SNU324N000Y
MLL3HRKNPLLPMPANCREAS2812p.K2797fsc.8390_8390delAFrame_Shift_Del42.1SNU324Y490N
MLL3IHHRKNPLLPANCREAS2810p.K2797fsc.8390_8390delAFrame_Shift_Del42.1SNU324N700Y
MLL3INIHHRKNPPANCREAS2808p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU324N0011Y
MLL3KKRNKKTKLPANCREAS2795p.K2797fsc.8390_8390delAFrame_Shift_Del42.1SNU324N500N
MLL3KKTKLWFSLPANCREAS2799p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU324N500N
MLL3KLWFSLINIPANCREAS2802p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU324Y12120N
MLL3KRNKKTKLWPANCREAS2796p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU324Y490N
MLL3KTKLWFSLIPANCREAS2800p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU324Y7120N
MLL3LINIHHRKNPANCREAS2807p.K2797fsc.8390_8390delAFrame_Shift_Del62.1SNU324N001N
MLL3LWFSLINIHPANCREAS2803p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU324N004N
MLL3NIHHRKNPLPANCREAS2809p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU324N800N
MLL3NKKTKLWFSPANCREAS2798p.K2797fsc.8390_8390delAFrame_Shift_Del42.1SNU324N100N
MLL3PKKRNKKTKPANCREAS2794p.K2797fsc.8390_8390delAFrame_Shift_Del42.1SNU324N100N
MLL3RKNPLLPMRPANCREAS2813p.K2797fsc.8390_8390delAFrame_Shift_Del42.1SNU324N100N
MLL3RNKKTKLWFPANCREAS2797p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU324Y5110N
MLL3SLINIHHRKPANCREAS2806p.K2797fsc.8390_8390delAFrame_Shift_Del62.1SNU324Y6130N
MLL3SVEPKKRNKPANCREAS2791p.K2797fsc.8390_8390delAFrame_Shift_Del32.1SNU324N300N
MLL3TKLWFSLINPANCREAS2801p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU324N100N
MLL3VEPKKRNKKPANCREAS2792p.K2797fsc.8390_8390delAFrame_Shift_Del42.1SNU324N106N
MLL3VSVEPKKRNPANCREAS2790p.K2797fsc.8390_8390delAFrame_Shift_Del22.1SNU324N100N
MLL3WFSLINIHHPANCREAS2804p.K2797fsc.8390_8390delAFrame_Shift_Del52.1SNU324N2015N
MLL3AAKRDSGNEPANCREAS3767p.G3770Rc.11308G>AMissense_Mutation10.11SNU410N000N
MLL3AGAPAAKRDPANCREAS3763p.G3770Rc.11308G>AMissense_Mutation10.11SNU410N000N
MLL3AIAKRKFSPPANCREAS829p.T831Ac.2491A>GMissense_Mutation10.11HS766TN000N
MLL3AKRDSGNELPANCREAS3768p.G3770Rc.11308G>AMissense_Mutation10.11SNU410Y4140N
MLL3AKRKFSPGRPANCREAS831p.T831Ac.2491A>GMissense_Mutation10.11HS766TN100Y
MLL3APAAKRDSGPANCREAS3765p.G3770Rc.11308G>AMissense_Mutation10.11SNU410N000N
MLL3EKDIDDNSNPANCREAS170p.K170Ec.508A>GMissense_Mutation10.11MIAPACA2N100N
MLL3GAPAAKRDSPANCREAS3764p.G3770Rc.11308G>AMissense_Mutation10.11SNU410N100N
MLL3GKPAIAKRKPANCREAS826p.T831Ac.2491A>GMissense_Mutation10.11HS766TN100N
MLL3GMGKPAIAKPANCREAS824p.T831Ac.2491A>GMissense_Mutation10.11HS766TN600N
MLL3IAKRKFSPGPANCREAS830p.T831Ac.2491A>GMissense_Mutation10.11HS766TN200N
MLL3IGMGKPAIAPANCREAS823p.T831Ac.2491A>GMissense_Mutation10.11HS766TN307N
MLL3KPAIAKRKFPANCREAS827p.T831Ac.2491A>GMissense_Mutation10.11HS766TN1100N
MLL3KRDSGNELLPANCREAS3769p.G3770Rc.11308G>AMissense_Mutation10.11SNU410Y790N
MLL3MGKPAIAKRPANCREAS825p.T831Ac.2491A>GMissense_Mutation10.11HS766TN100N
MLL3NEKDIDDNSPANCREAS169p.K170Ec.508A>GMissense_Mutation10.11MIAPACA2N400Y
MLL3NQPSNEKDIPANCREAS165p.K170Ec.508A>GMissense_Mutation10.11MIAPACA2Y7100Y
MLL3PAAKRDSGNPANCREAS3766p.G3770Rc.11308G>AMissense_Mutation10.11SNU410N000N
MLL3PAIAKRKFSPANCREAS828p.T831Ac.2491A>GMissense_Mutation10.11HS766TN000N
MLL3PSNEKDIDDPANCREAS167p.K170Ec.508A>GMissense_Mutation10.11MIAPACA2N000Y
MLL3PWRNQPSNEPANCREAS162p.K170Ec.508A>GMissense_Mutation10.11MIAPACA2N000N
MLL3QPSNEKDIDPANCREAS166p.K170Ec.508A>GMissense_Mutation10.11MIAPACA2N000Y
MLL3RDSGNELLKPANCREAS3770p.G3770Rc.11308G>AMissense_Mutation10.11SNU410N100N
MLL3RNQPSNEKDPANCREAS164p.K170Ec.508A>GMissense_Mutation10.11MIAPACA2N000N
MLL3SAGAPAAKRPANCREAS3762p.G3770Rc.11308G>AMissense_Mutation10.11SNU410N300N
MLL3SNEKDIDDNPANCREAS168p.K170Ec.508A>GMissense_Mutation10.11MIAPACA2N000Y
MLL3WRNQPSNEKPANCREAS163p.K170Ec.508A>GMissense_Mutation10.11MIAPACA2Y41121N
MSH2AQIGCSVPCPANCREAS689p.F694Sc.2081T>CMissense_Mutation10.11SNU324N200N
MSH2CSVPCESAEPANCREAS693p.F694Sc.2081T>CMissense_Mutation10.11SNU324N000N
MSH2GCSVPCESAPANCREAS692p.F694Sc.2081T>CMissense_Mutation10.11SNU324N100N
MSH2IGCSVPCESPANCREAS691p.F694Sc.2081T>CMissense_Mutation10.11SNU324N005N
MSH2LMAQIGCSVPANCREAS687p.F694Sc.2081T>CMissense_Mutation10.11SNU324N602N
MSH2MAQIGCSVPPANCREAS688p.F694Sc.2081T>CMissense_Mutation10.11SNU324N000N
MSH2QIGCSVPCEPANCREAS690p.F694Sc.2081T>CMissense_Mutation10.11SNU324N000N
MSH2SVPCESAEVPANCREAS694p.F694Sc.2081T>CMissense_Mutation10.11SNU324Y3110N
MSH2VLMAQIGCSPANCREAS686p.F694Sc.2081T>CMissense_Mutation10.11SNU324N0030N
MSH3ALWECSLPQPANCREAS389p.K381fsc.1141_1141delAFrame_Shift_Del62.65SNU324N000N
MSH3ARLCLIVSRPANCREAS398p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324Y390N
MSH3ATFLLALWEPANCREAS384p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324N000N
MSH3CLIVSRTLLPANCREAS401p.K381fsc.1141_1141delAFrame_Shift_Del62.65SNU324N1400N
MSH3CSLPQARLCPANCREAS393p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324N200N
MSH3DKKRATFLLPANCREAS380p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324N500N
MSH3ECSLPQARLPANCREAS392p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324Y490N
MSH3ENVRDKKRAPANCREAS376p.K381fsc.1141_1141delAFrame_Shift_Del22.65SNU324N100N
MSH3FLLALWECSPANCREAS386p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324N203N
MSH3IVSRTLLLVPANCREAS403p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324Y4927N
MSH3KENVRDKKRPANCREAS375p.K381fsc.1141_1141delAFrame_Shift_Del12.65SNU324Y090Y
MSH3KKRATFLLAPANCREAS381p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324N200N
MSH3KRATFLLALPANCREAS382p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324Y990N
MSH3LALWECSLPPANCREAS388p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324N000N
MSH3LCLIVSRTLPANCREAS400p.K381fsc.1141_1141delAFrame_Shift_Del62.65SNU324N1207N
MSH3LIVSRTLLLPANCREAS402p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324Y15924N
MSH3LLALWECSLPANCREAS387p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324N1000N
MSH3LPQARLCLIPANCREAS395p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324N1700N
MSH3LWECSLPQAPANCREAS390p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324N100N
MSH3NVRDKKRATPANCREAS377p.K381fsc.1141_1141delAFrame_Shift_Del32.65SNU324N200N
MSH3PQARLCLIVPANCREAS396p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324N200N
MSH3QARLCLIVSPANCREAS397p.K381fsc.1141_1141delAFrame_Shift_Del62.65SNU324N100N
MSH3RATFLLALWPANCREAS383p.K381fsc.1141_1141delAFrame_Shift_Del62.65SNU324N400N
MSH3RDKKRATFLPANCREAS379p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324Y7130N
MSH3RLCLIVSRTPANCREAS399p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324N400N
MSH3SLPQARLCLPANCREAS394p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324Y12100N
MSH3SRTLLLVQSPANCREAS405p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324N200N
MSH3TFLLALWECPANCREAS385p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324N100N
MSH3VRDKKRATFPANCREAS378p.K381fsc.1141_1141delAFrame_Shift_Del42.65SNU324Y4912N
MSH3VSRTLLLVQPANCREAS404p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324N003N
MSH3WECSLPQARPANCREAS391p.K381fsc.1141_1141delAFrame_Shift_Del52.65SNU324N202N
MSH3GAAAAAAPPPANCREAS50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94CFPAC1N000N
MSH3GAAAAAAPPPANCREAS50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94HS766TN000N
MSH3GAAAAAAPPPANCREAS50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94KP1NLN000N
MSH3GAAAAAAPPPANCREAS50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94KP1NN000N
MSH3GAAAAAAPPPANCREAS50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94KP2N000N
MSH3GAAAAAAPPPANCREAS50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94PANC0327N000N
MSH3GAAAAAAPPPANCREAS50p.AAAAAA52delc.154_171delGCAGCGGCTGCAGCGGCCIn_Frame_Del113.94SNU410N000N
MSH3PGAAAAAAPPANCREAS49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94CFPAC1N000N
MSH3PGAAAAAAPPANCREAS49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94HS766TN000N
MSH3PGAAAAAAPPANCREAS49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94KP1NLN000N
MSH3PGAAAAAAPPANCREAS49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94KP1NN000N
MSH3PGAAAAAAPPANCREAS49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94KP2N000N
MSH3PGAAAAAAPPANCREAS49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94PANC0327N000N
MSH3PGAAAAAAPPANCREAS49p.AAAAAA52delc.154_171delGCAGCGGCTGCAGCGGCCIn_Frame_Del113.94SNU410N000N
MSH3AAAAPPAPAPANCREAS53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23CFPAC1N200N
MSH3AAAAPPAPAPANCREAS59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23CFPAC1N200N
MSH3AAAAPPAPAPANCREAS59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HPAFIIN200N
MSH3AAAAPPAPAPANCREAS53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23HS766TN200N
MSH3AAAAPPAPAPANCREAS59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HS766TN200N
MSH3AAAAPPAPAPANCREAS53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23KP1NLN200N
MSH3AAAAPPAPAPANCREAS53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23KP1NN200N
MSH3AAAAPPAPAPANCREAS53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23KP2N200N
MSH3AAAAPPAPAPANCREAS59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23PANC0203N200N
MSH3AAAAPPAPAPANCREAS53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23PANC0327N200N
MSH3AAAAPPAPAPANCREAS59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23PANC0327N200N
