Cancertope

In silico Platform for designing genome-based
Personalized immunotherapy or Vaccine against Cancer

Browse Results ...


The result page of search shows exclusive peptide/epitopes generated due to mutation [Neoepitope], the tissue of origin [Tissue], position of peptide in protein [Position], number of mismatches counted by aligning mutated and normal protein sequence [Num Mismatch, percentage of cell lines with this peptide over total number of cell lines [Promiscuity %]. The immune information include CTL epitopes (Yes/No), MHC I binders, MHC II binders (both given as number of alleles) and B cell epitopes (Yes/No). For more information, please click HERE


Result Reset Search:
ProteinNeoepitopesTissuePositionProt MutationcDNA MutationMutation TypeNum MismatchPromiscuity (%)Cell LineCTLMHC INHLApredMHC IIBcell
ABL1EELRVLGYNOESOPHAGUS105p.K106Ec.316A>GMissense_Mutation10.11KYSE410N500N
ABL1ELRVLGYNHOESOPHAGUS106p.K106Ec.316A>GMissense_Mutation10.11KYSE410N000N
ABL1GEELRVLGYOESOPHAGUS104p.K106Ec.316A>GMissense_Mutation10.11KYSE410Y6130N
ABL1ITKGEELRVOESOPHAGUS101p.K106Ec.316A>GMissense_Mutation10.11KYSE410N200N
ABL1KGEELRVLGOESOPHAGUS103p.K106Ec.316A>GMissense_Mutation10.11KYSE410N000N
ABL1LSITKGEELOESOPHAGUS99p.K106Ec.316A>GMissense_Mutation10.11KYSE410N1402N
ABL1SITKGEELROESOPHAGUS100p.K106Ec.316A>GMissense_Mutation10.11KYSE410N400N
ABL1TKGEELRVLOESOPHAGUS102p.K106Ec.316A>GMissense_Mutation10.11KYSE410N300N
ABL1TLSITKGEEOESOPHAGUS98p.K106Ec.316A>GMissense_Mutation10.11KYSE410N000N
AKAP12AVEECKEEEOESOPHAGUS261p.G269delc.804_806delAGGIn_Frame_Del10.88OE19N000N
AKAP12CKEEEEKQEOESOPHAGUS265p.G269delc.804_806delAGGIn_Frame_Del30.88OE19N000Y
AKAP12ECKEEEEKQOESOPHAGUS264p.G269delc.804_806delAGGIn_Frame_Del30.88OE19N000N
AKAP12EECKEEEEKOESOPHAGUS263p.G269delc.804_806delAGGIn_Frame_Del20.88OE19N000N
AKAP12EEEEKQEKEOESOPHAGUS267p.G269delc.804_806delAGGIn_Frame_Del10.88OE19N000N
AKAP12EEEKQEKEPOESOPHAGUS268p.G269delc.804_806delAGGIn_Frame_Del10.88OE19N000N
AKAP12KEEEEKQEKOESOPHAGUS266p.G269delc.804_806delAGGIn_Frame_Del20.88OE19N300N
AKAP12VEECKEEEEOESOPHAGUS262p.G269delc.804_806delAGGIn_Frame_Del10.88OE19N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86COLO680NN000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYSE140N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYSE180N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYSE270N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYSE30N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYSE410N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYSE450N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYSE520N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYSE70N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OE19N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OE21N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE10N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE11N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE14N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE1N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE5N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE6N000N
AKAP12AIEEDLEPEOESOPHAGUS1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE8N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86COLO680NN000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYSE140N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYSE180N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYSE270N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYSE30N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYSE410N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYSE450N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYSE520N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYSE70N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OE19N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OE21N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE10N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE11N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE14N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE1N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE5N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE6N000N
AKAP12EEDLEPENGOESOPHAGUS1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE8N000N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86COLO680NN200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYSE140N200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYSE180N200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYSE270N200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYSE30N200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYSE410N200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYSE450N200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYSE520N200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYSE70N200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OE19N200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OE21N200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE10N200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE11N200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE14N200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE1N200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE5N200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE6N200N
AKAP12IEEDLEPENOESOPHAGUS1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE8N200N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86COLO680NN000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYSE140N000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYSE180N000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYSE270N000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYSE30N000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYSE410N000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYSE450N000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYSE520N000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYSE70N000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OE19N000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86OE21N000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE10N000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE11N000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE14N000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE1N000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE5N000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE6N000N
AKAP12KVSVAIEEDOESOPHAGUS1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE8N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86COLO680NN000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYSE140N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYSE180N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYSE270N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYSE30N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYSE410N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYSE450N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYSE520N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYSE70N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OE19N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OE21N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE10N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE11N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE14N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE1N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE5N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE6N000N
AKAP12SVAIEEDLEOESOPHAGUS1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE8N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86COLO680NN000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYSE140N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYSE180N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYSE270N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYSE30N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYSE410N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYSE450N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYSE520N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYSE70N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OE19N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86OE21N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE10N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE11N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE14N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE1N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE5N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE6N000N
AKAP12VAIEEDLEPOESOPHAGUS1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE8N000N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86COLO680NN002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYSE140N002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYSE180N002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYSE270N002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYSE30N002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYSE410N002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYSE450N002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYSE520N002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYSE70N002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OE19N002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86OE21N002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE10N002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE11N002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE14N002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE1N002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE5N002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE6N002N
AKAP12VKVSVAIEEOESOPHAGUS1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE8N002N
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86COLO680NN1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYSE140N1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYSE180N1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYSE270N1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYSE30N1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYSE410N1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYSE450N1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYSE520N1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYSE70N1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OE19N1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86OE21N1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE10N1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE11N1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE14N1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE1N1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE5N1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE6N1500Y
AKAP12VSVAIEEDLOESOPHAGUS1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE8N1500Y
AKAP12DTKEDGKAEOESOPHAGUS336p.E338Kc.1012G>AMissense_Mutation10.11KYSE410N000N
AKAP12EKVDTKEDGOESOPHAGUS333p.E338Kc.1012G>AMissense_Mutation10.11KYSE410N000N
AKAP12EPEKVDTKEOESOPHAGUS331p.E338Kc.1012G>AMissense_Mutation10.11KYSE410N000N
AKAP12KEDGKAEVAOESOPHAGUS338p.E338Kc.1012G>AMissense_Mutation10.11KYSE410N600N
AKAP12KVDTKEDGKOESOPHAGUS334p.E338Kc.1012G>AMissense_Mutation10.11KYSE410N600N
AKAP12PEKVDTKEDOESOPHAGUS332p.E338Kc.1012G>AMissense_Mutation10.11KYSE410N000N
AKAP12QEPEKVDTKOESOPHAGUS330p.E338Kc.1012G>AMissense_Mutation10.11KYSE410N200N
AKAP12TKEDGKAEVOESOPHAGUS337p.E338Kc.1012G>AMissense_Mutation10.11KYSE410N100N
AKAP12VDTKEDGKAOESOPHAGUS335p.E338Kc.1012G>AMissense_Mutation10.11KYSE410N400N
AKAP9DLEKTKQLEOESOPHAGUS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27COLO680NN000N
AKAP9DLEKTKQLEOESOPHAGUS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KYSE270N000N
AKAP9DLEKTKQLEOESOPHAGUS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KYSE510N000N
AKAP9DLEKTKQLEOESOPHAGUS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KYSE520N000N
AKAP9DLEKTKQLEOESOPHAGUS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27OE19N000N
AKAP9DLEKTKQLEOESOPHAGUS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27OE21N000N