MSH3AAAPPAPAFPANCREAS54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23CFPAC1Y8100N
MSH3AAAPPAPAFPANCREAS60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23CFPAC1Y8100N
MSH3AAAPPAPAFPANCREAS60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23HPAFIIY8100N
MSH3AAAPPAPAFPANCREAS54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23HS766TY8100N
MSH3AAAPPAPAFPANCREAS60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23HS766TY8100N
MSH3AAAPPAPAFPANCREAS54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23KP1NLY8100N
MSH3AAAPPAPAFPANCREAS54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23KP1NY8100N
MSH3AAAPPAPAFPANCREAS54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23KP2Y8100N
MSH3AAAPPAPAFPANCREAS60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23PANC0203Y8100N
MSH3AAAPPAPAFPANCREAS54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23PANC0327Y8100N
MSH3AAAPPAPAFPANCREAS60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23PANC0327Y8100N
MSH3AAPPAPAFPPANCREAS55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23CFPAC1N000N
MSH3AAPPAPAFPPANCREAS61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23CFPAC1N000N
MSH3AAPPAPAFPPANCREAS61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HPAFIIN000N
MSH3AAPPAPAFPPANCREAS55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23HS766TN000N
MSH3AAPPAPAFPPANCREAS61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HS766TN000N
MSH3AAPPAPAFPPANCREAS55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23KP1NLN000N
MSH3AAPPAPAFPPANCREAS55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23KP1NN000N
MSH3AAPPAPAFPPANCREAS55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23KP2N000N
MSH3AAPPAPAFPPANCREAS61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23PANC0203N000N
MSH3AAPPAPAFPPANCREAS55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23PANC0327N000N
MSH3AAPPAPAFPPANCREAS61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23PANC0327N000N
MSH3AAAAAAAPAPANCREAS56p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77QGP1N300N
MSH3AAAAAAAPAPANCREAS56p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77SNU213N300N
MSH3AAAAAAPAAPANCREAS57p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77QGP1N300N
MSH3AAAAAAPAAPANCREAS57p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77SNU213N300N
MSH3AAAAAPAAPPANCREAS58p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77QGP1N000N
MSH3AAAAAPAAPPANCREAS58p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77SNU213N000N
MSH3AAAAPAAPPPANCREAS59p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77QGP1N000N
MSH3AAAAPAAPPPANCREAS59p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77SNU213N000N
MSH3AAAPAAPPAPANCREAS60p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77QGP1N500N
MSH3AAAPAAPPAPANCREAS60p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77SNU213N500N
MSH3AAPAAPPAPPANCREAS61p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77QGP1N000N
MSH3AAPAAPPAPPANCREAS61p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77SNU213N000N
MSH3APAAPPAPPPANCREAS62p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77QGP1N000N
MSH3APAAPPAPPPANCREAS62p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77SNU213N000N
MSH3PAAPPAPPAPANCREAS63p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77QGP1N000N
MSH3PAAPPAPPAPANCREAS63p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77SNU213N000N
MSH3EQVAKVGDKPANCREAS691p.A693Vc.2078C>TMissense_Mutation10.11PK1N300N
MSH3ILNEQVAKVPANCREAS688p.A693Vc.2078C>TMissense_Mutation10.11PK1Y7143N
MSH3KILNEQVAKPANCREAS687p.A693Vc.2078C>TMissense_Mutation10.11PK1N500N
MSH3LKILNEQVAPANCREAS686p.A693Vc.2078C>TMissense_Mutation10.11PK1N302N
MSH3LNEQVAKVGPANCREAS689p.A693Vc.2078C>TMissense_Mutation10.11PK1N000N
MSH3NEQVAKVGDPANCREAS690p.A693Vc.2078C>TMissense_Mutation10.11PK1N000N
MSH3QVAKVGDKTPANCREAS692p.A693Vc.2078C>TMissense_Mutation10.11PK1N100N
MSH3VAKVGDKTEPANCREAS693p.A693Vc.2078C>TMissense_Mutation10.11PK1N000N
MSH3YLKILNEQVPANCREAS685p.A693Vc.2078C>TMissense_Mutation10.11PK1Y7177N
MSH6VHKLLTLIDPANCREAS1350p.T1355fsc.4065_4066insTTGAFrame_Shift_Ins10.66HUPT3N0018N
MSH6DIGGSDMEFPANCREAS257p.V263Mc.787G>AMissense_Mutation10.11HUPT4N300N
MSH6DMEFKPDTKPANCREAS262p.V263Mc.787G>AMissense_Mutation10.11HUPT4N500N
MSH6EEEYFSEKLPANCREAS639p.R644Sc.1932G>CMissense_Mutation10.11L33N700N
MSH6EEYFSEKLSPANCREAS640p.R644Sc.1932G>CMissense_Mutation10.11L33N500N
MSH6EGYPWWPSLPANCREAS101p.C108Sc.323G>CMissense_Mutation10.11PANC0403N1300N
MSH6ESDIGGSDMPANCREAS255p.V263Mc.787G>AMissense_Mutation10.11HUPT4Y490N
MSH6EYFSEKLSDPANCREAS641p.R644Sc.1932G>CMissense_Mutation10.11L33N000N
MSH6FSEKLSDGIPANCREAS643p.R644Sc.1932G>CMissense_Mutation10.11L33N600N
MSH6GGSDMEFKPPANCREAS259p.V263Mc.787G>AMissense_Mutation10.11HUPT4N000N
MSH6GSDMEFKPDPANCREAS260p.V263Mc.787G>AMissense_Mutation10.11HUPT4N000N
MSH6GYPWWPSLVPANCREAS102p.C108Sc.323G>CMissense_Mutation10.11PANC0403Y5110N
MSH6IGGSDMEFKPANCREAS258p.V263Mc.787G>AMissense_Mutation10.11HUPT4N000N
MSH6LEEEYFSEKPANCREAS638p.R644Sc.1932G>CMissense_Mutation10.11L33N300N
MSH6LLEEEYFSEPANCREAS637p.R644Sc.1932G>CMissense_Mutation10.11L33N000N
MSH6MEFKPDTKEPANCREAS263p.V263Mc.787G>AMissense_Mutation10.11HUPT4N200N
MSH6MEGYPWWPSPANCREAS100p.C108Sc.323G>CMissense_Mutation10.11PANC0403N300N
MSH6PSLVYNHPFPANCREAS107p.C108Sc.323G>CMissense_Mutation10.11PANC0403N200N
MSH6PWWPSLVYNPANCREAS104p.C108Sc.323G>CMissense_Mutation10.11PANC0403N000N
MSH6SDIGGSDMEPANCREAS256p.V263Mc.787G>AMissense_Mutation10.11HUPT4N100N
MSH6SDMEFKPDTPANCREAS261p.V263Mc.787G>AMissense_Mutation10.11HUPT4N200N
MSH6SEKLSDGIGPANCREAS644p.R644Sc.1932G>CMissense_Mutation10.11L33N000N
MSH6SLVYNHPFDPANCREAS108p.C108Sc.323G>CMissense_Mutation10.11PANC0403N100N
MSH6TLLEEEYFSPANCREAS636p.R644Sc.1932G>CMissense_Mutation10.11L33N100N
MSH6WPSLVYNHPPANCREAS106p.C108Sc.323G>CMissense_Mutation10.11PANC0403N300N
MSH6WWPSLVYNHPANCREAS105p.C108Sc.323G>CMissense_Mutation10.11PANC0403Y2151N
MSH6YFSEKLSDGPANCREAS642p.R644Sc.1932G>CMissense_Mutation10.11L33N100N
MSH6YPWWPSLVYPANCREAS103p.C108Sc.323G>CMissense_Mutation10.11PANC0403N1600Y
MYLKASKELKKDVPANCREAS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02HUPT4N400N
MYLKASKELKKDVPANCREAS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KP3N400N
MYLKASKELKKDVPANCREAS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KP4N400N
MYLKASKELKKDVPANCREAS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02PK59N400N
MYLKASKELKKDVPANCREAS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02PSN1N400N
MYLKASKELKKDVPANCREAS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02QGP1N400N
MYLKASKELKKDVPANCREAS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU213N400N
MYLKASKELKKDVPANCREAS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU324N400N
MYLKASKELKKDVPANCREAS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU410N400N
MYLKASKELKKDVPANCREAS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02YAPCN400N
MYLKKELKKDVKNPANCREAS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02HUPT4N500N
MYLKKELKKDVKNPANCREAS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KP3N500N
MYLKKELKKDVKNPANCREAS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KP4N500N
MYLKKELKKDVKNPANCREAS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02PK59N500N
MYLKKELKKDVKNPANCREAS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02PSN1N500N
MYLKKELKKDVKNPANCREAS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02QGP1N500N
MYLKKELKKDVKNPANCREAS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU213N500N
MYLKKELKKDVKNPANCREAS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU324N500N
MYLKKELKKDVKNPANCREAS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU410N500N
MYLKKELKKDVKNPANCREAS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02YAPCN500N
MYLKKSASKELKKPANCREAS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02HUPT4N400N
MYLKKSASKELKKPANCREAS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KP3N400N
MYLKKSASKELKKPANCREAS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KP4N400N
MYLKKSASKELKKPANCREAS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02PK59N400N
MYLKKSASKELKKPANCREAS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02PSN1N400N
MYLKKSASKELKKPANCREAS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02QGP1N400N
MYLKKSASKELKKPANCREAS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU213N400N
MYLKKSASKELKKPANCREAS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU324N400N
MYLKKSASKELKKPANCREAS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU410N400N
MYLKKSASKELKKPANCREAS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02YAPCN400N
MYLKLKSASKELKPANCREAS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02HUPT4N105N
MYLKLKSASKELKPANCREAS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KP3N105N
MYLKLKSASKELKPANCREAS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KP4N105N
MYLKLKSASKELKPANCREAS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02PK59N105N
MYLKLKSASKELKPANCREAS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02PSN1N105N
MYLKLKSASKELKPANCREAS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02QGP1N105N
MYLKLKSASKELKPANCREAS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU213N105N
MYLKLKSASKELKPANCREAS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU324N105N
MYLKLKSASKELKPANCREAS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU410N105N
MYLKLKSASKELKPANCREAS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02YAPCN105N
MYLKNLKSASKELPANCREAS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02HUPT4Y5100N
MYLKNLKSASKELPANCREAS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KP3Y5100N
MYLKNLKSASKELPANCREAS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KP4Y5100N
MYLKNLKSASKELPANCREAS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02PK59Y5100N
MYLKNLKSASKELPANCREAS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02PSN1Y5100N
MYLKNLKSASKELPANCREAS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02QGP1Y5100N
MYLKNLKSASKELPANCREAS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU213Y5100N
MYLKNLKSASKELPANCREAS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU324Y5100N
MYLKNLKSASKELPANCREAS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU410Y5100N
MYLKNLKSASKELPANCREAS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02YAPCY5100N
MYLKSASKELKKDPANCREAS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02HUPT4N000N
MYLKSASKELKKDPANCREAS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KP3N000N
MYLKSASKELKKDPANCREAS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KP4N000N
MYLKSASKELKKDPANCREAS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02PK59N000N
MYLKSASKELKKDPANCREAS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02PSN1N000N
MYLKSASKELKKDPANCREAS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02QGP1N000N
MYLKSASKELKKDPANCREAS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU213N000N
MYLKSASKELKKDPANCREAS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU324N000N
MYLKSASKELKKDPANCREAS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU410N000N
MYLKSASKELKKDPANCREAS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02YAPCN000N
MYLKSKELKKDVKPANCREAS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02HUPT4N200N
MYLKSKELKKDVKPANCREAS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KP3N200N
MYLKSKELKKDVKPANCREAS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KP4N200N
MYLKSKELKKDVKPANCREAS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02PK59N200N
MYLKSKELKKDVKPANCREAS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02PSN1N200N
MYLKSKELKKDVKPANCREAS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02QGP1N200N
MYLKSKELKKDVKPANCREAS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU213N200N
MYLKSKELKKDVKPANCREAS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU324N200N
MYLKSKELKKDVKPANCREAS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU410N200N
MYLKSKELKKDVKPANCREAS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02YAPCN200N
MYLKAETLNAKTVPANCREAS1000p.A1007Tc.3019G>AMissense_Mutation10.11PK45HY7110N
MYLKAKTVESSKPPANCREAS1005p.A1007Tc.3019G>AMissense_Mutation10.11PK45HN000N
MYLKEPIRYATDMPANCREAS1636p.G1639Rc.4915G>CMissense_Mutation10.11HPAFIIN1200N
MYLKETLNAKTVEPANCREAS1001p.A1007Tc.3019G>AMissense_Mutation10.11PK45HN000N
MYLKEVINYEPIRPANCREAS1631p.G1639Rc.4915G>CMissense_Mutation10.11HPAFIIN600N
MYLKINYEPIRYAPANCREAS1633p.G1639Rc.4915G>CMissense_Mutation10.11HPAFIIN505N
MYLKIRYATDMWSPANCREAS1638p.G1639Rc.4915G>CMissense_Mutation10.11HPAFIIN3020N
MYLKKTVESSKPLPANCREAS1006p.A1007Tc.3019G>AMissense_Mutation10.11PK45HN1700N
MYLKLNAKTVESSPANCREAS1003p.A1007Tc.3019G>AMissense_Mutation10.11PK45HN0012N
MYLKNAKTVESSKPANCREAS1004p.A1007Tc.3019G>AMissense_Mutation10.11PK45HN100N
MYLKNYEPIRYATPANCREAS1634p.G1639Rc.4915G>CMissense_Mutation10.11HPAFIIN400N
MYLKPIRYATDMWPANCREAS1637p.G1639Rc.4915G>CMissense_Mutation10.11HPAFIIN000N
MYLKRYATDMWSIPANCREAS1639p.G1639Rc.4915G>CMissense_Mutation10.11HPAFIIY4130N
MYLKSAETLNAKTPANCREAS999p.A1007Tc.3019G>AMissense_Mutation10.11PK45HN400N
MYLKTLNAKTVESPANCREAS1002p.A1007Tc.3019G>AMissense_Mutation10.11PK45HN000N
MYLKTVESSKPLSPANCREAS1007p.A1007Tc.3019G>AMissense_Mutation10.11PK45HN100N
MYLKVINYEPIRYPANCREAS1632p.G1639Rc.4915G>CMissense_Mutation10.11HPAFIIY61111N
MYLKYEPIRYATDPANCREAS1635p.G1639Rc.4915G>CMissense_Mutation10.11HPAFIIY290N
MYST4DNPEPLRCKPANCREAS1237p.K1243Rc.3728A>GMissense_Mutation10.11KP3N000N
MYST4EPLRCKQVWPANCREAS1240p.K1243Rc.3728A>GMissense_Mutation10.11KP3N1000N
MYST4KDNPEPLRCPANCREAS1236p.K1243Rc.3728A>GMissense_Mutation10.11KP3N100N
MYST4LRCKQVWPKPANCREAS1242p.K1243Rc.3728A>GMissense_Mutation10.11KP3N2022N
MYST4NPEPLRCKQPANCREAS1238p.K1243Rc.3728A>GMissense_Mutation10.11KP3N100N
MYST4PEPLRCKQVPANCREAS1239p.K1243Rc.3728A>GMissense_Mutation10.11KP3N300N
MYST4PLRCKQVWPPANCREAS1241p.K1243Rc.3728A>GMissense_Mutation10.11KP3N000N
MYST4RCKQVWPKGPANCREAS1243p.K1243Rc.3728A>GMissense_Mutation10.11KP3N000N
MYST4SKDNPEPLRPANCREAS1235p.K1243Rc.3728A>GMissense_Mutation10.11KP3N100N
NCOA3AILGDLTSFPANCREAS802p.S810Fc.2429C>TMissense_Mutation10.11KP4N400N
NCOA3AILKETLRQPANCREAS70p.V76Lc.226G>TMissense_Mutation10.11MIAPACA2N000N
NCOA3CAILKETLRPANCREAS69p.V76Lc.226G>TMissense_Mutation10.11MIAPACA2N400N
NCOA3DLTSFDFYNPANCREAS806p.S810Fc.2429C>TMissense_Mutation10.11KP4N100N
NCOA3ETLRQIRQIPANCREAS74p.V76Lc.226G>TMissense_Mutation10.11MIAPACA2Y7140Y
NCOA3ETVRQLRQIPANCREAS74p.I79Lc.234_235GA>ATMissense_Mutation10.11MIAPACA2Y7130N
NCOA3FDFYNNSISPANCREAS810p.S810Fc.2429C>TMissense_Mutation10.11KP4N502N
NCOA3GDLTSFDFYPANCREAS805p.S810Fc.2429C>TMissense_Mutation10.11KP4N400N
NCOA3ILGDLTSFDPANCREAS803p.S810Fc.2429C>TMissense_Mutation10.11KP4N0012N
NCOA3ILKETLRQIPANCREAS71p.V76Lc.226G>TMissense_Mutation10.11MIAPACA2N700N
NCOA3ILKETVRQLPANCREAS71p.I79Lc.234_235GA>ATMissense_Mutation10.11MIAPACA2Y8130N
NCOA3KCAILKETLPANCREAS68p.V76Lc.226G>TMissense_Mutation10.11MIAPACA2Y8100N
NCOA3KETLRQIRQPANCREAS73p.V76Lc.226G>TMissense_Mutation10.11MIAPACA2N000N
NCOA3KETVRQLRQPANCREAS73p.I79Lc.234_235GA>ATMissense_Mutation10.11MIAPACA2N000N
NCOA3LGDLTSFDFPANCREAS804p.S810Fc.2429C>TMissense_Mutation10.11KP4N800N
NCOA3LKETLRQIRPANCREAS72p.V76Lc.226G>TMissense_Mutation10.11MIAPACA2N100N
NCOA3LKETVRQLRPANCREAS72p.I79Lc.234_235GA>ATMissense_Mutation10.11MIAPACA2N100N
NCOA3LRQIKEQGKPANCREAS79p.I79Lc.234_235GA>ATMissense_Mutation10.11MIAPACA2N202N
NCOA3LRQIRQIKEPANCREAS76p.V76Lc.226G>TMissense_Mutation10.11MIAPACA2N107N
NCOA3LTSFDFYNNPANCREAS807p.S810Fc.2429C>TMissense_Mutation10.11KP4N000N
NCOA3QLRQIKEQGPANCREAS78p.I79Lc.234_235GA>ATMissense_Mutation10.11MIAPACA2N000N
NCOA3RQLRQIKEQPANCREAS77p.I79Lc.234_235GA>ATMissense_Mutation10.11MIAPACA2N000N
NCOA3SFDFYNNSIPANCREAS809p.S810Fc.2429C>TMissense_Mutation10.11KP4N400N
NCOA3TLRQIRQIKPANCREAS75p.V76Lc.226G>TMissense_Mutation10.11MIAPACA2Y4130N
NCOA3TSFDFYNNSPANCREAS808p.S810Fc.2429C>TMissense_Mutation10.11KP4Y1100N
NCOA3TVRQLRQIKPANCREAS75p.I79Lc.234_235GA>ATMissense_Mutation10.11MIAPACA2Y3120N
NCOA3VRQLRQIKEPANCREAS76p.I79Lc.234_235GA>ATMissense_Mutation10.11MIAPACA2N1013N
NF1ERSLKLMSKPANCREAS1436p.G1438Sc.4312G>AMissense_Mutation10.11PANC1005Y2110N
NF1IERSLKLMSPANCREAS1435p.G1438Sc.4312G>AMissense_Mutation10.11PANC1005N4025N
NF1KPPPRIERSPANCREAS1430p.G1438Sc.4312G>AMissense_Mutation10.11PANC1005N500N
NF1PPPRIERSLPANCREAS1431p.G1438Sc.4312G>AMissense_Mutation10.11PANC1005N1000N
NF1PPRIERSLKPANCREAS1432p.G1438Sc.4312G>AMissense_Mutation10.11PANC1005N000N
NF1PRIERSLKLPANCREAS1433p.G1438Sc.4312G>AMissense_Mutation10.11PANC1005N300N
NF1RIERSLKLMPANCREAS1434p.G1438Sc.4312G>AMissense_Mutation10.11PANC1005N100N
NF1RSLKLMSKIPANCREAS1437p.G1438Sc.4312G>AMissense_Mutation10.11PANC1005Y9110N
NF1SLKLMSKILPANCREAS1438p.G1438Sc.4312G>AMissense_Mutation10.11PANC1005N600N
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13ASPC1N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13BXPC3N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13CAPAN1N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13CAPAN2N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13DANGN101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13HPAFIIN101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HS766TN101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13HUPT3N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13HUPT4N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KP1NLN101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KP1NN101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KP2N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KP3N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KP4N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13L33N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13MIAPACA2N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13PANC0203N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13PANC0203N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13PANC0213N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13PANC0327N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13PANC0403N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13PANC0813N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13PANC1005N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13PANC1005N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13PATU8902N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13PK1N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13PK45HN101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13PK45HN101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13PK59N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13PSN1N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13QGP1N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU213N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU324N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU410N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SU8686N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SW1990N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13T3M4N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13TCCPAN2N101Y