AKAP9DLEKTKQLEOESOPHAGUS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27OE33N000N
AKAP9DLEKTKQLEOESOPHAGUS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TE10N000N
AKAP9DLEKTKQLEOESOPHAGUS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TE11N000N
AKAP9DLEKTKQLEOESOPHAGUS1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TE9N000N
AKAP9EKTKQLEEQOESOPHAGUS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27COLO680NN000N
AKAP9EKTKQLEEQOESOPHAGUS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KYSE270N000N
AKAP9EKTKQLEEQOESOPHAGUS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KYSE510N000N
AKAP9EKTKQLEEQOESOPHAGUS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KYSE520N000N
AKAP9EKTKQLEEQOESOPHAGUS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27OE19N000N
AKAP9EKTKQLEEQOESOPHAGUS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27OE21N000N
AKAP9EKTKQLEEQOESOPHAGUS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27OE33N000N
AKAP9EKTKQLEEQOESOPHAGUS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TE10N000N
AKAP9EKTKQLEEQOESOPHAGUS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TE11N000N
AKAP9EKTKQLEEQOESOPHAGUS1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TE9N000N
AKAP9KQLEEQVQEOESOPHAGUS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27COLO680NN000N
AKAP9KQLEEQVQEOESOPHAGUS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KYSE270N000N
AKAP9KQLEEQVQEOESOPHAGUS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KYSE510N000N
AKAP9KQLEEQVQEOESOPHAGUS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KYSE520N000N
AKAP9KQLEEQVQEOESOPHAGUS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27OE19N000N
AKAP9KQLEEQVQEOESOPHAGUS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27OE21N000N
AKAP9KQLEEQVQEOESOPHAGUS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27OE33N000N
AKAP9KQLEEQVQEOESOPHAGUS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TE10N000N
AKAP9KQLEEQVQEOESOPHAGUS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TE11N000N
AKAP9KQLEEQVQEOESOPHAGUS1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TE9N000N
AKAP9KTKQLEEQVOESOPHAGUS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27COLO680NN200N
AKAP9KTKQLEEQVOESOPHAGUS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27KYSE270N200N
AKAP9KTKQLEEQVOESOPHAGUS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27KYSE510N200N
AKAP9KTKQLEEQVOESOPHAGUS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27KYSE520N200N
AKAP9KTKQLEEQVOESOPHAGUS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27OE19N200N
AKAP9KTKQLEEQVOESOPHAGUS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27OE21N200N
AKAP9KTKQLEEQVOESOPHAGUS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27OE33N200N
AKAP9KTKQLEEQVOESOPHAGUS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27TE10N200N
AKAP9KTKQLEEQVOESOPHAGUS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27TE11N200N
AKAP9KTKQLEEQVOESOPHAGUS1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27TE9N200N
AKAP9LEKTKQLEEOESOPHAGUS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27COLO680NN000N
AKAP9LEKTKQLEEOESOPHAGUS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KYSE270N000N
AKAP9LEKTKQLEEOESOPHAGUS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KYSE510N000N
AKAP9LEKTKQLEEOESOPHAGUS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KYSE520N000N
AKAP9LEKTKQLEEOESOPHAGUS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27OE19N000N
AKAP9LEKTKQLEEOESOPHAGUS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27OE21N000N
AKAP9LEKTKQLEEOESOPHAGUS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27OE33N000N
AKAP9LEKTKQLEEOESOPHAGUS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TE10N000N
AKAP9LEKTKQLEEOESOPHAGUS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TE11N000N
AKAP9LEKTKQLEEOESOPHAGUS1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TE9N000N
AKAP9LQDLEKTKQOESOPHAGUS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27COLO680NN000N
AKAP9LQDLEKTKQOESOPHAGUS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KYSE270N000N
AKAP9LQDLEKTKQOESOPHAGUS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KYSE510N000N
AKAP9LQDLEKTKQOESOPHAGUS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KYSE520N000N
AKAP9LQDLEKTKQOESOPHAGUS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27OE19N000N
AKAP9LQDLEKTKQOESOPHAGUS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27OE21N000N
AKAP9LQDLEKTKQOESOPHAGUS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27OE33N000N
AKAP9LQDLEKTKQOESOPHAGUS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27TE10N000N
AKAP9LQDLEKTKQOESOPHAGUS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27TE11N000N
AKAP9LQDLEKTKQOESOPHAGUS1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27TE9N000N
AKAP9QDLEKTKQLOESOPHAGUS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27COLO680NN900N
AKAP9QDLEKTKQLOESOPHAGUS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KYSE270N900N
AKAP9QDLEKTKQLOESOPHAGUS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KYSE510N900N
AKAP9QDLEKTKQLOESOPHAGUS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KYSE520N900N
AKAP9QDLEKTKQLOESOPHAGUS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27OE19N900N
AKAP9QDLEKTKQLOESOPHAGUS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27OE21N900N
AKAP9QDLEKTKQLOESOPHAGUS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27OE33N900N
AKAP9QDLEKTKQLOESOPHAGUS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TE10N900N
AKAP9QDLEKTKQLOESOPHAGUS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TE11N900N
AKAP9QDLEKTKQLOESOPHAGUS1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TE9N900N
AKAP9QLEEQVQELOESOPHAGUS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27COLO680NN1200N
AKAP9QLEEQVQELOESOPHAGUS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KYSE270N1200N
AKAP9QLEEQVQELOESOPHAGUS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KYSE510N1200N
AKAP9QLEEQVQELOESOPHAGUS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KYSE520N1200N
AKAP9QLEEQVQELOESOPHAGUS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27OE19N1200N
AKAP9QLEEQVQELOESOPHAGUS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27OE21N1200N
AKAP9QLEEQVQELOESOPHAGUS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27OE33N1200N
AKAP9QLEEQVQELOESOPHAGUS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27TE10N1200N
AKAP9QLEEQVQELOESOPHAGUS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27TE11N1200N
AKAP9QLEEQVQELOESOPHAGUS1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27TE9N1200N
AKAP9TKQLEEQVQOESOPHAGUS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27COLO680NN000N
AKAP9TKQLEEQVQOESOPHAGUS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KYSE270N000N
AKAP9TKQLEEQVQOESOPHAGUS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KYSE510N000N
AKAP9TKQLEEQVQOESOPHAGUS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KYSE520N000N
AKAP9TKQLEEQVQOESOPHAGUS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27OE19N000N
AKAP9TKQLEEQVQOESOPHAGUS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27OE21N000N
AKAP9TKQLEEQVQOESOPHAGUS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27OE33N000N
AKAP9TKQLEEQVQOESOPHAGUS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TE10N000N
AKAP9TKQLEEQVQOESOPHAGUS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TE11N000N
AKAP9TKQLEEQVQOESOPHAGUS1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TE9N000N
AKAP9EMEVELSSMOESOPHAGUS3135p.Q3137Ec.9409C>GMissense_Mutation10.11KYSE510N100Y
AKAP9EVELSSMKDOESOPHAGUS3137p.Q3137Ec.9409C>GMissense_Mutation10.11KYSE510N000N
AKAP9KQSQMLEMEOESOPHAGUS3129p.Q3137Ec.9409C>GMissense_Mutation10.11KYSE510N000N
AKAP9LEMEVELSSOESOPHAGUS3134p.Q3137Ec.9409C>GMissense_Mutation10.11KYSE510N500N
AKAP9MEVELSSMKOESOPHAGUS3136p.Q3137Ec.9409C>GMissense_Mutation10.11KYSE510N202N
AKAP9MLEMEVELSOESOPHAGUS3133p.Q3137Ec.9409C>GMissense_Mutation10.11KYSE510N104N
AKAP9QMLEMEVELOESOPHAGUS3132p.Q3137Ec.9409C>GMissense_Mutation10.11KYSE510N1900N
AKAP9QSQMLEMEVOESOPHAGUS3130p.Q3137Ec.9409C>GMissense_Mutation10.11KYSE510N200N
AKAP9SQMLEMEVEOESOPHAGUS3131p.Q3137Ec.9409C>GMissense_Mutation10.11KYSE510N000N
AKAP9AKVTQTELTOESOPHAGUS1871p.M1879Tc.5636T>CMissense_Mutation10.22TTN100N
AKAP9ELTRESFRQOESOPHAGUS1877p.M1879Tc.5636T>CMissense_Mutation10.22TTN000Y
AKAP9KVTQTELTROESOPHAGUS1872p.M1879Tc.5636T>CMissense_Mutation10.22TTY6100N
AKAP9LTRESFRQKOESOPHAGUS1878p.M1879Tc.5636T>CMissense_Mutation10.22TTN200N
AKAP9QTELTRESFOESOPHAGUS1875p.M1879Tc.5636T>CMissense_Mutation10.22TTN300N
AKAP9TELTRESFROESOPHAGUS1876p.M1879Tc.5636T>CMissense_Mutation10.22TTY090N
AKAP9TQTELTRESOESOPHAGUS1874p.M1879Tc.5636T>CMissense_Mutation10.22TTN000N
AKAP9TRESFRQKQOESOPHAGUS1879p.M1879Tc.5636T>CMissense_Mutation10.22TTN100N
AKAP9VTQTELTREOESOPHAGUS1873p.M1879Tc.5636T>CMissense_Mutation10.22TTN000N
ALKAALGLLQFNOESOPHAGUS161p.V163Lc.487G>TMissense_Mutation10.11KYSE520N200N
ALKAILEGCVGHOESOPHAGUS149p.P157Hc.470C>AMissense_Mutation10.11TE5N000N
ALKALGLLQFNLOESOPHAGUS162p.V163Lc.487G>TMissense_Mutation10.11KYSE520Y10100N
ALKCVGHPGEAAOESOPHAGUS154p.P157Hc.470C>AMissense_Mutation10.11TE5N100N
ALKEAALGLLQFOESOPHAGUS160p.V163Lc.487G>TMissense_Mutation10.11KYSE520Y690N
ALKEGCVGHPGEOESOPHAGUS152p.P157Hc.470C>AMissense_Mutation10.11TE5N000N
ALKFGGGRGGCSOESOPHAGUS921p.G925Rc.2773G>AMissense_Mutation10.11KYSE450N300N
ALKGCVGHPGEAOESOPHAGUS153p.P157Hc.470C>AMissense_Mutation10.11TE5N200N
ALKGEAALGLLQOESOPHAGUS159p.V163Lc.487G>TMissense_Mutation10.11KYSE520N100N
ALKGFGGGRGGCOESOPHAGUS920p.G925Rc.2773G>AMissense_Mutation10.11KYSE450N100N
ALKGGFGGGRGGOESOPHAGUS919p.G925Rc.2773G>AMissense_Mutation10.11KYSE450N000N
ALKGGGRGGCSSOESOPHAGUS922p.G925Rc.2773G>AMissense_Mutation10.11KYSE450N000N
ALKGGRGGCSSGOESOPHAGUS923p.G925Rc.2773G>AMissense_Mutation10.11KYSE450N000N
ALKGHPGEAAVGOESOPHAGUS156p.P157Hc.470C>AMissense_Mutation10.11TE5N000N
ALKGPPGEAALGOESOPHAGUS156p.V163Lc.487G>TMissense_Mutation10.11KYSE520N000Y
ALKGRGGCSSGGOESOPHAGUS924p.G925Rc.2773G>AMissense_Mutation10.11KYSE450N100N
ALKHPGEAAVGLOESOPHAGUS157p.P157Hc.470C>AMissense_Mutation10.11TE5N1600N
ALKILEGCVGHPOESOPHAGUS150p.P157Hc.470C>AMissense_Mutation10.11TE5N000N
ALKLEGCVGHPGOESOPHAGUS151p.P157Hc.470C>AMissense_Mutation10.11TE5N000N
ALKLGLLQFNLSOESOPHAGUS163p.V163Lc.487G>TMissense_Mutation10.11KYSE520N105N
ALKPGEAALGLLOESOPHAGUS158p.V163Lc.487G>TMissense_Mutation10.11KYSE520N000N
ALKPPGEAALGLOESOPHAGUS157p.V163Lc.487G>TMissense_Mutation10.11KYSE520N900N
ALKRGGCSSGGGOESOPHAGUS925p.G925Rc.2773G>AMissense_Mutation10.11KYSE450N000N
ALKRGGFGGGRGOESOPHAGUS918p.G925Rc.2773G>AMissense_Mutation10.11KYSE450N000N
ALKTRGGFGGGROESOPHAGUS917p.G925Rc.2773G>AMissense_Mutation10.11KYSE450N300N
ALKVGHPGEAAVOESOPHAGUS155p.P157Hc.470C>AMissense_Mutation10.11TE5Y7120N
ALKVGPPGEAALOESOPHAGUS155p.V163Lc.487G>TMissense_Mutation10.11KYSE520Y12120N
ALPK2AFKKFLTCPOESOPHAGUS1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27KYSE180N000N
ALPK2DHTAFKKFLOESOPHAGUS1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27KYSE180N600N
ALPK2HTAFKKFLTOESOPHAGUS1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27KYSE180N100N
ALPK2KMDHTAFKKOESOPHAGUS1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27KYSE180N600N
ALPK2LKMDHTAFKOESOPHAGUS1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27KYSE180N1017N
ALPK2MDHTAFKKFOESOPHAGUS1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27KYSE180N600N
ALPK2TAFKKFLTCOESOPHAGUS1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27KYSE180N600N
ALPK2ATRETVTIAOESOPHAGUS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74ECGI10Y1140N
ALPK2ATRETVTIAOESOPHAGUS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74KYSE140Y1140N
ALPK2ATRETVTIAOESOPHAGUS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74KYSE150Y1140N
ALPK2ATRETVTIAOESOPHAGUS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74KYSE270Y1140N
ALPK2ATRETVTIAOESOPHAGUS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74KYSE30Y1140N
ALPK2ATRETVTIAOESOPHAGUS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74KYSE410Y1140N
ALPK2ATRETVTIAOESOPHAGUS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74KYSE70Y1140N