NR1H2IRKQQQQQEPANCREAS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13YAPCN101Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13ASPC1N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13BXPC3N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13CAPAN1N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13CAPAN2N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13DANGN000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13HPAFIIN000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HS766TN000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13HUPT3N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13HUPT4N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KP1NLN000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KP1NN000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KP2N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KP3N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KP4N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13L33N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13MIAPACA2N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13PANC0203N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13PANC0203N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13PANC0213N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13PANC0327N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13PANC0403N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13PANC0813N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13PANC1005N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13PANC1005N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13PATU8902N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13PK1N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13PK45HN000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13PK45HN000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13PK59N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13PSN1N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13QGP1N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU213N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU324N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU410N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SU8686N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SW1990N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13T3M4N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13TCCPAN2N000Y
NR1H2KIRKQQQQQPANCREAS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13YAPCN000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13ASPC1N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13BXPC3N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13CAPAN1N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13CAPAN2N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13DANGN000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13HPAFIIN000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HS766TN000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13HUPT3N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13HUPT4N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KP1NLN000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KP1NN000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KP2N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KP3N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KP4N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13L33N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13MIAPACA2N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13PANC0203N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13PANC0203N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13PANC0213N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13PANC0327N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13PANC0403N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13PANC0813N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13PANC1005N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13PANC1005N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13PATU8902N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13PK1N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13PK45HN000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13PK45HN000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13PK59N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13PSN1N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13QGP1N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU213N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU324N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU410N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SU8686N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SW1990N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13T3M4N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13TCCPAN2N000Y
NR1H2KQQQQQESQPANCREAS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13YAPCN000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13ASPC1N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13BXPC3N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13CAPAN1N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13CAPAN2N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13DANGN000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13HPAFIIN000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HS766TN000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13HUPT3N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13HUPT4N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KP1NLN000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KP1NN000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KP2N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KP3N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KP4N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13L33N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13MIAPACA2N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13PANC0203N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13PANC0203N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13PANC0213N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13PANC0327N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13PANC0403N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13PANC0813N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13PANC1005N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13PANC1005N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13PATU8902N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13PK1N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13PK45HN000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13PK45HN000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13PK59N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13PSN1N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13QGP1N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU213N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU324N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU410N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SU8686N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SW1990N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13T3M4N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13TCCPAN2N000Y
NR1H2QQQQQESQSPANCREAS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13YAPCN000Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13ASPC1N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13BXPC3N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13CAPAN1N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13CAPAN2N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13DANGN100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13HPAFIIN100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13HS766TN100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13HUPT3N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13HUPT4N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KP1NLN100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KP1NN100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KP2N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KP3N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KP4N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13L33N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13MIAPACA2N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13PANC0203N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13PANC0203N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13PANC0213N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13PANC0327N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13PANC0403N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13PANC0813N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13PANC1005N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13PANC1005N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13PATU8902N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13PK1N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13PK45HN100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13PK45HN100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13PK59N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13PSN1N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13QGP1N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SNU213N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SNU324N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SNU410N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SU8686N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SW1990N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13T3M4N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13TCCPAN2N100Y
NR1H2RKQQQQQESPANCREAS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13YAPCN100Y
PDE4DIPANLDQGRVRPANCREAS603p.L601fsc.1801_1801delCFrame_Shift_Del615.49KP3Y2110N
PDE4DIPANLDQGRVRPANCREAS603p.L601fsc.1801_1801delCFrame_Shift_Del615.49PK59Y2110N
PDE4DIPATCSANLDQPANCREAS599p.L601fsc.1801_1801delCFrame_Shift_Del615.49KP3N000N
PDE4DIPATCSANLDQPANCREAS599p.L601fsc.1801_1801delCFrame_Shift_Del615.49PK59N000N
PDE4DIPCSANLDQGRPANCREAS601p.L601fsc.1801_1801delCFrame_Shift_Del515.49KP3N300N
PDE4DIPCSANLDQGRPANCREAS601p.L601fsc.1801_1801delCFrame_Shift_Del515.49PK59N300N
PDE4DIPDLSATCSANPANCREAS596p.L601fsc.1801_1801delCFrame_Shift_Del415.49KP3N000N
PDE4DIPDLSATCSANPANCREAS596p.L601fsc.1801_1801delCFrame_Shift_Del415.49PK59N000N
PDE4DIPEDLSATCSAPANCREAS595p.L601fsc.1801_1801delCFrame_Shift_Del315.49KP3N400N
PDE4DIPEDLSATCSAPANCREAS595p.L601fsc.1801_1801delCFrame_Shift_Del315.49PK59N400N
PDE4DIPEVEDLSATCPANCREAS593p.L601fsc.1801_1801delCFrame_Shift_Del115.49KP3N200N
PDE4DIPEVEDLSATCPANCREAS593p.L601fsc.1801_1801delCFrame_Shift_Del115.49PK59N200N
PDE4DIPLSATCSANLPANCREAS597p.L601fsc.1801_1801delCFrame_Shift_Del415.49KP3N1102N
PDE4DIPLSATCSANLPANCREAS597p.L601fsc.1801_1801delCFrame_Shift_Del415.49PK59N1102N
PDE4DIPSANLDQGRVPANCREAS602p.L601fsc.1801_1801delCFrame_Shift_Del515.49KP3N400N
PDE4DIPSANLDQGRVPANCREAS602p.L601fsc.1801_1801delCFrame_Shift_Del515.49PK59N400N
PDE4DIPSATCSANLDPANCREAS598p.L601fsc.1801_1801delCFrame_Shift_Del515.49KP3N000N
PDE4DIPSATCSANLDPANCREAS598p.L601fsc.1801_1801delCFrame_Shift_Del515.49PK59N000N
PDE4DIPTCSANLDQGPANCREAS600p.L601fsc.1801_1801delCFrame_Shift_Del615.49KP3N100N
PDE4DIPTCSANLDQGPANCREAS600p.L601fsc.1801_1801delCFrame_Shift_Del615.49PK59N100N
PDE4DIPVEDLSATCSPANCREAS594p.L601fsc.1801_1801delCFrame_Shift_Del215.49KP3N300N
PDE4DIPVEDLSATCSPANCREAS594p.L601fsc.1801_1801delCFrame_Shift_Del215.49PK59N300N
PDE4DIPADSRKKSSKPANCREAS242p.E243fsc.729_729delAFrame_Shift_Del517.59ASPC1N000Y
PDE4DIPADSRKKSSKPANCREAS242p.E243fsc.729_729delAFrame_Shift_Del517.59KP3N000Y
PDE4DIPADSRKKSSKPANCREAS242p.E243fsc.729_729delAFrame_Shift_Del517.59PK59N000Y
PDE4DIPADSRKKSSKPANCREAS242p.E243fsc.729_729delAFrame_Shift_Del517.59SNU324N000Y
PDE4DIPDSHLADSRKPANCREAS238p.E243fsc.729_729delAFrame_Shift_Del417.59ASPC1N200N
PDE4DIPDSHLADSRKPANCREAS238p.E243fsc.729_729delAFrame_Shift_Del417.59KP3N200N
PDE4DIPDSHLADSRKPANCREAS238p.E243fsc.729_729delAFrame_Shift_Del417.59PK59N200N
PDE4DIPDSHLADSRKPANCREAS238p.E243fsc.729_729delAFrame_Shift_Del417.59SNU324N200N
PDE4DIPDSRKKSSKQPANCREAS243p.E243fsc.729_729delAFrame_Shift_Del417.59ASPC1N200Y
PDE4DIPDSRKKSSKQPANCREAS243p.E243fsc.729_729delAFrame_Shift_Del417.59KP3N200Y
PDE4DIPDSRKKSSKQPANCREAS243p.E243fsc.729_729delAFrame_Shift_Del417.59PK59N200Y
PDE4DIPDSRKKSSKQPANCREAS243p.E243fsc.729_729delAFrame_Shift_Del417.59SNU324N200Y
PDE4DIPHLADSRKKSPANCREAS240p.E243fsc.729_729delAFrame_Shift_Del517.59ASPC1N000N
PDE4DIPHLADSRKKSPANCREAS240p.E243fsc.729_729delAFrame_Shift_Del517.59KP3N000N
PDE4DIPHLADSRKKSPANCREAS240p.E243fsc.729_729delAFrame_Shift_Del517.59PK59N000N
PDE4DIPHLADSRKKSPANCREAS240p.E243fsc.729_729delAFrame_Shift_Del517.59SNU324N000N
PDE4DIPKKSSKQRPPPANCREAS246p.E243fsc.729_729delAFrame_Shift_Del517.59ASPC1N100Y
PDE4DIPKKSSKQRPPPANCREAS246p.E243fsc.729_729delAFrame_Shift_Del517.59KP3N100Y
PDE4DIPKKSSKQRPPPANCREAS246p.E243fsc.729_729delAFrame_Shift_Del517.59PK59N100Y
PDE4DIPKKSSKQRPPPANCREAS246p.E243fsc.729_729delAFrame_Shift_Del517.59SNU324N100Y
PDE4DIPKQRPPTRFFPANCREAS250p.E243fsc.729_729delAFrame_Shift_Del617.59ASPC1Y7100Y
PDE4DIPKQRPPTRFFPANCREAS250p.E243fsc.729_729delAFrame_Shift_Del617.59KP3Y7100Y
PDE4DIPKQRPPTRFFPANCREAS250p.E243fsc.729_729delAFrame_Shift_Del617.59PK59Y7100Y
PDE4DIPKQRPPTRFFPANCREAS250p.E243fsc.729_729delAFrame_Shift_Del617.59SNU324Y7100Y
PDE4DIPKSSKQRPPTPANCREAS247p.E243fsc.729_729delAFrame_Shift_Del517.59ASPC1N200Y
PDE4DIPKSSKQRPPTPANCREAS247p.E243fsc.729_729delAFrame_Shift_Del517.59KP3N200Y
PDE4DIPKSSKQRPPTPANCREAS247p.E243fsc.729_729delAFrame_Shift_Del517.59PK59N200Y
PDE4DIPKSSKQRPPTPANCREAS247p.E243fsc.729_729delAFrame_Shift_Del517.59SNU324N200Y
PDE4DIPLADSRKKSSPANCREAS241p.E243fsc.729_729delAFrame_Shift_Del517.59ASPC1N100N
PDE4DIPLADSRKKSSPANCREAS241p.E243fsc.729_729delAFrame_Shift_Del517.59KP3N100N
PDE4DIPLADSRKKSSPANCREAS241p.E243fsc.729_729delAFrame_Shift_Del517.59PK59N100N
PDE4DIPLADSRKKSSPANCREAS241p.E243fsc.729_729delAFrame_Shift_Del517.59SNU324N100N
PDE4DIPPPTRFFKRNPANCREAS253p.E243fsc.729_729delAFrame_Shift_Del517.59ASPC1N000Y
PDE4DIPPPTRFFKRNPANCREAS253p.E243fsc.729_729delAFrame_Shift_Del517.59KP3N000Y
PDE4DIPPPTRFFKRNPANCREAS253p.E243fsc.729_729delAFrame_Shift_Del517.59PK59N000Y
PDE4DIPPPTRFFKRNPANCREAS253p.E243fsc.729_729delAFrame_Shift_Del517.59SNU324N000Y
PDE4DIPPTRFFKRNLPANCREAS254p.E243fsc.729_729delAFrame_Shift_Del617.59ASPC1Y2110Y
PDE4DIPPTRFFKRNLPANCREAS254p.E243fsc.729_729delAFrame_Shift_Del617.59KP3Y2110Y
PDE4DIPPTRFFKRNLPANCREAS254p.E243fsc.729_729delAFrame_Shift_Del617.59PK59Y2110Y
PDE4DIPPTRFFKRNLPANCREAS254p.E243fsc.729_729delAFrame_Shift_Del617.59SNU324Y2110Y
PDE4DIPQRPPTRFFKPANCREAS251p.E243fsc.729_729delAFrame_Shift_Del617.59ASPC1Y2100Y
PDE4DIPQRPPTRFFKPANCREAS251p.E243fsc.729_729delAFrame_Shift_Del617.59KP3Y2100Y
PDE4DIPQRPPTRFFKPANCREAS251p.E243fsc.729_729delAFrame_Shift_Del617.59PK59Y2100Y
PDE4DIPQRPPTRFFKPANCREAS251p.E243fsc.729_729delAFrame_Shift_Del617.59SNU324Y2100Y
PDE4DIPRFFKRNLMKPANCREAS256p.E243fsc.729_729delAFrame_Shift_Del617.59ASPC1Y2130N
PDE4DIPRFFKRNLMKPANCREAS256p.E243fsc.729_729delAFrame_Shift_Del617.59KP3Y2130N
PDE4DIPRFFKRNLMKPANCREAS256p.E243fsc.729_729delAFrame_Shift_Del617.59PK59Y2130N
PDE4DIPRFFKRNLMKPANCREAS256p.E243fsc.729_729delAFrame_Shift_Del617.59SNU324Y2130N
PDE4DIPRKKSSKQRPPANCREAS245p.E243fsc.729_729delAFrame_Shift_Del417.59ASPC1N100Y
PDE4DIPRKKSSKQRPPANCREAS245p.E243fsc.729_729delAFrame_Shift_Del417.59KP3N100Y
PDE4DIPRKKSSKQRPPANCREAS245p.E243fsc.729_729delAFrame_Shift_Del417.59PK59N100Y
PDE4DIPRKKSSKQRPPANCREAS245p.E243fsc.729_729delAFrame_Shift_Del417.59SNU324N100Y
PDE4DIPRPPTRFFKRPANCREAS252p.E243fsc.729_729delAFrame_Shift_Del617.59ASPC1Y590Y
PDE4DIPRPPTRFFKRPANCREAS252p.E243fsc.729_729delAFrame_Shift_Del617.59KP3Y590Y
PDE4DIPRPPTRFFKRPANCREAS252p.E243fsc.729_729delAFrame_Shift_Del617.59PK59Y590Y
PDE4DIPRPPTRFFKRPANCREAS252p.E243fsc.729_729delAFrame_Shift_Del617.59SNU324Y590Y
PDE4DIPSDSHLADSRPANCREAS237p.E243fsc.729_729delAFrame_Shift_Del317.59ASPC1N000N
PDE4DIPSDSHLADSRPANCREAS237p.E243fsc.729_729delAFrame_Shift_Del317.59KP3N000N
PDE4DIPSDSHLADSRPANCREAS237p.E243fsc.729_729delAFrame_Shift_Del317.59PK59N000N
PDE4DIPSDSHLADSRPANCREAS237p.E243fsc.729_729delAFrame_Shift_Del317.59SNU324N000N
PDE4DIPSHLADSRKKPANCREAS239p.E243fsc.729_729delAFrame_Shift_Del417.59ASPC1N000N
PDE4DIPSHLADSRKKPANCREAS239p.E243fsc.729_729delAFrame_Shift_Del417.59KP3N000N
PDE4DIPSHLADSRKKPANCREAS239p.E243fsc.729_729delAFrame_Shift_Del417.59PK59N000N
PDE4DIPSHLADSRKKPANCREAS239p.E243fsc.729_729delAFrame_Shift_Del417.59SNU324N000N
PDE4DIPSKQRPPTRFPANCREAS249p.E243fsc.729_729delAFrame_Shift_Del517.59ASPC1N200Y
PDE4DIPSKQRPPTRFPANCREAS249p.E243fsc.729_729delAFrame_Shift_Del517.59KP3N200Y
PDE4DIPSKQRPPTRFPANCREAS249p.E243fsc.729_729delAFrame_Shift_Del517.59PK59N200Y
PDE4DIPSKQRPPTRFPANCREAS249p.E243fsc.729_729delAFrame_Shift_Del517.59SNU324N200Y
PDE4DIPSRKKSSKQRPANCREAS244p.E243fsc.729_729delAFrame_Shift_Del417.59ASPC1Y390Y
PDE4DIPSRKKSSKQRPANCREAS244p.E243fsc.729_729delAFrame_Shift_Del417.59KP3Y390Y
PDE4DIPSRKKSSKQRPANCREAS244p.E243fsc.729_729delAFrame_Shift_Del417.59PK59Y390Y
PDE4DIPSRKKSSKQRPANCREAS244p.E243fsc.729_729delAFrame_Shift_Del417.59SNU324Y390Y
PDE4DIPSSKQRPPTRPANCREAS248p.E243fsc.729_729delAFrame_Shift_Del517.59ASPC1Y390Y
PDE4DIPSSKQRPPTRPANCREAS248p.E243fsc.729_729delAFrame_Shift_Del517.59KP3Y390Y
PDE4DIPSSKQRPPTRPANCREAS248p.E243fsc.729_729delAFrame_Shift_Del517.59PK59Y390Y
PDE4DIPSSKQRPPTRPANCREAS248p.E243fsc.729_729delAFrame_Shift_Del517.59SNU324Y390Y
PDE4DIPSVSDSHLADPANCREAS235p.E243fsc.729_729delAFrame_Shift_Del117.59ASPC1N000N
PDE4DIPSVSDSHLADPANCREAS235p.E243fsc.729_729delAFrame_Shift_Del117.59KP3N000N
PDE4DIPSVSDSHLADPANCREAS235p.E243fsc.729_729delAFrame_Shift_Del117.59PK59N000N
PDE4DIPSVSDSHLADPANCREAS235p.E243fsc.729_729delAFrame_Shift_Del117.59SNU324N000N
PDE4DIPTRFFKRNLMPANCREAS255p.E243fsc.729_729delAFrame_Shift_Del617.59ASPC1Y390Y
PDE4DIPTRFFKRNLMPANCREAS255p.E243fsc.729_729delAFrame_Shift_Del617.59KP3Y390Y
PDE4DIPTRFFKRNLMPANCREAS255p.E243fsc.729_729delAFrame_Shift_Del617.59PK59Y390Y
PDE4DIPTRFFKRNLMPANCREAS255p.E243fsc.729_729delAFrame_Shift_Del617.59SNU324Y390Y
PDE4DIPVSDSHLADSPANCREAS236p.E243fsc.729_729delAFrame_Shift_Del217.59ASPC1N100N
PDE4DIPVSDSHLADSPANCREAS236p.E243fsc.729_729delAFrame_Shift_Del217.59KP3N100N