ALPK2ATRETVTIAOESOPHAGUS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74OE21Y1140N
ALPK2ATRETVTIAOESOPHAGUS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74TE4Y1140N
ALPK2ATRETVTIAOESOPHAGUS1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74TE6Y1140N
ALPK2CFQATRETVOESOPHAGUS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74ECGI10Y2110N
ALPK2CFQATRETVOESOPHAGUS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KYSE140Y2110N
ALPK2CFQATRETVOESOPHAGUS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KYSE150Y2110N
ALPK2CFQATRETVOESOPHAGUS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KYSE270Y2110N
ALPK2CFQATRETVOESOPHAGUS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KYSE30Y2110N
ALPK2CFQATRETVOESOPHAGUS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KYSE410Y2110N
ALPK2CFQATRETVOESOPHAGUS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KYSE70Y2110N
ALPK2CFQATRETVOESOPHAGUS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74OE21Y2110N
ALPK2CFQATRETVOESOPHAGUS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74TE4Y2110N
ALPK2CFQATRETVOESOPHAGUS998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74TE6Y2110N
ALPK2ETVTIATEVOESOPHAGUS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74ECGI10N400N
ALPK2ETVTIATEVOESOPHAGUS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KYSE140N400N
ALPK2ETVTIATEVOESOPHAGUS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KYSE150N400N
ALPK2ETVTIATEVOESOPHAGUS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KYSE270N400N
ALPK2ETVTIATEVOESOPHAGUS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KYSE30N400N
ALPK2ETVTIATEVOESOPHAGUS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KYSE410N400N
ALPK2ETVTIATEVOESOPHAGUS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KYSE70N400N
ALPK2ETVTIATEVOESOPHAGUS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74OE21N400N
ALPK2ETVTIATEVOESOPHAGUS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74TE4N400N
ALPK2ETVTIATEVOESOPHAGUS1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74TE6N400N
ALPK2FQATRETVTOESOPHAGUS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74ECGI10N600N
ALPK2FQATRETVTOESOPHAGUS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KYSE140N600N
ALPK2FQATRETVTOESOPHAGUS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KYSE150N600N
ALPK2FQATRETVTOESOPHAGUS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KYSE270N600N
ALPK2FQATRETVTOESOPHAGUS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KYSE30N600N
ALPK2FQATRETVTOESOPHAGUS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KYSE410N600N
ALPK2FQATRETVTOESOPHAGUS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KYSE70N600N
ALPK2FQATRETVTOESOPHAGUS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74OE21N600N
ALPK2FQATRETVTOESOPHAGUS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74TE4N600N
ALPK2FQATRETVTOESOPHAGUS999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74TE6N600N
ALPK2QATRETVTIOESOPHAGUS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74ECGI10N600N
ALPK2QATRETVTIOESOPHAGUS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KYSE140N600N
ALPK2QATRETVTIOESOPHAGUS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KYSE150N600N
ALPK2QATRETVTIOESOPHAGUS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KYSE270N600N
ALPK2QATRETVTIOESOPHAGUS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KYSE30N600N
ALPK2QATRETVTIOESOPHAGUS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KYSE410N600N
ALPK2QATRETVTIOESOPHAGUS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KYSE70N600N
ALPK2QATRETVTIOESOPHAGUS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74OE21N600N
ALPK2QATRETVTIOESOPHAGUS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74TE4N600N
ALPK2QATRETVTIOESOPHAGUS1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74TE6N600N
ALPK2RETVTIATEOESOPHAGUS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74ECGI10N100N
ALPK2RETVTIATEOESOPHAGUS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KYSE140N100N
ALPK2RETVTIATEOESOPHAGUS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KYSE150N100N
ALPK2RETVTIATEOESOPHAGUS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KYSE270N100N
ALPK2RETVTIATEOESOPHAGUS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KYSE30N100N
ALPK2RETVTIATEOESOPHAGUS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KYSE410N100N
ALPK2RETVTIATEOESOPHAGUS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KYSE70N100N
ALPK2RETVTIATEOESOPHAGUS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74OE21N100N
ALPK2RETVTIATEOESOPHAGUS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74TE4N100N
ALPK2RETVTIATEOESOPHAGUS1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74TE6N100N
ALPK2TRETVTIATOESOPHAGUS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74ECGI10N200N
ALPK2TRETVTIATOESOPHAGUS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KYSE140N200N
ALPK2TRETVTIATOESOPHAGUS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KYSE150N200N
ALPK2TRETVTIATOESOPHAGUS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KYSE270N200N
ALPK2TRETVTIATOESOPHAGUS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KYSE30N200N
ALPK2TRETVTIATOESOPHAGUS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KYSE410N200N
ALPK2TRETVTIATOESOPHAGUS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KYSE70N200N
ALPK2TRETVTIATOESOPHAGUS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74OE21N200N
ALPK2TRETVTIATOESOPHAGUS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74TE4N200N
ALPK2TRETVTIATOESOPHAGUS1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74TE6N200N
ATMAADIWRKLLOESOPHAGUS920p.R924Wc.2770C>TMissense_Mutation10.11KYSE410N1000N
ATMADIWRKLLMOESOPHAGUS921p.R924Wc.2770C>TMissense_Mutation10.11KYSE410N500N
ATMDIWRKLLMLOESOPHAGUS922p.R924Wc.2770C>TMissense_Mutation10.11KYSE410Y1390N
ATMEPTKSLHVHOESOPHAGUS937p.L944Vc.2830C>GMissense_Mutation10.11TE11N000N
ATMFRAADIWRKOESOPHAGUS918p.R924Wc.2770C>TMissense_Mutation10.11KYSE410Y4917N
ATMFSVRQNLKEOESOPHAGUS680p.H683Rc.2048A>GMissense_Mutation10.11COLO680NN202N
ATMGFSVRQNLKOESOPHAGUS679p.H683Rc.2048A>GMissense_Mutation10.11COLO680NY1100N
ATMHVHMYLMLLOESOPHAGUS943p.L944Vc.2830C>GMissense_Mutation10.11TE11Y9100N
ATMIGFSVRQNLOESOPHAGUS678p.H683Rc.2048A>GMissense_Mutation10.11COLO680NN1902N
ATMIWRKLLMLIOESOPHAGUS923p.R924Wc.2770C>TMissense_Mutation10.11KYSE410N805N
ATMKSLHVHMYLOESOPHAGUS940p.L944Vc.2830C>GMissense_Mutation10.11TE11Y1790N
ATMLEPTKSLHVOESOPHAGUS936p.L944Vc.2830C>GMissense_Mutation10.11TE11N1002N
ATMLHVHMYLMLOESOPHAGUS942p.L944Vc.2830C>GMissense_Mutation10.11TE11N905N
ATMPTKSLHVHMOESOPHAGUS938p.L944Vc.2830C>GMissense_Mutation10.11TE11N100N
ATMQSSIGFSVROESOPHAGUS675p.H683Rc.2048A>GMissense_Mutation10.11COLO680NY390N
ATMRAADIWRKLOESOPHAGUS919p.R924Wc.2770C>TMissense_Mutation10.11KYSE410Y1690N
ATMRQNLKESLDOESOPHAGUS683p.H683Rc.2048A>GMissense_Mutation10.11COLO680NN000N
ATMSFRAADIWROESOPHAGUS917p.R924Wc.2770C>TMissense_Mutation10.11KYSE410N200N
ATMSIGFSVRQNOESOPHAGUS677p.H683Rc.2048A>GMissense_Mutation10.11COLO680NN000N
ATMSLHVHMYLMOESOPHAGUS941p.L944Vc.2830C>GMissense_Mutation10.11TE11Y690N
ATMSSIGFSVRQOESOPHAGUS676p.H683Rc.2048A>GMissense_Mutation10.11COLO680NN000N
ATMSVRQNLKESOESOPHAGUS681p.H683Rc.2048A>GMissense_Mutation10.11COLO680NN100N
ATMTKSLHVHMYOESOPHAGUS939p.L944Vc.2830C>GMissense_Mutation10.11TE11N200N
ATMVHMYLMLLKOESOPHAGUS944p.L944Vc.2830C>GMissense_Mutation10.11TE11N0012N
ATMVRQNLKESLOESOPHAGUS682p.H683Rc.2048A>GMissense_Mutation10.11COLO680NN808N
ATMVSFRAADIWOESOPHAGUS916p.R924Wc.2770C>TMissense_Mutation10.11KYSE410N900N
ATMWRKLLMLIDOESOPHAGUS924p.R924Wc.2770C>TMissense_Mutation10.11KYSE410N307N
CARD10DPLTLWDLDOESOPHAGUS751p.R756Wc.2266C>TMissense_Mutation10.11TE11N000Y
CARD10LTLWDLDRGOESOPHAGUS753p.R756Wc.2266C>TMissense_Mutation10.11TE11N000N
CARD10LWDLDRGTVOESOPHAGUS755p.R756Wc.2266C>TMissense_Mutation10.11TE11N300N
CARD10PLTLWDLDROESOPHAGUS752p.R756Wc.2266C>TMissense_Mutation10.11TE11N200N
CARD10RVDPLTLWDOESOPHAGUS749p.R756Wc.2266C>TMissense_Mutation10.11TE11N100N
CARD10TLWDLDRGTOESOPHAGUS754p.R756Wc.2266C>TMissense_Mutation10.11TE11N300N
CARD10TRVDPLTLWOESOPHAGUS748p.R756Wc.2266C>TMissense_Mutation10.11TE11N300N
CARD10VDPLTLWDLOESOPHAGUS750p.R756Wc.2266C>TMissense_Mutation10.11TE11N1000N
CARD10WDLDRGTVPOESOPHAGUS756p.R756Wc.2266C>TMissense_Mutation10.11TE11N200N
CBLALHEVHLISOESOPHAGUS208p.P214Lc.641C>TMissense_Mutation10.11KYSE180N000N
CBLEVHLISSGLOESOPHAGUS211p.P214Lc.641C>TMissense_Mutation10.11KYSE180N800N
CBLHEVHLISSGOESOPHAGUS210p.P214Lc.641C>TMissense_Mutation10.11KYSE180N200N
CBLHLISSGLEAOESOPHAGUS213p.P214Lc.641C>TMissense_Mutation10.11KYSE180N300N
CBLLHEVHLISSOESOPHAGUS209p.P214Lc.641C>TMissense_Mutation10.11KYSE180N200N
CBLLISSGLEAMOESOPHAGUS214p.P214Lc.641C>TMissense_Mutation10.11KYSE180N301N
CBLQALHEVHLIOESOPHAGUS207p.P214Lc.641C>TMissense_Mutation10.11KYSE180Y10110N
CBLRQALHEVHLOESOPHAGUS206p.P214Lc.641C>TMissense_Mutation10.11KYSE180Y11100N
CBLVHLISSGLEOESOPHAGUS212p.P214Lc.641C>TMissense_Mutation10.11KYSE180N005N
CDH1DGGQFVVTKOESOPHAGUS419p.T427Kc.1280C>AMissense_Mutation10.11KYSE510N000N
CDH1FVVTKNPVNOESOPHAGUS423p.T427Kc.1280C>AMissense_Mutation10.11KYSE510N204N
CDH1GGQFVVTKNOESOPHAGUS420p.T427Kc.1280C>AMissense_Mutation10.11KYSE510N100Y
CDH1GQFVVTKNPOESOPHAGUS421p.T427Kc.1280C>AMissense_Mutation10.11KYSE510N000Y
CDH1ITVKRPLWFOESOPHAGUS83p.R90Wc.268C>TMissense_Mutation10.11OE19Y6910N
CDH1KNPVNNDGIOESOPHAGUS427p.T427Kc.1280C>AMissense_Mutation10.11KYSE510N500N
CDH1KRPLWFHNPOESOPHAGUS86p.R90Wc.268C>TMissense_Mutation10.11OE19N200N
CDH1LWFHNPQIHOESOPHAGUS89p.R90Wc.268C>TMissense_Mutation10.11OE19N007N
CDH1PLWFHNPQIOESOPHAGUS88p.R90Wc.268C>TMissense_Mutation10.11OE19N100N
CDH1QFVVTKNPVOESOPHAGUS422p.T427Kc.1280C>AMissense_Mutation10.11KYSE510N300N
CDH1RPLWFHNPQOESOPHAGUS87p.R90Wc.268C>TMissense_Mutation10.11OE19N100N
CDH1TKNPVNNDGOESOPHAGUS426p.T427Kc.1280C>AMissense_Mutation10.11KYSE510N000N
CDH1TVKRPLWFHOESOPHAGUS84p.R90Wc.268C>TMissense_Mutation10.11OE19Y0120N
CDH1VITVKRPLWOESOPHAGUS82p.R90Wc.268C>TMissense_Mutation10.11OE19N100N
CDH1VKRPLWFHNOESOPHAGUS85p.R90Wc.268C>TMissense_Mutation10.11OE19N100N
CDH1VTKNPVNNDOESOPHAGUS425p.T427Kc.1280C>AMissense_Mutation10.11KYSE510N000N
CDH1VVTKNPVNNOESOPHAGUS424p.T427Kc.1280C>AMissense_Mutation10.11KYSE510N1013N
CDH1WFHNPQIHFOESOPHAGUS90p.R90Wc.268C>TMissense_Mutation10.11OE19Y892N
CDH1AYTLVVQAAOESOPHAGUS340p.T340Ac.1018A>GMissense_Mutation10.33TE4Y3100N
CDH1DRESFPAYTOESOPHAGUS334p.T340Ac.1018A>GMissense_Mutation10.33TE4N100Y
CDH1ESFPAYTLVOESOPHAGUS336p.T340Ac.1018A>GMissense_Mutation10.33TE4Y12100N
CDH1FPAYTLVVQOESOPHAGUS338p.T340Ac.1018A>GMissense_Mutation10.33TE4N303N
CDH1GLDRESFPAOESOPHAGUS332p.T340Ac.1018A>GMissense_Mutation10.33TE4N300N
CDH1LDRESFPAYOESOPHAGUS333p.T340Ac.1018A>GMissense_Mutation10.33TE4N500Y
CDH1PAYTLVVQAOESOPHAGUS339p.T340Ac.1018A>GMissense_Mutation10.33TE4N300N
CDH1RESFPAYTLOESOPHAGUS335p.T340Ac.1018A>GMissense_Mutation10.33TE4Y9100N
CDH1SFPAYTLVVOESOPHAGUS337p.T340Ac.1018A>GMissense_Mutation10.33TE4N500N
CHD1DQRSYGSRSOESOPHAGUS1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86COLO680NN100N
CHD1DQRSYGSRSOESOPHAGUS1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86KYSE70N100N
CHD1DQRSYGSRSOESOPHAGUS1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86OE19N100N
CHD1DQRSYGSRSOESOPHAGUS1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86TE11N100N
CHD1DQRSYGSRSOESOPHAGUS1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86TE5N100N
CHD1DQRSYGSRSOESOPHAGUS1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86TE6N100N
CHD1LDQRSYGSROESOPHAGUS1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86COLO680NN000N
CHD1LDQRSYGSROESOPHAGUS1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86KYSE70N000N
CHD1LDQRSYGSROESOPHAGUS1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86OE19N000N
CHD1LDQRSYGSROESOPHAGUS1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86TE11N000N
CHD1LDQRSYGSROESOPHAGUS1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86TE5N000N
CHD1LDQRSYGSROESOPHAGUS1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86TE6N000N
CHD1PLDQRSYGSOESOPHAGUS1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86COLO680NN000N
CHD1PLDQRSYGSOESOPHAGUS1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86KYSE70N000N
CHD1PLDQRSYGSOESOPHAGUS1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86OE19N000N
CHD1PLDQRSYGSOESOPHAGUS1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86TE11N000N
CHD1PLDQRSYGSOESOPHAGUS1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86TE5N000N
CHD1PLDQRSYGSOESOPHAGUS1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86TE6N000N
CHD1QRSYGSRSPOESOPHAGUS1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86COLO680NN000N
CHD1QRSYGSRSPOESOPHAGUS1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86KYSE70N000N
CHD1QRSYGSRSPOESOPHAGUS1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86OE19N000N
CHD1QRSYGSRSPOESOPHAGUS1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86TE11N000N
CHD1QRSYGSRSPOESOPHAGUS1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86TE5N000N
CHD1QRSYGSRSPOESOPHAGUS1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86TE6N000N
CHD1RSPLDQRSYOESOPHAGUS1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86COLO680NN600N
CHD1RSPLDQRSYOESOPHAGUS1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86KYSE70N600N
CHD1RSPLDQRSYOESOPHAGUS1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86OE19N600N
CHD1RSPLDQRSYOESOPHAGUS1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86TE11N600N
CHD1RSPLDQRSYOESOPHAGUS1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86TE5N600N
CHD1RSPLDQRSYOESOPHAGUS1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86TE6N600N
CHD1RSYGSRSPFOESOPHAGUS1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86COLO680NN900N
CHD1RSYGSRSPFOESOPHAGUS1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86KYSE70N900N
CHD1RSYGSRSPFOESOPHAGUS1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86OE19N900N
CHD1RSYGSRSPFOESOPHAGUS1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86TE11N900N
CHD1RSYGSRSPFOESOPHAGUS1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86TE5N900N
CHD1RSYGSRSPFOESOPHAGUS1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86TE6N900N
CHD1SPLDQRSYGOESOPHAGUS1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86COLO680NN000N
CHD1SPLDQRSYGOESOPHAGUS1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86KYSE70N000N
CHD1SPLDQRSYGOESOPHAGUS1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86OE19N000N
CHD1SPLDQRSYGOESOPHAGUS1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86TE11N000N
CHD1SPLDQRSYGOESOPHAGUS1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86TE5N000N
CHD1SPLDQRSYGOESOPHAGUS1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86TE6N000N
CHD1SYGSRSPFEOESOPHAGUS1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86COLO680NN000N
CHD1SYGSRSPFEOESOPHAGUS1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86KYSE70N000N
CHD1SYGSRSPFEOESOPHAGUS1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86OE19N000N
CHD1SYGSRSPFEOESOPHAGUS1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86TE11N000N
CHD1SYGSRSPFEOESOPHAGUS1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86TE5N000N
CHD1SYGSRSPFEOESOPHAGUS1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86TE6N000N
CHD1GTPVQNSLKOESOPHAGUS643p.L646Vc.1936C>GMissense_Mutation10.11COLO680NN300N
CHD1ITGTPVQNSOESOPHAGUS641p.L646Vc.1936C>GMissense_Mutation10.11COLO680NN002N
CHD1LITGTPVQNOESOPHAGUS640p.L646Vc.1936C>GMissense_Mutation10.11COLO680NN000N
CHD1LLITGTPVQOESOPHAGUS639p.L646Vc.1936C>GMissense_Mutation10.11COLO680NN1027N
CHD1PVQNSLKELOESOPHAGUS645p.L646Vc.1936C>GMissense_Mutation10.11COLO680NN100N
CHD1RLLITGTPVOESOPHAGUS638p.L646Vc.1936C>GMissense_Mutation10.11COLO680NY790N
CHD1TGTPVQNSLOESOPHAGUS642p.L646Vc.1936C>GMissense_Mutation10.11COLO680NN1200N
CHD1TPVQNSLKEOESOPHAGUS644p.L646Vc.1936C>GMissense_Mutation10.11COLO680NN000N
CHD1VQNSLKELWOESOPHAGUS646p.L646Vc.1936C>GMissense_Mutation10.11COLO680NN505N
CREB3L2FTHITSDSFOESOPHAGUS95p.T100delc.299_301delCCAIn_Frame_Del444.47ECGI10N801N
CREB3L2FTHITSDSFOESOPHAGUS95p.T100delc.299_301delCCAIn_Frame_Del444.47KYSE140N801N
CREB3L2FTHITSDSFOESOPHAGUS95p.T100delc.299_301delCCAIn_Frame_Del444.47KYSE270N801N
CREB3L2FTHITSDSFOESOPHAGUS95p.T100delc.299_301delCCAIn_Frame_Del444.47KYSE410N801N
CREB3L2FTHITSDSFOESOPHAGUS95p.T100delc.299_301delCCAIn_Frame_Del444.47KYSE70N801N
CREB3L2FTHITSDSFOESOPHAGUS95p.T100delc.299_301delCCAIn_Frame_Del444.47OE21N801N
CREB3L2FTHITSDSFOESOPHAGUS95p.T100delc.299_301delCCAIn_Frame_Del444.47TE10N801N
CREB3L2FTHITSDSFOESOPHAGUS95p.T100delc.299_301delCCAIn_Frame_Del444.47TE11N801N
CREB3L2FTHITSDSFOESOPHAGUS95p.T100delc.299_301delCCAIn_Frame_Del444.47TE1N801N
CREB3L2FTHITSDSFOESOPHAGUS95p.T100delc.299_301delCCAIn_Frame_Del444.47TE6N801N
CREB3L2FTHITSDSFOESOPHAGUS95p.T100delc.299_301delCCAIn_Frame_Del444.47TTN801N
CREB3L2HITSDSFNDOESOPHAGUS97p.T100delc.299_301delCCAIn_Frame_Del244.47ECGI10N000N
CREB3L2HITSDSFNDOESOPHAGUS97p.T100delc.299_301delCCAIn_Frame_Del244.47KYSE140N000N
CREB3L2HITSDSFNDOESOPHAGUS97p.T100delc.299_301delCCAIn_Frame_Del244.47KYSE270N000N
CREB3L2HITSDSFNDOESOPHAGUS97p.T100delc.299_301delCCAIn_Frame_Del244.47KYSE410N000N
CREB3L2HITSDSFNDOESOPHAGUS97p.T100delc.299_301delCCAIn_Frame_Del244.47KYSE70N000N
CREB3L2HITSDSFNDOESOPHAGUS97p.T100delc.299_301delCCAIn_Frame_Del244.47OE21N000N
CREB3L2HITSDSFNDOESOPHAGUS97p.T100delc.299_301delCCAIn_Frame_Del244.47TE10N000N
CREB3L2HITSDSFNDOESOPHAGUS97p.T100delc.299_301delCCAIn_Frame_Del244.47TE11N000N
CREB3L2HITSDSFNDOESOPHAGUS97p.T100delc.299_301delCCAIn_Frame_Del244.47TE1N000N
CREB3L2HITSDSFNDOESOPHAGUS97p.T100delc.299_301delCCAIn_Frame_Del244.47TE6N000N
CREB3L2HITSDSFNDOESOPHAGUS97p.T100delc.299_301delCCAIn_Frame_Del244.47TTN000N
CREB3L2ITSDSFNDDOESOPHAGUS98p.T100delc.299_301delCCAIn_Frame_Del144.47ECGI10N000N
CREB3L2ITSDSFNDDOESOPHAGUS98p.T100delc.299_301delCCAIn_Frame_Del144.47KYSE140N000N
CREB3L2ITSDSFNDDOESOPHAGUS98p.T100delc.299_301delCCAIn_Frame_Del144.47KYSE270N000N
CREB3L2ITSDSFNDDOESOPHAGUS98p.T100delc.299_301delCCAIn_Frame_Del144.47KYSE410N000N
CREB3L2ITSDSFNDDOESOPHAGUS98p.T100delc.299_301delCCAIn_Frame_Del144.47KYSE70N000N
CREB3L2ITSDSFNDDOESOPHAGUS98p.T100delc.299_301delCCAIn_Frame_Del144.47OE21N000N
CREB3L2ITSDSFNDDOESOPHAGUS98p.T100delc.299_301delCCAIn_Frame_Del144.47TE10N000N
CREB3L2ITSDSFNDDOESOPHAGUS98p.T100delc.299_301delCCAIn_Frame_Del144.47TE11N000N
CREB3L2ITSDSFNDDOESOPHAGUS98p.T100delc.299_301delCCAIn_Frame_Del144.47TE1N000N
CREB3L2ITSDSFNDDOESOPHAGUS98p.T100delc.299_301delCCAIn_Frame_Del144.47TE6N000N
CREB3L2ITSDSFNDDOESOPHAGUS98p.T100delc.299_301delCCAIn_Frame_Del144.47TTN000N
CREB3L2PFTHITSDSOESOPHAGUS94p.T100delc.299_301delCCAIn_Frame_Del344.47ECGI10N000N
CREB3L2PFTHITSDSOESOPHAGUS94p.T100delc.299_301delCCAIn_Frame_Del344.47KYSE140N000N
CREB3L2PFTHITSDSOESOPHAGUS94p.T100delc.299_301delCCAIn_Frame_Del344.47KYSE270N000N
CREB3L2PFTHITSDSOESOPHAGUS94p.T100delc.299_301delCCAIn_Frame_Del344.47KYSE410N000N
CREB3L2PFTHITSDSOESOPHAGUS94p.T100delc.299_301delCCAIn_Frame_Del344.47KYSE70N000N
CREB3L2PFTHITSDSOESOPHAGUS94p.T100delc.299_301delCCAIn_Frame_Del344.47OE21N000N
CREB3L2PFTHITSDSOESOPHAGUS94p.T100delc.299_301delCCAIn_Frame_Del344.47TE10N000N
CREB3L2PFTHITSDSOESOPHAGUS94p.T100delc.299_301delCCAIn_Frame_Del344.47TE11N000N
CREB3L2PFTHITSDSOESOPHAGUS94p.T100delc.299_301delCCAIn_Frame_Del344.47TE1N000N
CREB3L2PFTHITSDSOESOPHAGUS94p.T100delc.299_301delCCAIn_Frame_Del344.47TE6N000N
CREB3L2PFTHITSDSOESOPHAGUS94p.T100delc.299_301delCCAIn_Frame_Del344.47TTN000N
CREB3L2QSPFTHITSOESOPHAGUS92p.T100delc.299_301delCCAIn_Frame_Del144.47ECGI10N000N
CREB3L2QSPFTHITSOESOPHAGUS92p.T100delc.299_301delCCAIn_Frame_Del144.47KYSE140N000N
CREB3L2QSPFTHITSOESOPHAGUS92p.T100delc.299_301delCCAIn_Frame_Del144.47KYSE270N000N
CREB3L2QSPFTHITSOESOPHAGUS92p.T100delc.299_301delCCAIn_Frame_Del144.47KYSE410N000N
CREB3L2QSPFTHITSOESOPHAGUS92p.T100delc.299_301delCCAIn_Frame_Del144.47KYSE70N000N
CREB3L2QSPFTHITSOESOPHAGUS92p.T100delc.299_301delCCAIn_Frame_Del144.47OE21N000N
CREB3L2QSPFTHITSOESOPHAGUS92p.T100delc.299_301delCCAIn_Frame_Del144.47TE10N000N
CREB3L2QSPFTHITSOESOPHAGUS92p.T100delc.299_301delCCAIn_Frame_Del144.47TE11N000N
CREB3L2QSPFTHITSOESOPHAGUS92p.T100delc.299_301delCCAIn_Frame_Del144.47TE1N000N
CREB3L2QSPFTHITSOESOPHAGUS92p.T100delc.299_301delCCAIn_Frame_Del144.47TE6N000N
CREB3L2QSPFTHITSOESOPHAGUS92p.T100delc.299_301delCCAIn_Frame_Del144.47TTN000N
CREB3L2SPFTHITSDOESOPHAGUS93p.T100delc.299_301delCCAIn_Frame_Del244.47ECGI10N100N
CREB3L2SPFTHITSDOESOPHAGUS93p.T100delc.299_301delCCAIn_Frame_Del244.47KYSE140N100N
CREB3L2SPFTHITSDOESOPHAGUS93p.T100delc.299_301delCCAIn_Frame_Del244.47KYSE270N100N
CREB3L2SPFTHITSDOESOPHAGUS93p.T100delc.299_301delCCAIn_Frame_Del244.47KYSE410N100N
CREB3L2SPFTHITSDOESOPHAGUS93p.T100delc.299_301delCCAIn_Frame_Del244.47KYSE70N100N
CREB3L2SPFTHITSDOESOPHAGUS93p.T100delc.299_301delCCAIn_Frame_Del244.47OE21N100N
CREB3L2SPFTHITSDOESOPHAGUS93p.T100delc.299_301delCCAIn_Frame_Del244.47TE10N100N
CREB3L2SPFTHITSDOESOPHAGUS93p.T100delc.299_301delCCAIn_Frame_Del244.47TE11N100N
CREB3L2SPFTHITSDOESOPHAGUS93p.T100delc.299_301delCCAIn_Frame_Del244.47TE1N100N
CREB3L2SPFTHITSDOESOPHAGUS93p.T100delc.299_301delCCAIn_Frame_Del244.47TE6N100N
CREB3L2SPFTHITSDOESOPHAGUS93p.T100delc.299_301delCCAIn_Frame_Del244.47TTN100N
CREB3L2THITSDSFNOESOPHAGUS96p.T100delc.299_301delCCAIn_Frame_Del344.47ECGI10N100N
CREB3L2THITSDSFNOESOPHAGUS96p.T100delc.299_301delCCAIn_Frame_Del344.47KYSE140N100N
CREB3L2THITSDSFNOESOPHAGUS96p.T100delc.299_301delCCAIn_Frame_Del344.47KYSE270N100N
CREB3L2THITSDSFNOESOPHAGUS96p.T100delc.299_301delCCAIn_Frame_Del344.47KYSE410N100N
CREB3L2THITSDSFNOESOPHAGUS96p.T100delc.299_301delCCAIn_Frame_Del344.47KYSE70N100N
CREB3L2THITSDSFNOESOPHAGUS96p.T100delc.299_301delCCAIn_Frame_Del344.47OE21N100N
CREB3L2THITSDSFNOESOPHAGUS96p.T100delc.299_301delCCAIn_Frame_Del344.47TE10N100N
CREB3L2THITSDSFNOESOPHAGUS96p.T100delc.299_301delCCAIn_Frame_Del344.47TE11N100N
CREB3L2THITSDSFNOESOPHAGUS96p.T100delc.299_301delCCAIn_Frame_Del344.47TE1N100N
CREB3L2THITSDSFNOESOPHAGUS96p.T100delc.299_301delCCAIn_Frame_Del344.47TE6N100N
CREB3L2THITSDSFNOESOPHAGUS96p.T100delc.299_301delCCAIn_Frame_Del344.47TTN100N
CREB3L2ALKKIQRKIOESOPHAGUS294p.R299Qc.896G>AMissense_Mutation10.11TE10Y6120N
CREB3L2EEKALKKIQOESOPHAGUS291p.R299Qc.896G>AMissense_Mutation10.11TE10N100N
CREB3L2EKALKKIQROESOPHAGUS292p.R299Qc.896G>AMissense_Mutation10.11TE10N100N
CREB3L2IQRKIKNKIOESOPHAGUS298p.R299Qc.896G>AMissense_Mutation10.11TE10N10021N
CREB3L2KALKKIQRKOESOPHAGUS293p.R299Qc.896G>AMissense_Mutation10.11TE10N500N
CREB3L2KIQRKIKNKOESOPHAGUS297p.R299Qc.896G>AMissense_Mutation10.11TE10Y3120N
CREB3L2KKIQRKIKNOESOPHAGUS296p.R299Qc.896G>AMissense_Mutation10.11TE10N100N
CREB3L2LKKIQRKIKOESOPHAGUS295p.R299Qc.896G>AMissense_Mutation10.11TE10N107N
CREB3L2QRKIKNKISOESOPHAGUS299p.R299Qc.896G>AMissense_Mutation10.11TE10N200N
CTBP2APSPNQPTNOESOPHAGUS966p.K974fsc.2922_2922delAFrame_Shift_Del124.34COLO680NN300N
CTBP2APSPNQPTNOESOPHAGUS966p.K974fsc.2922_2922delAFrame_Shift_Del124.34KYSE150N300N
CTBP2APSPNQPTNOESOPHAGUS966p.K974fsc.2922_2922delAFrame_Shift_Del124.34TE10N300N
CTBP2APSPNQPTNOESOPHAGUS966p.K974fsc.2922_2922delAFrame_Shift_Del124.34TE8N300N
CTBP2GTIESTPTSOESOPHAGUS976p.K974fsc.2922_2922delAFrame_Shift_Del524.34COLO680NN100N
CTBP2GTIESTPTSOESOPHAGUS976p.K974fsc.2922_2922delAFrame_Shift_Del524.34KYSE150N100N
CTBP2GTIESTPTSOESOPHAGUS976p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE10N100N
CTBP2GTIESTPTSOESOPHAGUS976p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE8N100N
CTBP2NQPTNTGTIOESOPHAGUS970p.K974fsc.2922_2922delAFrame_Shift_Del424.34COLO680NN1000N
CTBP2NQPTNTGTIOESOPHAGUS970p.K974fsc.2922_2922delAFrame_Shift_Del424.34KYSE150N1000N
CTBP2NQPTNTGTIOESOPHAGUS970p.K974fsc.2922_2922delAFrame_Shift_Del424.34TE10N1000N
CTBP2NQPTNTGTIOESOPHAGUS970p.K974fsc.2922_2922delAFrame_Shift_Del424.34TE8N1000N
CTBP2NTGTIESTPOESOPHAGUS974p.K974fsc.2922_2922delAFrame_Shift_Del524.34COLO680NN000N
CTBP2NTGTIESTPOESOPHAGUS974p.K974fsc.2922_2922delAFrame_Shift_Del524.34KYSE150N000N
CTBP2NTGTIESTPOESOPHAGUS974p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE10N000N
CTBP2NTGTIESTPOESOPHAGUS974p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE8N000N
CTBP2PNQPTNTGTOESOPHAGUS969p.K974fsc.2922_2922delAFrame_Shift_Del324.34COLO680NN000N
CTBP2PNQPTNTGTOESOPHAGUS969p.K974fsc.2922_2922delAFrame_Shift_Del324.34KYSE150N000N