PDE4DIPVSDSHLADSPANCREAS236p.E243fsc.729_729delAFrame_Shift_Del217.59PK59N100N
PDE4DIPVSDSHLADSPANCREAS236p.E243fsc.729_729delAFrame_Shift_Del217.59SNU324N100N
PDE4DIPDKAVLWSGLPANCREAS483p.V486fsc.1458_1458delTFrame_Shift_Del518.58BXPC3N400N
PDE4DIPDKAVLWSGLPANCREAS483p.V486fsc.1458_1458delTFrame_Shift_Del518.58DANGN400N
PDE4DIPDKAVLWSGLPANCREAS483p.V486fsc.1458_1458delTFrame_Shift_Del518.58HPAFIIN400N
PDE4DIPDKAVLWSGLPANCREAS483p.V486fsc.1458_1458delTFrame_Shift_Del518.58HS766TN400N
PDE4DIPDKAVLWSGLPANCREAS483p.V486fsc.1458_1458delTFrame_Shift_Del518.58L33N400N
PDE4DIPDKAVLWSGLPANCREAS483p.V486fsc.1458_1458delTFrame_Shift_Del518.58MIAPACA2N400N
PDE4DIPDKAVLWSGLPANCREAS483p.V486fsc.1458_1458delTFrame_Shift_Del518.58PANC0203N400N
PDE4DIPDKAVLWSGLPANCREAS483p.V486fsc.1458_1458delTFrame_Shift_Del518.58PATU8902N400N
PDE4DIPHDKAVLWSGPANCREAS482p.V486fsc.1458_1458delTFrame_Shift_Del418.58BXPC3N000N
PDE4DIPHDKAVLWSGPANCREAS482p.V486fsc.1458_1458delTFrame_Shift_Del418.58DANGN000N
PDE4DIPHDKAVLWSGPANCREAS482p.V486fsc.1458_1458delTFrame_Shift_Del418.58HPAFIIN000N
PDE4DIPHDKAVLWSGPANCREAS482p.V486fsc.1458_1458delTFrame_Shift_Del418.58HS766TN000N
PDE4DIPHDKAVLWSGPANCREAS482p.V486fsc.1458_1458delTFrame_Shift_Del418.58L33N000N
PDE4DIPHDKAVLWSGPANCREAS482p.V486fsc.1458_1458delTFrame_Shift_Del418.58MIAPACA2N000N
PDE4DIPHDKAVLWSGPANCREAS482p.V486fsc.1458_1458delTFrame_Shift_Del418.58PANC0203N000N
PDE4DIPHDKAVLWSGPANCREAS482p.V486fsc.1458_1458delTFrame_Shift_Del418.58PATU8902N000N
PDE4DIPIHDKAVLWSPANCREAS481p.V486fsc.1458_1458delTFrame_Shift_Del318.58BXPC3N2020N
PDE4DIPIHDKAVLWSPANCREAS481p.V486fsc.1458_1458delTFrame_Shift_Del318.58DANGN2020N
PDE4DIPIHDKAVLWSPANCREAS481p.V486fsc.1458_1458delTFrame_Shift_Del318.58HPAFIIN2020N
PDE4DIPIHDKAVLWSPANCREAS481p.V486fsc.1458_1458delTFrame_Shift_Del318.58HS766TN2020N
PDE4DIPIHDKAVLWSPANCREAS481p.V486fsc.1458_1458delTFrame_Shift_Del318.58L33N2020N
PDE4DIPIHDKAVLWSPANCREAS481p.V486fsc.1458_1458delTFrame_Shift_Del318.58MIAPACA2N2020N
PDE4DIPIHDKAVLWSPANCREAS481p.V486fsc.1458_1458delTFrame_Shift_Del318.58PANC0203N2020N
PDE4DIPIHDKAVLWSPANCREAS481p.V486fsc.1458_1458delTFrame_Shift_Del318.58PATU8902N2020N
PDE4DIPQRIHDKAVLPANCREAS479p.V486fsc.1458_1458delTFrame_Shift_Del118.58BXPC3N600N
PDE4DIPQRIHDKAVLPANCREAS479p.V486fsc.1458_1458delTFrame_Shift_Del118.58DANGN600N
PDE4DIPQRIHDKAVLPANCREAS479p.V486fsc.1458_1458delTFrame_Shift_Del118.58HPAFIIN600N
PDE4DIPQRIHDKAVLPANCREAS479p.V486fsc.1458_1458delTFrame_Shift_Del118.58HS766TN600N
PDE4DIPQRIHDKAVLPANCREAS479p.V486fsc.1458_1458delTFrame_Shift_Del118.58L33N600N
PDE4DIPQRIHDKAVLPANCREAS479p.V486fsc.1458_1458delTFrame_Shift_Del118.58MIAPACA2N600N
PDE4DIPQRIHDKAVLPANCREAS479p.V486fsc.1458_1458delTFrame_Shift_Del118.58PANC0203N600N
PDE4DIPQRIHDKAVLPANCREAS479p.V486fsc.1458_1458delTFrame_Shift_Del118.58PATU8902N600N
PDE4DIPRIHDKAVLWPANCREAS480p.V486fsc.1458_1458delTFrame_Shift_Del218.58BXPC3N400N
PDE4DIPRIHDKAVLWPANCREAS480p.V486fsc.1458_1458delTFrame_Shift_Del218.58DANGN400N
PDE4DIPRIHDKAVLWPANCREAS480p.V486fsc.1458_1458delTFrame_Shift_Del218.58HPAFIIN400N
PDE4DIPRIHDKAVLWPANCREAS480p.V486fsc.1458_1458delTFrame_Shift_Del218.58HS766TN400N
PDE4DIPRIHDKAVLWPANCREAS480p.V486fsc.1458_1458delTFrame_Shift_Del218.58L33N400N
PDE4DIPRIHDKAVLWPANCREAS480p.V486fsc.1458_1458delTFrame_Shift_Del218.58MIAPACA2N400N
PDE4DIPRIHDKAVLWPANCREAS480p.V486fsc.1458_1458delTFrame_Shift_Del218.58PANC0203N400N
PDE4DIPRIHDKAVLWPANCREAS480p.V486fsc.1458_1458delTFrame_Shift_Del218.58PATU8902N400N
PDE4DIPAAVRHQWSPPANCREAS1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BXPC3N000N
PDE4DIPAAVRHQWSPPANCREAS1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35DANGN000N
PDE4DIPAAVRHQWSPPANCREAS1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HPAFIIN000N
PDE4DIPAAVRHQWSPPANCREAS1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KP1NN000N
PDE4DIPAAVRHQWSPPANCREAS1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35L33N000N
PDE4DIPAAVRHQWSPPANCREAS1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MIAPACA2N000N
PDE4DIPAAVRHQWSPPANCREAS1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PANC0203N000N
PDE4DIPAAVRHQWSPPANCREAS1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PATU8902N000N
PDE4DIPACQLPRIPPPANCREAS1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BXPC3N000N
PDE4DIPACQLPRIPPPANCREAS1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35DANGN000N
PDE4DIPACQLPRIPPPANCREAS1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HPAFIIN000N
PDE4DIPACQLPRIPPPANCREAS1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KP1NN000N
PDE4DIPACQLPRIPPPANCREAS1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35L33N000N
PDE4DIPACQLPRIPPPANCREAS1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MIAPACA2N000N
PDE4DIPACQLPRIPPPANCREAS1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PANC0203N000N
PDE4DIPACQLPRIPPPANCREAS1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PATU8902N000N
PDE4DIPAFIFTPYPSPANCREAS1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N000N
PDE4DIPAFIFTPYPSPANCREAS1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN000N
PDE4DIPAFIFTPYPSPANCREAS1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN000N
PDE4DIPAFIFTPYPSPANCREAS1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN000N
PDE4DIPAFIFTPYPSPANCREAS1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N000N
PDE4DIPAFIFTPYPSPANCREAS1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N000N
PDE4DIPAFIFTPYPSPANCREAS1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N000N
PDE4DIPAFIFTPYPSPANCREAS1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N000N
PDE4DIPAFLRHHCPQPANCREAS1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N000N
PDE4DIPAFLRHHCPQPANCREAS1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN000N
PDE4DIPAFLRHHCPQPANCREAS1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN000N
PDE4DIPAFLRHHCPQPANCREAS1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN000N
PDE4DIPAFLRHHCPQPANCREAS1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N000N
PDE4DIPAFLRHHCPQPANCREAS1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N000N
PDE4DIPAFLRHHCPQPANCREAS1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N000N
PDE4DIPAFLRHHCPQPANCREAS1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N000N
PDE4DIPALFLLLPQLPANCREAS1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3Y16110N
PDE4DIPALFLLLPQLPANCREAS1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGY16110N
PDE4DIPALFLLLPQLPANCREAS1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIY16110N
PDE4DIPALFLLLPQLPANCREAS1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NY16110N
PDE4DIPALFLLLPQLPANCREAS1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33Y16110N
PDE4DIPALFLLLPQLPANCREAS1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2Y16110N
PDE4DIPALFLLLPQLPANCREAS1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203Y16110N
PDE4DIPALFLLLPQLPANCREAS1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902Y16110N
PDE4DIPALSSLAAVRPANCREAS1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BXPC3Y6100N
PDE4DIPALSSLAAVRPANCREAS1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35DANGY6100N
PDE4DIPALSSLAAVRPANCREAS1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HPAFIIY6100N
PDE4DIPALSSLAAVRPANCREAS1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KP1NY6100N
PDE4DIPALSSLAAVRPANCREAS1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35L33Y6100N
PDE4DIPALSSLAAVRPANCREAS1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MIAPACA2Y6100N
PDE4DIPALSSLAAVRPANCREAS1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PANC0203Y6100N
PDE4DIPALSSLAAVRPANCREAS1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PATU8902Y6100N
PDE4DIPAPLALSSLAPANCREAS1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N1000N
PDE4DIPAPLALSSLAPANCREAS1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN1000N
PDE4DIPAPLALSSLAPANCREAS1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN1000N
PDE4DIPAPLALSSLAPANCREAS1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN1000N
PDE4DIPAPLALSSLAPANCREAS1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N1000N
PDE4DIPAPLALSSLAPANCREAS1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N1000N
PDE4DIPAPLALSSLAPANCREAS1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N1000N
PDE4DIPAPLALSSLAPANCREAS1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N1000N
PDE4DIPASCLSAPLAPANCREAS1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BXPC3N100N
PDE4DIPASCLSAPLAPANCREAS1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35DANGN100N
PDE4DIPASCLSAPLAPANCREAS1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HPAFIIN100N
PDE4DIPASCLSAPLAPANCREAS1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KP1NN100N
PDE4DIPASCLSAPLAPANCREAS1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35L33N100N
PDE4DIPASCLSAPLAPANCREAS1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MIAPACA2N100N
PDE4DIPASCLSAPLAPANCREAS1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PANC0203N100N
PDE4DIPASCLSAPLAPANCREAS1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PATU8902N100N
PDE4DIPASRGLRPNPPANCREAS1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N000Y
PDE4DIPASRGLRPNPPANCREAS1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN000Y
PDE4DIPASRGLRPNPPANCREAS1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN000Y
PDE4DIPASRGLRPNPPANCREAS1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN000Y