CTBP2PNQPTNTGTOESOPHAGUS969p.K974fsc.2922_2922delAFrame_Shift_Del324.34TE10N000N
CTBP2PNQPTNTGTOESOPHAGUS969p.K974fsc.2922_2922delAFrame_Shift_Del324.34TE8N000N
CTBP2PSPNQPTNTOESOPHAGUS967p.K974fsc.2922_2922delAFrame_Shift_Del224.34COLO680NN000N
CTBP2PSPNQPTNTOESOPHAGUS967p.K974fsc.2922_2922delAFrame_Shift_Del224.34KYSE150N000N
CTBP2PSPNQPTNTOESOPHAGUS967p.K974fsc.2922_2922delAFrame_Shift_Del224.34TE10N000N
CTBP2PSPNQPTNTOESOPHAGUS967p.K974fsc.2922_2922delAFrame_Shift_Del224.34TE8N000N
CTBP2PTNTGTIESOESOPHAGUS972p.K974fsc.2922_2922delAFrame_Shift_Del524.34COLO680NN000N
CTBP2PTNTGTIESOESOPHAGUS972p.K974fsc.2922_2922delAFrame_Shift_Del524.34KYSE150N000N
CTBP2PTNTGTIESOESOPHAGUS972p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE10N000N
CTBP2PTNTGTIESOESOPHAGUS972p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE8N000N
CTBP2QPTNTGTIEOESOPHAGUS971p.K974fsc.2922_2922delAFrame_Shift_Del524.34COLO680NN000N
CTBP2QPTNTGTIEOESOPHAGUS971p.K974fsc.2922_2922delAFrame_Shift_Del524.34KYSE150N000N
CTBP2QPTNTGTIEOESOPHAGUS971p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE10N000N
CTBP2QPTNTGTIEOESOPHAGUS971p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE8N000N
CTBP2SPNQPTNTGOESOPHAGUS968p.K974fsc.2922_2922delAFrame_Shift_Del224.34COLO680NN000N
CTBP2SPNQPTNTGOESOPHAGUS968p.K974fsc.2922_2922delAFrame_Shift_Del224.34KYSE150N000N
CTBP2SPNQPTNTGOESOPHAGUS968p.K974fsc.2922_2922delAFrame_Shift_Del224.34TE10N000N
CTBP2SPNQPTNTGOESOPHAGUS968p.K974fsc.2922_2922delAFrame_Shift_Del224.34TE8N000N
CTBP2TGTIESTPTOESOPHAGUS975p.K974fsc.2922_2922delAFrame_Shift_Del524.34COLO680NN000N
CTBP2TGTIESTPTOESOPHAGUS975p.K974fsc.2922_2922delAFrame_Shift_Del524.34KYSE150N000N
CTBP2TGTIESTPTOESOPHAGUS975p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE10N000N
CTBP2TGTIESTPTOESOPHAGUS975p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE8N000N
CTBP2TIESTPTSNOESOPHAGUS977p.K974fsc.2922_2922delAFrame_Shift_Del524.34COLO680NN100N
CTBP2TIESTPTSNOESOPHAGUS977p.K974fsc.2922_2922delAFrame_Shift_Del524.34KYSE150N100N
CTBP2TIESTPTSNOESOPHAGUS977p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE10N100N
CTBP2TIESTPTSNOESOPHAGUS977p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE8N100N
CTBP2TNTGTIESTOESOPHAGUS973p.K974fsc.2922_2922delAFrame_Shift_Del524.34COLO680NN000N
CTBP2TNTGTIESTOESOPHAGUS973p.K974fsc.2922_2922delAFrame_Shift_Del524.34KYSE150N000N
CTBP2TNTGTIESTOESOPHAGUS973p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE10N000N
CTBP2TNTGTIESTOESOPHAGUS973p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE8N000N
CTBP2AQGPFKDAPOESOPHAGUS846p.L850Fc.2550G>TMissense_Mutation10.11COLO680NN000N
CTBP2AVMSGCSPLOESOPHAGUS97p.R102Cc.304C>TMissense_Mutation10.11KYSE70N800N
CTBP2CSPLLPREYOESOPHAGUS102p.R102Cc.304C>TMissense_Mutation10.11KYSE70N700N
CTBP2FAQGPFKDAOESOPHAGUS845p.L850Fc.2550G>TMissense_Mutation10.11COLO680NN800N
CTBP2FKDAPNLICOESOPHAGUS850p.L850Fc.2550G>TMissense_Mutation10.11COLO680NN303N
CTBP2FSFAQGPFKOESOPHAGUS843p.L850Fc.2550G>TMissense_Mutation10.11COLO680NN602N
CTBP2GCSPLLPREOESOPHAGUS101p.R102Cc.304C>TMissense_Mutation10.11KYSE70N000N
CTBP2GPFKDAPNLOESOPHAGUS848p.L850Fc.2550G>TMissense_Mutation10.11COLO680NN1900N
CTBP2MSGCSPLLPOESOPHAGUS99p.R102Cc.304C>TMissense_Mutation10.11KYSE70N000N
CTBP2PFKDAPNLIOESOPHAGUS849p.L850Fc.2550G>TMissense_Mutation10.11COLO680NN100N
CTBP2PFSFAQGPFOESOPHAGUS842p.L850Fc.2550G>TMissense_Mutation10.11COLO680NN100N
CTBP2QAVMSGCSPOESOPHAGUS96p.R102Cc.304C>TMissense_Mutation10.11KYSE70N000N
CTBP2QGPFKDAPNOESOPHAGUS847p.L850Fc.2550G>TMissense_Mutation10.11COLO680NN100N
CTBP2RQAVMSGCSOESOPHAGUS95p.R102Cc.304C>TMissense_Mutation10.11KYSE70N200N
CTBP2SFAQGPFKDOESOPHAGUS844p.L850Fc.2550G>TMissense_Mutation10.11COLO680NN000N
CTBP2SGCSPLLPROESOPHAGUS100p.R102Cc.304C>TMissense_Mutation10.11KYSE70N100N
CTBP2SRQAVMSGCOESOPHAGUS94p.R102Cc.304C>TMissense_Mutation10.11KYSE70N200N
CTBP2VMSGCSPLLOESOPHAGUS98p.R102Cc.304C>TMissense_Mutation10.11KYSE70N1300N
EGFRCRGIMIFPSOESOPHAGUS70p.T68fsc.203_203delCFrame_Shift_Del50.11KYSE70N200N
EGFREITMCRGIMOESOPHAGUS66p.T68fsc.203_203delCFrame_Shift_Del50.11KYSE70N200N
EGFRGNLEITMCROESOPHAGUS63p.T68fsc.203_203delCFrame_Shift_Del30.11KYSE70N200N
EGFRITMCRGIMIOESOPHAGUS67p.T68fsc.203_203delCFrame_Shift_Del50.11KYSE70Y9158N
EGFRLEITMCRGIOESOPHAGUS65p.T68fsc.203_203delCFrame_Shift_Del50.11KYSE70N807N
EGFRLGNLEITMCOESOPHAGUS62p.T68fsc.203_203delCFrame_Shift_Del20.11KYSE70N003N
EGFRMCRGIMIFPOESOPHAGUS69p.T68fsc.203_203delCFrame_Shift_Del50.11KYSE70N000N
EGFRNLEITMCRGOESOPHAGUS64p.T68fsc.203_203delCFrame_Shift_Del40.11KYSE70N100N
EGFRTMCRGIMIFOESOPHAGUS68p.T68fsc.203_203delCFrame_Shift_Del50.11KYSE70Y690N
EGFRVLGNLEITMOESOPHAGUS61p.T68fsc.203_203delCFrame_Shift_Del10.11KYSE70N600N
EGFRAIVDNPHVCOESOPHAGUS767p.S768Ic.2303G>TMissense_Mutation10.11KYSE450N200N
EGFRAYVMAIVDNOESOPHAGUS763p.S768Ic.2303G>TMissense_Mutation10.11KYSE450N200N
EGFRDEAYVMAIVOESOPHAGUS761p.S768Ic.2303G>TMissense_Mutation10.11KYSE450Y7110N
EGFREAYVMAIVDOESOPHAGUS762p.S768Ic.2303G>TMissense_Mutation10.11KYSE450N000N
EGFRIVDNPHVCROESOPHAGUS768p.S768Ic.2303G>TMissense_Mutation10.11KYSE450N700N
EGFRLDEAYVMAIOESOPHAGUS760p.S768Ic.2303G>TMissense_Mutation10.11KYSE450N600N
EGFRMAIVDNPHVOESOPHAGUS766p.S768Ic.2303G>TMissense_Mutation10.11KYSE450N501N
EGFRVMAIVDNPHOESOPHAGUS765p.S768Ic.2303G>TMissense_Mutation10.11KYSE450N004N
EGFRYVMAIVDNPOESOPHAGUS764p.S768Ic.2303G>TMissense_Mutation10.11KYSE450N2018N
FBXW7ESGGSGGVLOESOPHAGUS664p.V672Lc.2014G>CMissense_Mutation10.11TE11N700Y
FBXW7GGSGGVLWROESOPHAGUS666p.V672Lc.2014G>CMissense_Mutation10.11TE11N100N
FBXW7GGVLWRIRAOESOPHAGUS669p.V672Lc.2014G>CMissense_Mutation10.11TE11N300N
FBXW7GSGGVLWRIOESOPHAGUS667p.V672Lc.2014G>CMissense_Mutation10.11TE11Y6130N
FBXW7GVLWRIRASOESOPHAGUS670p.V672Lc.2014G>CMissense_Mutation10.11TE11N100N
FBXW7LWRIRASNTOESOPHAGUS672p.V672Lc.2014G>CMissense_Mutation10.11TE11N001N
FBXW7SGGSGGVLWOESOPHAGUS665p.V672Lc.2014G>CMissense_Mutation10.11TE11N200N
FBXW7SGGVLWRIROESOPHAGUS668p.V672Lc.2014G>CMissense_Mutation10.11TE11N100N
FBXW7VLWRIRASNOESOPHAGUS671p.V672Lc.2014G>CMissense_Mutation10.11TE11N107N
FGFR3ASCTHDLYMOESOPHAGUS719p.N720Sc.2159A>GMissense_Mutation10.11KYSE70N400N
FGFR3DKPASCTHDOESOPHAGUS716p.N720Sc.2159A>GMissense_Mutation10.11KYSE70N000N
FGFR3GHRMDKPASOESOPHAGUS712p.N720Sc.2159A>GMissense_Mutation10.11KYSE70N000N
FGFR3HRMDKPASCOESOPHAGUS713p.N720Sc.2159A>GMissense_Mutation10.11KYSE70N200N
FGFR3KPASCTHDLOESOPHAGUS717p.N720Sc.2159A>GMissense_Mutation10.11KYSE70Y1890N
FGFR3MDKPASCTHOESOPHAGUS715p.N720Sc.2159A>GMissense_Mutation10.11KYSE70N000N
FGFR3PASCTHDLYOESOPHAGUS718p.N720Sc.2159A>GMissense_Mutation10.11KYSE70N000N
FGFR3RMDKPASCTOESOPHAGUS714p.N720Sc.2159A>GMissense_Mutation10.11KYSE70N100N
FGFR3SCTHDLYMIOESOPHAGUS720p.N720Sc.2159A>GMissense_Mutation10.11KYSE70N200N
FMN2LPPLPGAAIOESOPHAGUS934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03ECGI10N1401N
FMN2LPPLPGAAIOESOPHAGUS934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03KYSE150N1401N
FMN2LPPLPGAAIOESOPHAGUS934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03KYSE270N1401N
FMN2LPPLPGAAIOESOPHAGUS934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03TE10N1401N
FMN2LPPLPGAAIOESOPHAGUS934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03TE5N1401N
FMN2PLPPLPGAAOESOPHAGUS933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03ECGI10N000N
FMN2PLPPLPGAAOESOPHAGUS933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03KYSE150N000N
FMN2PLPPLPGAAOESOPHAGUS933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03KYSE270N000N
FMN2PLPPLPGAAOESOPHAGUS933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03TE10N000N
FMN2PLPPLPGAAOESOPHAGUS933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03TE5N000N
FMN2CFRELCNQNOESOPHAGUS577p.P581Lc.1742C>TMissense_Mutation10.22KYSE510N000N
FMN2DCFRELCNQOESOPHAGUS576p.P581Lc.1742C>TMissense_Mutation10.22KYSE510N000N
FMN2ELCNQNAQTOESOPHAGUS580p.P581Lc.1742C>TMissense_Mutation10.22KYSE510N100N
FMN2FRELCNQNAOESOPHAGUS578p.P581Lc.1742C>TMissense_Mutation10.22KYSE510N5010N
FMN2FSDCFRELCOESOPHAGUS574p.P581Lc.1742C>TMissense_Mutation10.22KYSE510Y4100N
FMN2LCNQNAQTNOESOPHAGUS581p.P581Lc.1742C>TMissense_Mutation10.22KYSE510N000N
FMN2PFSDCFRELOESOPHAGUS573p.P581Lc.1742C>TMissense_Mutation10.22KYSE510N200Y
FMN2RELCNQNAQOESOPHAGUS579p.P581Lc.1742C>TMissense_Mutation10.22KYSE510N000N
FMN2SDCFRELCNOESOPHAGUS575p.P581Lc.1742C>TMissense_Mutation10.22KYSE510N100N
GATA1AEAYRPSPVOESOPHAGUS66p.H71Pc.212A>CMissense_Mutation10.11ECGI10Y7120N
GATA1AYRPSPVFQOESOPHAGUS68p.H71Pc.212A>CMissense_Mutation10.11ECGI10Y0110N
GATA1DAEAYRPSPOESOPHAGUS65p.H71Pc.212A>CMissense_Mutation10.11ECGI10N000N
GATA1EAYRPSPVFOESOPHAGUS67p.H71Pc.212A>CMissense_Mutation10.11ECGI10N1100N
GATA1PSPVFQVYPOESOPHAGUS71p.H71Pc.212A>CMissense_Mutation10.11ECGI10N000N
GATA1RDAEAYRPSOESOPHAGUS64p.H71Pc.212A>CMissense_Mutation10.11ECGI10N400N
GATA1RPSPVFQVYOESOPHAGUS70p.H71Pc.212A>CMissense_Mutation10.11ECGI10Y14140N
GATA1YRDAEAYRPOESOPHAGUS63p.H71Pc.212A>CMissense_Mutation10.11ECGI10N301N
GATA1YRPSPVFQVOESOPHAGUS69p.H71Pc.212A>CMissense_Mutation10.11ECGI10Y10930N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7ECGI10N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KYSE140N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KYSE150N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KYSE270N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KYSE30N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KYSE410N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KYSE510N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KYSE70N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7OE21N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7OE33N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TE10N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TE11N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TE14N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TE1N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TE4N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TE5N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TE6N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TE8N000N
GPR112ASISDMFIQOESOPHAGUS2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TE9N000N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7ECGI10Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KYSE140Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KYSE150Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KYSE270Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KYSE30Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KYSE410Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KYSE510Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KYSE70Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7OE21Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7OE33Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE10Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE11Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE14Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE1Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE4Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE5Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE6Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE8Y11100N
GPR112ISDMFIQNLOESOPHAGUS2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE9Y11100N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7ECGI10N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KYSE140N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KYSE150N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KYSE270N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KYSE30N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KYSE410N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KYSE510N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KYSE70N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7OE21N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7OE33N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE10N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE11N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE14N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE1N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE4N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE5N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE6N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE8N700N