PDE4DIPASRGLRPNPPANCREAS1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N000Y
PDE4DIPASRGLRPNPPANCREAS1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N000Y
PDE4DIPASRGLRPNPPANCREAS1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N000Y
PDE4DIPASRGLRPNPPANCREAS1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N000Y
PDE4DIPATPSACQLPPANCREAS1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N000N
PDE4DIPATPSACQLPPANCREAS1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN000N
PDE4DIPATPSACQLPPANCREAS1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN000N
PDE4DIPATPSACQLPPANCREAS1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN000N
PDE4DIPATPSACQLPPANCREAS1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N000N
PDE4DIPATPSACQLPPANCREAS1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N000N
PDE4DIPATPSACQLPPANCREAS1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N000N
PDE4DIPATPSACQLPPANCREAS1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N000N
PDE4DIPAVRHQWSPWPANCREAS1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BXPC3N100N
PDE4DIPAVRHQWSPWPANCREAS1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35DANGN100N
PDE4DIPAVRHQWSPWPANCREAS1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HPAFIIN100N
PDE4DIPAVRHQWSPWPANCREAS1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KP1NN100N
PDE4DIPAVRHQWSPWPANCREAS1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35L33N100N
PDE4DIPAVRHQWSPWPANCREAS1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MIAPACA2N100N
PDE4DIPAVRHQWSPWPANCREAS1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PANC0203N100N
PDE4DIPAVRHQWSPWPANCREAS1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PATU8902N100N
PDE4DIPCCRSSWEKVPANCREAS1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N100N
PDE4DIPCCRSSWEKVPANCREAS1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN100N
PDE4DIPCCRSSWEKVPANCREAS1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN100N
PDE4DIPCCRSSWEKVPANCREAS1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN100N
PDE4DIPCCRSSWEKVPANCREAS1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N100N
PDE4DIPCCRSSWEKVPANCREAS1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N100N
PDE4DIPCCRSSWEKVPANCREAS1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N100N
PDE4DIPCCRSSWEKVPANCREAS1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N100N
PDE4DIPCLSAPLALSPANCREAS1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N000N
PDE4DIPCLSAPLALSPANCREAS1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN000N
PDE4DIPCLSAPLALSPANCREAS1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN000N
PDE4DIPCLSAPLALSPANCREAS1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN000N
PDE4DIPCLSAPLALSPANCREAS1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N000N
PDE4DIPCLSAPLALSPANCREAS1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N000N
PDE4DIPCLSAPLALSPANCREAS1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N000N
PDE4DIPCLSAPLALSPANCREAS1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N000N
PDE4DIPCPQLHPASCPANCREAS1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N400N
PDE4DIPCPQLHPASCPANCREAS1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN400N
PDE4DIPCPQLHPASCPANCREAS1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN400N
PDE4DIPCPQLHPASCPANCREAS1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN400N
PDE4DIPCPQLHPASCPANCREAS1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N400N
PDE4DIPCPQLHPASCPANCREAS1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N400N
PDE4DIPCPQLHPASCPANCREAS1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N400N
PDE4DIPCPQLHPASCPANCREAS1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N400N
PDE4DIPCQLPRIPPRPANCREAS1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N600Y
PDE4DIPCQLPRIPPRPANCREAS1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN600Y
PDE4DIPCQLPRIPPRPANCREAS1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN600Y
PDE4DIPCQLPRIPPRPANCREAS1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN600Y
PDE4DIPCQLPRIPPRPANCREAS1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N600Y
PDE4DIPCQLPRIPPRPANCREAS1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N600Y
PDE4DIPCQLPRIPPRPANCREAS1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N600Y
PDE4DIPCQLPRIPPRPANCREAS1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N600Y
PDE4DIPCRSSWEKVPPANCREAS1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N000N
PDE4DIPCRSSWEKVPPANCREAS1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN000N
PDE4DIPCRSSWEKVPPANCREAS1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN000N
PDE4DIPCRSSWEKVPPANCREAS1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN000N
PDE4DIPCRSSWEKVPPANCREAS1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N000N
PDE4DIPCRSSWEKVPPANCREAS1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N000N
PDE4DIPCRSSWEKVPPANCREAS1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N000N
PDE4DIPCRSSWEKVPPANCREAS1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N000N
PDE4DIPEKVPALFLLPANCREAS1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BXPC3N800N
PDE4DIPEKVPALFLLPANCREAS1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35DANGN800N
PDE4DIPEKVPALFLLPANCREAS1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HPAFIIN800N
PDE4DIPEKVPALFLLPANCREAS1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KP1NN800N
PDE4DIPEKVPALFLLPANCREAS1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35L33N800N
PDE4DIPEKVPALFLLPANCREAS1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MIAPACA2N800N
PDE4DIPEKVPALFLLPANCREAS1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PANC0203N800N
PDE4DIPEKVPALFLLPANCREAS1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PATU8902N800N
PDE4DIPFIFTPYPSWPANCREAS1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BXPC3N500N
PDE4DIPFIFTPYPSWPANCREAS1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35DANGN500N
PDE4DIPFIFTPYPSWPANCREAS1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HPAFIIN500N
PDE4DIPFIFTPYPSWPANCREAS1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KP1NN500N
PDE4DIPFIFTPYPSWPANCREAS1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35L33N500N
PDE4DIPFIFTPYPSWPANCREAS1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MIAPACA2N500N
PDE4DIPFIFTPYPSWPANCREAS1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PANC0203N500N
PDE4DIPFIFTPYPSWPANCREAS1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PATU8902N500N
PDE4DIPFLLLPQLHCPANCREAS1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N7023N
PDE4DIPFLLLPQLHCPANCREAS1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN7023N
PDE4DIPFLLLPQLHCPANCREAS1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN7023N
PDE4DIPFLLLPQLHCPANCREAS1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN7023N
PDE4DIPFLLLPQLHCPANCREAS1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N7023N
PDE4DIPFLLLPQLHCPANCREAS1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N7023N
PDE4DIPFLLLPQLHCPANCREAS1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N7023N
PDE4DIPFLLLPQLHCPANCREAS1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N7023N
PDE4DIPFLRHHCPQLPANCREAS1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3Y1399N
PDE4DIPFLRHHCPQLPANCREAS1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGY1399N
PDE4DIPFLRHHCPQLPANCREAS1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIY1399N
PDE4DIPFLRHHCPQLPANCREAS1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NY1399N
PDE4DIPFLRHHCPQLPANCREAS1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33Y1399N
PDE4DIPFLRHHCPQLPANCREAS1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2Y1399N
PDE4DIPFLRHHCPQLPANCREAS1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203Y1399N
PDE4DIPFLRHHCPQLPANCREAS1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902Y1399N
PDE4DIPFTPYPSWLAPANCREAS1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BXPC3N602N
PDE4DIPFTPYPSWLAPANCREAS1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35DANGN602N
PDE4DIPFTPYPSWLAPANCREAS1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HPAFIIN602N
PDE4DIPFTPYPSWLAPANCREAS1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KP1NN602N
PDE4DIPFTPYPSWLAPANCREAS1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35L33N602N
PDE4DIPFTPYPSWLAPANCREAS1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MIAPACA2N602N
PDE4DIPFTPYPSWLAPANCREAS1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PANC0203N602N
PDE4DIPFTPYPSWLAPANCREAS1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PATU8902N602N
PDE4DIPGLRPNPTATPANCREAS1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N200N
PDE4DIPGLRPNPTATPANCREAS1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN200N
PDE4DIPGLRPNPTATPANCREAS1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN200N
PDE4DIPGLRPNPTATPANCREAS1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN200N
PDE4DIPGLRPNPTATPANCREAS1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N200N
PDE4DIPGLRPNPTATPANCREAS1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N200N
PDE4DIPGLRPNPTATPANCREAS1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N200N
PDE4DIPGLRPNPTATPANCREAS1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N200N
PDE4DIPHCPQLHPASPANCREAS1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N100N