GPR112SASISDMFIOESOPHAGUS2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE9N700N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7ECGI10N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KYSE140N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KYSE150N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KYSE270N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KYSE30N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KYSE410N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KYSE510N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KYSE70N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7OE21N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7OE33N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE10N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE11N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE14N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE1N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE4N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE5N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE6N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE8N400N
GPR112SDMFIQNLAOESOPHAGUS2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE9N400N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7ECGI10N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KYSE140N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KYSE150N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KYSE270N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KYSE30N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KYSE410N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KYSE510N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KYSE70N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7OE21N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7OE33N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE10N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE11N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE14N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE1N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE4N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE5N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE6N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE8N000N
GPR112SISDMFIQNOESOPHAGUS2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE9N000N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7ECGI10N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KYSE140N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KYSE150N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KYSE270N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KYSE30N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KYSE410N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KYSE510N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KYSE70N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7OE21N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7OE33N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE10N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE11N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE14N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE1N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE4N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE5N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE6N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE8N900N
GPR112VSASISDMFOESOPHAGUS2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE9N900N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7ECGI10N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KYSE140N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KYSE150N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KYSE270N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KYSE30N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KYSE410N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KYSE510N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KYSE70N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7OE21N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7OE33N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE10N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE11N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE14N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE1N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE4N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE5N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE6N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE8N5020N
GPR112VVSASISDMOESOPHAGUS2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE9N5020N
GPR112AMATSTPIYOESOPHAGUS1503p.S1503Ac.4507T>GMissense_Mutation10.11KYSE150N800N
GPR112ESAMATSTPOESOPHAGUS1501p.S1503Ac.4507T>GMissense_Mutation10.11KYSE150N000N
GPR112LPRESAMATOESOPHAGUS1498p.S1503Ac.4507T>GMissense_Mutation10.11KYSE150N700N
GPR112MLPRESAMAOESOPHAGUS1497p.S1503Ac.4507T>GMissense_Mutation10.11KYSE150N406N
GPR112PRESAMATSOESOPHAGUS1499p.S1503Ac.4507T>GMissense_Mutation10.11KYSE150N000N
GPR112PTMLPRESAOESOPHAGUS1495p.S1503Ac.4507T>GMissense_Mutation10.11KYSE150N000N
GPR112RESAMATSTOESOPHAGUS1500p.S1503Ac.4507T>GMissense_Mutation10.11KYSE150N500N
GPR112SAMATSTPIOESOPHAGUS1502p.S1503Ac.4507T>GMissense_Mutation10.11KYSE150N700N
GPR112TMLPRESAMOESOPHAGUS1496p.S1503Ac.4507T>GMissense_Mutation10.11KYSE150Y790N
HSP90B1DEEETAKESOESOPHAGUS787p.E791delc.2362_2364delGAAIn_Frame_Del121.79KYSE150N300N
HSP90B1DEEETAKESOESOPHAGUS787p.E791delc.2362_2364delGAAIn_Frame_Del121.79KYSE510N300N
HSP90B1DEEETAKESOESOPHAGUS787p.E791delc.2362_2364delGAAIn_Frame_Del121.79TE11N300N
HSP90B1DEEETAKESOESOPHAGUS787p.E791delc.2362_2364delGAAIn_Frame_Del121.79TE14N300N
HSP90B1DVGTDEEETOESOPHAGUS783p.E791delc.2362_2364delGAAIn_Frame_Del121.79KYSE150N200N
HSP90B1DVGTDEEETOESOPHAGUS783p.E791delc.2362_2364delGAAIn_Frame_Del121.79KYSE510N200N
HSP90B1DVGTDEEETOESOPHAGUS783p.E791delc.2362_2364delGAAIn_Frame_Del121.79TE11N200N
HSP90B1DVGTDEEETOESOPHAGUS783p.E791delc.2362_2364delGAAIn_Frame_Del121.79TE14N200N
HSP90B1GTDEEETAKOESOPHAGUS785p.E791delc.2362_2364delGAAIn_Frame_Del321.79KYSE150N400N
HSP90B1GTDEEETAKOESOPHAGUS785p.E791delc.2362_2364delGAAIn_Frame_Del321.79KYSE510N400N
HSP90B1GTDEEETAKOESOPHAGUS785p.E791delc.2362_2364delGAAIn_Frame_Del321.79TE11N400N
HSP90B1GTDEEETAKOESOPHAGUS785p.E791delc.2362_2364delGAAIn_Frame_Del321.79TE14N400N
HSP90B1TDEEETAKEOESOPHAGUS786p.E791delc.2362_2364delGAAIn_Frame_Del221.79KYSE150N000N
HSP90B1TDEEETAKEOESOPHAGUS786p.E791delc.2362_2364delGAAIn_Frame_Del221.79KYSE510N000N
HSP90B1TDEEETAKEOESOPHAGUS786p.E791delc.2362_2364delGAAIn_Frame_Del221.79TE11N000N
HSP90B1TDEEETAKEOESOPHAGUS786p.E791delc.2362_2364delGAAIn_Frame_Del221.79TE14N000N
HSP90B1VGTDEEETAOESOPHAGUS784p.E791delc.2362_2364delGAAIn_Frame_Del221.79KYSE150N100N
HSP90B1VGTDEEETAOESOPHAGUS784p.E791delc.2362_2364delGAAIn_Frame_Del221.79KYSE510N100N
HSP90B1VGTDEEETAOESOPHAGUS784p.E791delc.2362_2364delGAAIn_Frame_Del221.79TE11N100N
HSP90B1VGTDEEETAOESOPHAGUS784p.E791delc.2362_2364delGAAIn_Frame_Del221.79TE14N100N
KITAKCMAFLASOESOPHAGUS777p.G779Cc.2335G>TMissense_Mutation10.11KYSE70N100N
KITCIHRDLEAROESOPHAGUS788p.A794Ec.2381C>AMissense_Mutation10.11KYSE140N500N
KITCMAFLASKNOESOPHAGUS779p.G779Cc.2335G>TMissense_Mutation10.11KYSE70N000N
KITDLEARNILLOESOPHAGUS792p.A794Ec.2381C>AMissense_Mutation10.11KYSE140N900N
KITEARNILLTHOESOPHAGUS794p.A794Ec.2381C>AMissense_Mutation10.11KYSE140N000N
KITFSYQVAKCMOESOPHAGUS772p.G779Cc.2335G>TMissense_Mutation10.11KYSE70N803N
KITHRDLEARNIOESOPHAGUS790p.A794Ec.2381C>AMissense_Mutation10.11KYSE140N400N
KITIHRDLEARNOESOPHAGUS789p.A794Ec.2381C>AMissense_Mutation10.11KYSE140N100N
KITKCMAFLASKOESOPHAGUS778p.G779Cc.2335G>TMissense_Mutation10.11KYSE70N500N
KITKNCIHRDLEOESOPHAGUS786p.A794Ec.2381C>AMissense_Mutation10.11KYSE140N000N
KITLEARNILLTOESOPHAGUS793p.A794Ec.2381C>AMissense_Mutation10.11KYSE140N703N
KITNCIHRDLEAOESOPHAGUS787p.A794Ec.2381C>AMissense_Mutation10.11KYSE140N200N
KITQVAKCMAFLOESOPHAGUS775p.G779Cc.2335G>TMissense_Mutation10.11KYSE70N800N
KITRDLEARNILOESOPHAGUS791p.A794Ec.2381C>AMissense_Mutation10.11KYSE140N900N
KITSFSYQVAKCOESOPHAGUS771p.G779Cc.2335G>TMissense_Mutation10.11KYSE70N100Y
KITSYQVAKCMAOESOPHAGUS773p.G779Cc.2335G>TMissense_Mutation10.11KYSE70N200N
KITVAKCMAFLAOESOPHAGUS776p.G779Cc.2335G>TMissense_Mutation10.11KYSE70N600N
KITYQVAKCMAFOESOPHAGUS774p.G779Cc.2335G>TMissense_Mutation10.11KYSE70N9018N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44COLO680NN000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44ECGI10N000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KYSE140N000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KYSE150N000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KYSE270N000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KYSE450N000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KYSE510N000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KYSE520N000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KYSE70N000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44OE19N000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44OE21N000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44OE33N000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44TE10N000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44TE14N000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44TE1N000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44TE4N000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44TE5N000N
MAP3K1STTTTTTTEOESOPHAGUS941p.T949delc.2822_2824delCAAIn_Frame_Del176.44TE6N000N
MAP3K1DPVLWRKTLOESOPHAGUS372p.M374Vc.1120A>GMissense_Mutation10.22ECGI10N1900N
MAP3K1EPSDPVLWROESOPHAGUS369p.M374Vc.1120A>GMissense_Mutation10.22ECGI10Y4100N
MAP3K1FQLEPSDPVOESOPHAGUS366p.M374Vc.1120A>GMissense_Mutation10.22ECGI10N1303N
MAP3K1LEPSDPVLWOESOPHAGUS368p.M374Vc.1120A>GMissense_Mutation10.22ECGI10N700N
MAP3K1PSDPVLWRKOESOPHAGUS370p.M374Vc.1120A>GMissense_Mutation10.22ECGI10N100N
MAP3K1PVLWRKTLKOESOPHAGUS373p.M374Vc.1120A>GMissense_Mutation10.22ECGI10N200N
MAP3K1QLEPSDPVLOESOPHAGUS367p.M374Vc.1120A>GMissense_Mutation10.22ECGI10N800N
MAP3K1SDPVLWRKTOESOPHAGUS371p.M374Vc.1120A>GMissense_Mutation10.22ECGI10N300N
MAP3K1VLWRKTLKNOESOPHAGUS374p.M374Vc.1120A>GMissense_Mutation10.22ECGI10N009N
MAP3K4AFLILCRVLOESOPHAGUS615p.V618Ic.1852G>AMissense_Mutation10.11OE19Y9100N
MAP3K4ASKLGPIEDOESOPHAGUS1288p.A1296Dc.3887C>AMissense_Mutation10.11TE6N000N
MAP3K4DIQKSVRLFOESOPHAGUS1296p.A1296Dc.3887C>AMissense_Mutation10.11TE6N200N
MAP3K4EDIQKSVRLOESOPHAGUS1295p.A1296Dc.3887C>AMissense_Mutation10.11TE6N900N
MAP3K4EPAFLILCROESOPHAGUS613p.V618Ic.1852G>AMissense_Mutation10.11OE19N400N
MAP3K4FEPAFLILCOESOPHAGUS612p.V618Ic.1852G>AMissense_Mutation10.11OE19N1001N
MAP3K4FLILCRVLLOESOPHAGUS616p.V618Ic.1852G>AMissense_Mutation10.11OE19Y171234N
MAP3K4GPIEDIQKSOESOPHAGUS1292p.A1296Dc.3887C>AMissense_Mutation10.11TE6N400N
MAP3K4IEDIQKSVROESOPHAGUS1294p.A1296Dc.3887C>AMissense_Mutation10.11TE6N000N
MAP3K4ILCRVLLNVOESOPHAGUS618p.V618Ic.1852G>AMissense_Mutation10.11OE19Y8118N
MAP3K4KLGPIEDIQOESOPHAGUS1290p.A1296Dc.3887C>AMissense_Mutation10.11TE6N000N
MAP3K4LGPIEDIQKOESOPHAGUS1291p.A1296Dc.3887C>AMissense_Mutation10.11TE6N002N
MAP3K4LILCRVLLNOESOPHAGUS617p.V618Ic.1852G>AMissense_Mutation10.11OE19N0033N
MAP3K4PAFLILCRVOESOPHAGUS614p.V618Ic.1852G>AMissense_Mutation10.11OE19N500N
MAP3K4PIEDIQKSVOESOPHAGUS1293p.A1296Dc.3887C>AMissense_Mutation10.11TE6N000N
MAP3K4PSFEPAFLIOESOPHAGUS610p.V618Ic.1852G>AMissense_Mutation10.11OE19N100N
MAP3K4SFEPAFLILOESOPHAGUS611p.V618Ic.1852G>AMissense_Mutation10.11OE19Y990N
MAP3K4SKLGPIEDIOESOPHAGUS1289p.A1296Dc.3887C>AMissense_Mutation10.11TE6N500N
MAP3K4ACKSPESVLOESOPHAGUS60p.D67Vc.200A>TMissense_Mutation10.22KYSE180Y490N
MAP3K4CKSPESVLEOESOPHAGUS61p.D67Vc.200A>TMissense_Mutation10.22KYSE180N000N
MAP3K4ESVLEDFSDOESOPHAGUS65p.D67Vc.200A>TMissense_Mutation10.22KYSE180N000N
MAP3K4KSPESVLEDOESOPHAGUS62p.D67Vc.200A>TMissense_Mutation10.22KYSE180N100N
MAP3K4PESVLEDFSOESOPHAGUS64p.D67Vc.200A>TMissense_Mutation10.22KYSE180N000N
MAP3K4SACKSPESVOESOPHAGUS59p.D67Vc.200A>TMissense_Mutation10.22KYSE180N400N
MAP3K4SPESVLEDFOESOPHAGUS63p.D67Vc.200A>TMissense_Mutation10.22KYSE180N1100N
MAP3K4SVLEDFSDEOESOPHAGUS66p.D67Vc.200A>TMissense_Mutation10.22KYSE180N000N
MAP3K4VLEDFSDETOESOPHAGUS67p.D67Vc.200A>TMissense_Mutation10.22KYSE180N400N
METACQHRSNSDOESOPHAGUS807p.E815Dc.2445G>CMissense_Mutation10.11TE5N000N
METARSISPTTEOESOPHAGUS1004p.V1007Ic.3019G>AMissense_Mutation10.11OE33N100N
METCQHRSNSDIOESOPHAGUS808p.E815Dc.2445G>CMissense_Mutation10.11TE5N600N
METDIICCTTPSOESOPHAGUS815p.E815Dc.2445G>CMissense_Mutation10.11TE5N100N
METDRLVSARSIOESOPHAGUS999p.V1007Ic.3019G>AMissense_Mutation10.11OE33N500N
METHRSNSDIICOESOPHAGUS810p.E815Dc.2445G>CMissense_Mutation10.11TE5N200N
METISPTTEMVSOESOPHAGUS1007p.V1007Ic.3019G>AMissense_Mutation10.11OE33N000N
METLVSARSISPOESOPHAGUS1001p.V1007Ic.3019G>AMissense_Mutation10.11OE33N007N
METNSDIICCTTOESOPHAGUS813p.E815Dc.2445G>CMissense_Mutation10.11TE5N200N
METQHRSNSDIIOESOPHAGUS809p.E815Dc.2445G>CMissense_Mutation10.11TE5N500N
METRLVSARSISOESOPHAGUS1000p.V1007Ic.3019G>AMissense_Mutation10.11OE33N000N
METRSISPTTEMOESOPHAGUS1005p.V1007Ic.3019G>AMissense_Mutation10.11OE33Y890N
METRSNSDIICCOESOPHAGUS811p.E815Dc.2445G>CMissense_Mutation10.11TE5N100N
METSARSISPTTOESOPHAGUS1003p.V1007Ic.3019G>AMissense_Mutation10.11OE33N400N
METSDIICCTTPOESOPHAGUS814p.E815Dc.2445G>CMissense_Mutation10.11TE5N000N
METSISPTTEMVOESOPHAGUS1006p.V1007Ic.3019G>AMissense_Mutation10.11OE33N200N
METSNSDIICCTOESOPHAGUS812p.E815Dc.2445G>CMissense_Mutation10.11TE5N000N
METVSARSISPTOESOPHAGUS1002p.V1007Ic.3019G>AMissense_Mutation10.11OE33N100N
METDFFKKIVNKOESOPHAGUS372p.N375Kc.1125C>GMissense_Mutation10.22TE8N000N
METFFKKIVNKNOESOPHAGUS373p.N375Kc.1125C>GMissense_Mutation10.22TE8N109N
METFKKIVNKNNOESOPHAGUS374p.N375Kc.1125C>GMissense_Mutation10.22TE8N303N
METIKYVNDFFKOESOPHAGUS367p.N375Kc.1125C>GMissense_Mutation10.22TE8N102N
METKKIVNKNNVOESOPHAGUS375p.N375Kc.1125C>GMissense_Mutation10.22TE8N400N
METKYVNDFFKKOESOPHAGUS368p.N375Kc.1125C>GMissense_Mutation10.22TE8N300N
METNDFFKKIVNOESOPHAGUS371p.N375Kc.1125C>GMissense_Mutation10.22TE8N100N
METVNDFFKKIVOESOPHAGUS370p.N375Kc.1125C>GMissense_Mutation10.22TE8N500N
METYVNDFFKKIOESOPHAGUS369p.N375Kc.1125C>GMissense_Mutation10.22TE8Y1197N
MLL3AITDPVMKAOESOPHAGUS3091p.I3096Vc.9286A>GMissense_Mutation10.11TE1Y290N
MLL3CETEKNYENOESOPHAGUS2837p.D2843Yc.8527G>TMissense_Mutation10.11TE8N400N
MLL3DAITDPVMKOESOPHAGUS3090p.I3096Vc.9286A>GMissense_Mutation10.11TE1N100N
MLL3DFDAITDPVOESOPHAGUS3088p.I3096Vc.9286A>GMissense_Mutation10.11TE1N300N
MLL3DPVMKAKMVOESOPHAGUS3094p.I3096Vc.9286A>GMissense_Mutation10.11TE1N1500N
MLL3EKNYENKDNOESOPHAGUS2840p.D2843Yc.8527G>TMissense_Mutation10.11TE8N100N
MLL3ETEKNYENKOESOPHAGUS2838p.D2843Yc.8527G>TMissense_Mutation10.11TE8N300N
MLL3FDAITDPVMOESOPHAGUS3089p.I3096Vc.9286A>GMissense_Mutation10.11TE1N800N
MLL3FLYPSLDPLOESOPHAGUS1403p.D1405Yc.4213G>TMissense_Mutation10.11KYSE410N2100N
MLL3GFLYPSLDPOESOPHAGUS1402p.D1405Yc.4213G>TMissense_Mutation10.11KYSE410N000N
MLL3ITDPVMKAKOESOPHAGUS3092p.I3096Vc.9286A>GMissense_Mutation10.11TE1Y5130N
MLL3KCETEKNYEOESOPHAGUS2836p.D2843Yc.8527G>TMissense_Mutation10.11TE8N000N
MLL3KNYENKDNVOESOPHAGUS2841p.D2843Yc.8527G>TMissense_Mutation10.11TE8Y9160N
MLL3LYPSLDPLLOESOPHAGUS1404p.D1405Yc.4213G>TMissense_Mutation10.11KYSE410N1200N
MLL3MNTGFLYPSOESOPHAGUS1399p.D1405Yc.4213G>TMissense_Mutation10.11KYSE410N001N
MLL3NMNTGFLYPOESOPHAGUS1398p.D1405Yc.4213G>TMissense_Mutation10.11KYSE410N000N
MLL3NTGFLYPSLOESOPHAGUS1400p.D1405Yc.4213G>TMissense_Mutation10.11KYSE410N800N
MLL3NYENKDNVDOESOPHAGUS2842p.D2843Yc.8527G>TMissense_Mutation10.11TE8N000N
MLL3PVMKAKMVAOESOPHAGUS3095p.I3096Vc.9286A>GMissense_Mutation10.11TE1N000N
MLL3SKCETEKNYOESOPHAGUS2835p.D2843Yc.8527G>TMissense_Mutation10.11TE8N200N
MLL3TDPVMKAKMOESOPHAGUS3093p.I3096Vc.9286A>GMissense_Mutation10.11TE1N400N
MLL3TEKNYENKDOESOPHAGUS2839p.D2843Yc.8527G>TMissense_Mutation10.11TE8N000N
MLL3TGFLYPSLDOESOPHAGUS1401p.D1405Yc.4213G>TMissense_Mutation10.11KYSE410N000N
MLL3TNMNTGFLYOESOPHAGUS1397p.D1405Yc.4213G>TMissense_Mutation10.11KYSE410N500N
MLL3VMKAKMVALOESOPHAGUS3096p.I3096Vc.9286A>GMissense_Mutation10.11TE1Y11102N
MLL3YENKDNVDTOESOPHAGUS2843p.D2843Yc.8527G>TMissense_Mutation10.11TE8N700N
MLL3YPSLDPLLSOESOPHAGUS1405p.D1405Yc.4213G>TMissense_Mutation10.11KYSE410N7020N
MSH3AAAAPPAPAOESOPHAGUS59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23COLO680NN200N
MSH3AAAPPAPAFOESOPHAGUS60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23COLO680NY8100N
MSH3AAPPAPAFPOESOPHAGUS61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23COLO680NN000N
MSH6AHYPPIQVLOESOPHAGUS587p.V592Ic.1774G>AMissense_Mutation10.11OE19Y890N
MSH6HYPPIQVLFOESOPHAGUS588p.V592Ic.1774G>AMissense_Mutation10.11OE19Y990N
MSH6IQVLFEKGNOESOPHAGUS592p.V592Ic.1774G>AMissense_Mutation10.11OE19N000N
MSH6LVAHYPPIQOESOPHAGUS585p.V592Ic.1774G>AMissense_Mutation10.11OE19N0026N
MSH6PIQVLFEKGOESOPHAGUS591p.V592Ic.1774G>AMissense_Mutation10.11OE19N000N
MSH6PPIQVLFEKOESOPHAGUS590p.V592Ic.1774G>AMissense_Mutation10.11OE19N000N
MSH6TLVAHYPPIOESOPHAGUS584p.V592Ic.1774G>AMissense_Mutation10.11OE19N1400N
MSH6VAHYPPIQVOESOPHAGUS586p.V592Ic.1774G>AMissense_Mutation10.11OE19Y5113N
MSH6YPPIQVLFEOESOPHAGUS589p.V592Ic.1774G>AMissense_Mutation10.11OE19N307N
MYLKASKELKKDVOESOPHAGUS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KYSE140N400N
MYLKASKELKKDVOESOPHAGUS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KYSE150N400N
MYLKASKELKKDVOESOPHAGUS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KYSE180N400N
MYLKASKELKKDVOESOPHAGUS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KYSE270N400N
MYLKASKELKKDVOESOPHAGUS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KYSE30N400N
MYLKASKELKKDVOESOPHAGUS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KYSE450N400N
MYLKASKELKKDVOESOPHAGUS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KYSE510N400N
MYLKASKELKKDVOESOPHAGUS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02TE1N400N
MYLKASKELKKDVOESOPHAGUS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02TE4N400N
MYLKASKELKKDVOESOPHAGUS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02TE6N400N
MYLKASKELKKDVOESOPHAGUS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02TE8N400N
MYLKASKELKKDVOESOPHAGUS1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02TTN400N
MYLKKELKKDVKNOESOPHAGUS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KYSE140N500N
MYLKKELKKDVKNOESOPHAGUS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KYSE150N500N
MYLKKELKKDVKNOESOPHAGUS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KYSE180N500N
MYLKKELKKDVKNOESOPHAGUS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KYSE270N500N
MYLKKELKKDVKNOESOPHAGUS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KYSE30N500N
MYLKKELKKDVKNOESOPHAGUS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KYSE450N500N
MYLKKELKKDVKNOESOPHAGUS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KYSE510N500N
MYLKKELKKDVKNOESOPHAGUS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02TE1N500N
MYLKKELKKDVKNOESOPHAGUS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02TE4N500N
MYLKKELKKDVKNOESOPHAGUS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02TE6N500N
MYLKKELKKDVKNOESOPHAGUS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02TE8N500N
MYLKKELKKDVKNOESOPHAGUS1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02TTN500N
MYLKKSASKELKKOESOPHAGUS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE140N400N
MYLKKSASKELKKOESOPHAGUS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE150N400N
MYLKKSASKELKKOESOPHAGUS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE180N400N
MYLKKSASKELKKOESOPHAGUS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE270N400N
MYLKKSASKELKKOESOPHAGUS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE30N400N
MYLKKSASKELKKOESOPHAGUS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE450N400N
MYLKKSASKELKKOESOPHAGUS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE510N400N
MYLKKSASKELKKOESOPHAGUS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TE1N400N
MYLKKSASKELKKOESOPHAGUS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TE4N400N
MYLKKSASKELKKOESOPHAGUS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TE6N400N
MYLKKSASKELKKOESOPHAGUS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TE8N400N
MYLKKSASKELKKOESOPHAGUS1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TTN400N
MYLKLKSASKELKOESOPHAGUS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE140N105N
MYLKLKSASKELKOESOPHAGUS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE150N105N
MYLKLKSASKELKOESOPHAGUS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE180N105N
MYLKLKSASKELKOESOPHAGUS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE270N105N
MYLKLKSASKELKOESOPHAGUS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE30N105N
MYLKLKSASKELKOESOPHAGUS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE450N105N
MYLKLKSASKELKOESOPHAGUS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE510N105N
MYLKLKSASKELKOESOPHAGUS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TE1N105N
MYLKLKSASKELKOESOPHAGUS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TE4N105N
MYLKLKSASKELKOESOPHAGUS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TE6N105N
MYLKLKSASKELKOESOPHAGUS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TE8N105N
MYLKLKSASKELKOESOPHAGUS1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TTN105N
MYLKNLKSASKELOESOPHAGUS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KYSE140Y5100N
MYLKNLKSASKELOESOPHAGUS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KYSE150Y5100N
MYLKNLKSASKELOESOPHAGUS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KYSE180Y5100N
MYLKNLKSASKELOESOPHAGUS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KYSE270Y5100N
MYLKNLKSASKELOESOPHAGUS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KYSE30Y5100N
MYLKNLKSASKELOESOPHAGUS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KYSE450Y5100N
MYLKNLKSASKELOESOPHAGUS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KYSE510Y5100N
MYLKNLKSASKELOESOPHAGUS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02TE1Y5100N
MYLKNLKSASKELOESOPHAGUS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02TE4Y5100N
MYLKNLKSASKELOESOPHAGUS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02TE6Y5100N
MYLKNLKSASKELOESOPHAGUS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02TE8Y5100N
MYLKNLKSASKELOESOPHAGUS1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02TTY5100N
MYLKSASKELKKDOESOPHAGUS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KYSE140N000N
MYLKSASKELKKDOESOPHAGUS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KYSE150N000N
MYLKSASKELKKDOESOPHAGUS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KYSE180N000N
MYLKSASKELKKDOESOPHAGUS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KYSE270N000N
MYLKSASKELKKDOESOPHAGUS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KYSE30N000N
MYLKSASKELKKDOESOPHAGUS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KYSE450N000N
MYLKSASKELKKDOESOPHAGUS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KYSE510N000N
MYLKSASKELKKDOESOPHAGUS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02TE1N000N
MYLKSASKELKKDOESOPHAGUS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02TE4N000N
MYLKSASKELKKDOESOPHAGUS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02TE6N000N
MYLKSASKELKKDOESOPHAGUS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02TE8N000N
MYLKSASKELKKDOESOPHAGUS1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02TTN000N
MYLKSKELKKDVKOESOPHAGUS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE140N200N
MYLKSKELKKDVKOESOPHAGUS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE150N200N
MYLKSKELKKDVKOESOPHAGUS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE180N200N
MYLKSKELKKDVKOESOPHAGUS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE270N200N
MYLKSKELKKDVKOESOPHAGUS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE30N200N
MYLKSKELKKDVKOESOPHAGUS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE450N200N
MYLKSKELKKDVKOESOPHAGUS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYSE510N200N
MYLKSKELKKDVKOESOPHAGUS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TE1N200N