PDE4DIPHCPQLHPASPANCREAS1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN100N
PDE4DIPHCPQLHPASPANCREAS1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN100N
PDE4DIPHCPQLHPASPANCREAS1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN100N
PDE4DIPHCPQLHPASPANCREAS1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N100N
PDE4DIPHCPQLHPASPANCREAS1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N100N
PDE4DIPHCPQLHPASPANCREAS1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N100N
PDE4DIPHCPQLHPASPANCREAS1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N100N
PDE4DIPHHCPQLHPAPANCREAS1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BXPC3N200N
PDE4DIPHHCPQLHPAPANCREAS1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35DANGN200N
PDE4DIPHHCPQLHPAPANCREAS1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HPAFIIN200N
PDE4DIPHHCPQLHPAPANCREAS1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KP1NN200N
PDE4DIPHHCPQLHPAPANCREAS1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35L33N200N
PDE4DIPHHCPQLHPAPANCREAS1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MIAPACA2N200N
PDE4DIPHHCPQLHPAPANCREAS1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PANC0203N200N
PDE4DIPHHCPQLHPAPANCREAS1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PATU8902N200N
PDE4DIPHPASCLSAPPANCREAS1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N100N
PDE4DIPHPASCLSAPPANCREAS1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN100N
PDE4DIPHPASCLSAPPANCREAS1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN100N
PDE4DIPHPASCLSAPPANCREAS1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN100N
PDE4DIPHPASCLSAPPANCREAS1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N100N
PDE4DIPHPASCLSAPPANCREAS1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N100N
PDE4DIPHPASCLSAPPANCREAS1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N100N
PDE4DIPHPASCLSAPPANCREAS1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N100N
PDE4DIPHQWSPWLRLPANCREAS1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3Y14120Y
PDE4DIPHQWSPWLRLPANCREAS1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGY14120Y
PDE4DIPHQWSPWLRLPANCREAS1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIY14120Y
PDE4DIPHQWSPWLRLPANCREAS1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NY14120Y
PDE4DIPHQWSPWLRLPANCREAS1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33Y14120Y
PDE4DIPHQWSPWLRLPANCREAS1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2Y14120Y
PDE4DIPHQWSPWLRLPANCREAS1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203Y14120Y
PDE4DIPHQWSPWLRLPANCREAS1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902Y14120Y
PDE4DIPIFTPYPSWLPANCREAS1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BXPC3N900N
PDE4DIPIFTPYPSWLPANCREAS1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35DANGN900N
PDE4DIPIFTPYPSWLPANCREAS1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HPAFIIN900N
PDE4DIPIFTPYPSWLPANCREAS1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KP1NN900N
PDE4DIPIFTPYPSWLPANCREAS1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35L33N900N
PDE4DIPIFTPYPSWLPANCREAS1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MIAPACA2N900N
PDE4DIPIFTPYPSWLPANCREAS1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PANC0203N900N
PDE4DIPIFTPYPSWLPANCREAS1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PATU8902N900N
PDE4DIPIPPRRPTRPPANCREAS1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N100N
PDE4DIPIPPRRPTRPPANCREAS1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN100N
PDE4DIPIPPRRPTRPPANCREAS1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN100N
PDE4DIPIPPRRPTRPPANCREAS1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN100N
PDE4DIPIPPRRPTRPPANCREAS1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N100N
PDE4DIPIPPRRPTRPPANCREAS1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N100N
PDE4DIPIPPRRPTRPPANCREAS1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N100N
PDE4DIPIPPRRPTRPPANCREAS1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N100N
PDE4DIPIQAFIFTPYPANCREAS1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BXPC3N900N
PDE4DIPIQAFIFTPYPANCREAS1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35DANGN900N
PDE4DIPIQAFIFTPYPANCREAS1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HPAFIIN900N
PDE4DIPIQAFIFTPYPANCREAS1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KP1NN900N
PDE4DIPIQAFIFTPYPANCREAS1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35L33N900N
PDE4DIPIQAFIFTPYPANCREAS1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MIAPACA2N900N
PDE4DIPIQAFIFTPYPANCREAS1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PANC0203N900N
PDE4DIPIQAFIFTPYPANCREAS1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PATU8902N900N
PDE4DIPKPSSTSASRPANCREAS1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35BXPC3Y490N
PDE4DIPKPSSTSASRPANCREAS1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35DANGY490N
PDE4DIPKPSSTSASRPANCREAS1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35HPAFIIY490N
PDE4DIPKPSSTSASRPANCREAS1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35KP1NY490N
PDE4DIPKPSSTSASRPANCREAS1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35L33Y490N
PDE4DIPKPSSTSASRPANCREAS1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35MIAPACA2Y490N
PDE4DIPKPSSTSASRPANCREAS1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35PANC0203Y490N
PDE4DIPKPSSTSASRPANCREAS1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35PATU8902Y490N
PDE4DIPKVPALFLLLPANCREAS1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3Y1890N
PDE4DIPKVPALFLLLPANCREAS1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGY1890N
PDE4DIPKVPALFLLLPANCREAS1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIY1890N
PDE4DIPKVPALFLLLPANCREAS1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NY1890N
PDE4DIPKVPALFLLLPANCREAS1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33Y1890N
PDE4DIPKVPALFLLLPANCREAS1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2Y1890N
PDE4DIPKVPALFLLLPANCREAS1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203Y1890N
PDE4DIPKVPALFLLLPANCREAS1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902Y1890N
PDE4DIPLAAVRHQWSPANCREAS1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N100N
PDE4DIPLAAVRHQWSPANCREAS1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN100N
PDE4DIPLAAVRHQWSPANCREAS1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN100N
PDE4DIPLAAVRHQWSPANCREAS1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN100N
PDE4DIPLAAVRHQWSPANCREAS1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N100N
PDE4DIPLAAVRHQWSPANCREAS1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N100N
PDE4DIPLAAVRHQWSPANCREAS1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N100N
PDE4DIPLAAVRHQWSPANCREAS1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N100N
PDE4DIPLAFLRHHCPPANCREAS1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35BXPC3N000N
PDE4DIPLAFLRHHCPPANCREAS1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35DANGN000N
PDE4DIPLAFLRHHCPPANCREAS1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HPAFIIN000N
PDE4DIPLAFLRHHCPPANCREAS1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KP1NN000N
PDE4DIPLAFLRHHCPPANCREAS1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35L33N000N
PDE4DIPLAFLRHHCPPANCREAS1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35MIAPACA2N000N
PDE4DIPLAFLRHHCPPANCREAS1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PANC0203N000N
PDE4DIPLAFLRHHCPPANCREAS1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35PATU8902N000N
PDE4DIPLALSSLAAVPANCREAS1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BXPC3N1000N
PDE4DIPLALSSLAAVPANCREAS1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35DANGN1000N
PDE4DIPLALSSLAAVPANCREAS1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HPAFIIN1000N
PDE4DIPLALSSLAAVPANCREAS1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KP1NN1000N
PDE4DIPLALSSLAAVPANCREAS1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35L33N1000N
PDE4DIPLALSSLAAVPANCREAS1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35MIAPACA2N1000N
PDE4DIPLALSSLAAVPANCREAS1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PANC0203N1000N
PDE4DIPLALSSLAAVPANCREAS1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35PATU8902N1000N
PDE4DIPLFLLLPQLHPANCREAS1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35BXPC3N0032N
PDE4DIPLFLLLPQLHPANCREAS1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35DANGN0032N
PDE4DIPLFLLLPQLHPANCREAS1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HPAFIIN0032N
PDE4DIPLFLLLPQLHPANCREAS1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KP1NN0032N
PDE4DIPLFLLLPQLHPANCREAS1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35L33N0032N
PDE4DIPLFLLLPQLHPANCREAS1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35MIAPACA2N0032N
PDE4DIPLFLLLPQLHPANCREAS1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PANC0203N0032N
PDE4DIPLFLLLPQLHPANCREAS1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35PATU8902N0032N
PDE4DIPLHPASCLSAPANCREAS1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35BXPC3N307N
PDE4DIPLHPASCLSAPANCREAS1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35DANGN307N
PDE4DIPLHPASCLSAPANCREAS1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HPAFIIN307N
PDE4DIPLHP