MYLKSKELKKDVKOESOPHAGUS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TE4N200N
MYLKSKELKKDVKOESOPHAGUS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TE6N200N
MYLKSKELKKDVKOESOPHAGUS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TE8N200N
MYLKSKELKKDVKOESOPHAGUS1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TTN200N
MYLKEPHYGTQPWOESOPHAGUS714p.D717Yc.2149G>TMissense_Mutation10.11KYSE180N800N
MYLKHYGTQPWFIOESOPHAGUS716p.D717Yc.2149G>TMissense_Mutation10.11KYSE180Y6110N
MYLKLTVQEPHYGOESOPHAGUS710p.D717Yc.2149G>TMissense_Mutation10.11KYSE180N000N
MYLKPHYGTQPWFOESOPHAGUS715p.D717Yc.2149G>TMissense_Mutation10.11KYSE180N200N
MYLKQEPHYGTQPOESOPHAGUS713p.D717Yc.2149G>TMissense_Mutation10.11KYSE180N000N
MYLKTVQEPHYGTOESOPHAGUS711p.D717Yc.2149G>TMissense_Mutation10.11KYSE180N100Y
MYLKVLTVQEPHYOESOPHAGUS709p.D717Yc.2149G>TMissense_Mutation10.11KYSE180N600N
MYLKVQEPHYGTQOESOPHAGUS712p.D717Yc.2149G>TMissense_Mutation10.11KYSE180N100N
MYLKYGTQPWFISOESOPHAGUS717p.D717Yc.2149G>TMissense_Mutation10.11KYSE180N300N
MYST4DWNKLLRRTOESOPHAGUS106p.A114Tc.340G>AMissense_Mutation10.11TE11N000N
MYST4GLWICQVCROESOPHAGUS310p.M311Lc.931A>TMissense_Mutation10.11TE4N700N
MYST4KGLWICQVCOESOPHAGUS309p.M311Lc.931A>TMissense_Mutation10.11TE4N200N
MYST4KLLRRTIEGOESOPHAGUS109p.A114Tc.340G>AMissense_Mutation10.11TE11N000N
MYST4LLRRTIEGLOESOPHAGUS110p.A114Tc.340G>AMissense_Mutation10.11TE11N901N
MYST4LRRTIEGLEOESOPHAGUS111p.A114Tc.340G>AMissense_Mutation10.11TE11N100N
MYST4LSRMPKGLWOESOPHAGUS304p.M311Lc.931A>TMissense_Mutation10.11TE4N402N
MYST4LWICQVCRPOESOPHAGUS311p.M311Lc.931A>TMissense_Mutation10.11TE4N000N
MYST4MPKGLWICQOESOPHAGUS307p.M311Lc.931A>TMissense_Mutation10.11TE4N300N
MYST4NKLLRRTIEOESOPHAGUS108p.A114Tc.340G>AMissense_Mutation10.11TE11N100N
MYST4PKGLWICQVOESOPHAGUS308p.M311Lc.931A>TMissense_Mutation10.11TE4N100N
MYST4PLSRMPKGLOESOPHAGUS303p.M311Lc.931A>TMissense_Mutation10.11TE4N200N
MYST4RMPKGLWICOESOPHAGUS306p.M311Lc.931A>TMissense_Mutation10.11TE4N300N
MYST4RRTIEGLEEOESOPHAGUS112p.A114Tc.340G>AMissense_Mutation10.11TE11N200N
MYST4RTIEGLEEPOESOPHAGUS113p.A114Tc.340G>AMissense_Mutation10.11TE11N100N
MYST4SRMPKGLWIOESOPHAGUS305p.M311Lc.931A>TMissense_Mutation10.11TE4Y6150N
MYST4TIEGLEEPNOESOPHAGUS114p.A114Tc.340G>AMissense_Mutation10.11TE11N100N
MYST4WNKLLRRTIOESOPHAGUS107p.A114Tc.340G>AMissense_Mutation10.11TE11N5020N
NCOA3FGVSSSTSGOESOPHAGUS657p.S657Fc.1970C>TMissense_Mutation10.11KYSE510N204N
NCOA3PFGVSSSTSOESOPHAGUS656p.S657Fc.1970C>TMissense_Mutation10.11KYSE510N000N
NCOA3SPFGVSSSTOESOPHAGUS655p.S657Fc.1970C>TMissense_Mutation10.11KYSE510N600N
NCOA3SSVSVTSPFOESOPHAGUS649p.S657Fc.1970C>TMissense_Mutation10.11KYSE510N600N
NCOA3SVSVTSPFGOESOPHAGUS650p.S657Fc.1970C>TMissense_Mutation10.11KYSE510N000N
NCOA3SVTSPFGVSOESOPHAGUS652p.S657Fc.1970C>TMissense_Mutation10.11KYSE510N000N
NCOA3TSPFGVSSSOESOPHAGUS654p.S657Fc.1970C>TMissense_Mutation10.11KYSE510N100N
NCOA3VSVTSPFGVOESOPHAGUS651p.S657Fc.1970C>TMissense_Mutation10.11KYSE510N802N
NCOA3VTSPFGVSSOESOPHAGUS653p.S657Fc.1970C>TMissense_Mutation10.11KYSE510N100N
NF1FPHNSIGAVOESOPHAGUS1397p.Q1399Hc.4197G>TMissense_Mutation10.11KYSE450Y12110N
NF1HNSIGAVGSOESOPHAGUS1399p.Q1399Hc.4197G>TMissense_Mutation10.11KYSE450N000N
NF1PHNSIGAVGOESOPHAGUS1398p.Q1399Hc.4197G>TMissense_Mutation10.11KYSE450N000N
NF1QRFPHNSIGOESOPHAGUS1395p.Q1399Hc.4197G>TMissense_Mutation10.11KYSE450N200N
NF1RFPHNSIGAOESOPHAGUS1396p.Q1399Hc.4197G>TMissense_Mutation10.11KYSE450N300N
NF1SQRFPHNSIOESOPHAGUS1394p.Q1399Hc.4197G>TMissense_Mutation10.11KYSE450Y6120N
NF1SVVSQRFPHOESOPHAGUS1391p.Q1399Hc.4197G>TMissense_Mutation10.11KYSE450N100N
NF1VSQRFPHNSOESOPHAGUS1393p.Q1399Hc.4197G>TMissense_Mutation10.11KYSE450N103N
NF1VVSQRFPHNOESOPHAGUS1392p.Q1399Hc.4197G>TMissense_Mutation10.11KYSE450N000N
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13COLO680NN101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13ECGI10N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYSE140N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYSE150N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYSE180N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13KYSE270N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYSE30N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13KYSE30N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYSE410N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYSE450N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYSE510N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13KYSE520N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYSE70N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13OE19N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13OE21N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13OE33N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13TE10N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE11N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE14N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE1N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE4N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE5N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE6N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13TE8N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE9N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13TE9N101Y
NR1H2IRKQQQQQEOESOPHAGUS170p.176_177insQc.514_515insAACIn_Frame_Ins296.13TTN101Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13COLO680NN000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13ECGI10N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYSE140N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYSE150N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYSE180N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13KYSE270N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYSE30N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13KYSE30N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYSE410N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYSE450N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYSE510N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13KYSE520N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYSE70N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13OE19N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13OE21N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13OE33N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13TE10N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE11N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE14N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE1N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE4N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE5N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE6N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13TE8N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE9N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13TE9N000Y
NR1H2KIRKQQQQQOESOPHAGUS169p.176_177insQc.514_515insAACIn_Frame_Ins196.13TTN000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13COLO680NN000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13ECGI10N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYSE140N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYSE150N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYSE180N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13KYSE270N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYSE30N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13KYSE30N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYSE410N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYSE450N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYSE510N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13KYSE520N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYSE70N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13OE19N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13OE21N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13OE33N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13TE10N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE11N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE14N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE1N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE4N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE5N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE6N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13TE8N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE9N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13TE9N000Y
NR1H2KQQQQQESQOESOPHAGUS172p.176_177insQc.514_515insAACIn_Frame_Ins296.13TTN000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13COLO680NN000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13ECGI10N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYSE140N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYSE150N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYSE180N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13KYSE270N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYSE30N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13KYSE30N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYSE410N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYSE450N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYSE510N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13KYSE520N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYSE70N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13OE19N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13OE21N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13OE33N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13TE10N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE11N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE14N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE1N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE4N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE5N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE6N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13TE8N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE9N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13TE9N000Y
NR1H2QQQQQESQSOESOPHAGUS173p.176_177insQc.514_515insAACIn_Frame_Ins196.13TTN000Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13COLO680NN100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13ECGI10N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KYSE140N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KYSE150N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KYSE180N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13KYSE270N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KYSE30N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13KYSE30N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KYSE410N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KYSE450N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KYSE510N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13KYSE520N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KYSE70N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13OE19N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13OE21N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13OE33N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13TE10N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13TE11N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13TE14N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13TE1N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13TE4N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13TE5N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13TE6N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13TE8N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13TE9N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13TE9N100Y
NR1H2RKQQQQQESOESOPHAGUS171p.176_177insQc.514_515insAACIn_Frame_Ins396.13TTN100Y
PDE4DIPANLDQGRVROESOPHAGUS603p.L601fsc.1801_1801delCFrame_Shift_Del615.49KYSE140Y2110N
PDE4DIPANLDQGRVROESOPHAGUS603p.L601fsc.1801_1801delCFrame_Shift_Del615.49KYSE150Y2110N
PDE4DIPANLDQGRVROESOPHAGUS603p.L601fsc.1801_1801delCFrame_Shift_Del615.49KYSE180Y2110N
PDE4DIPANLDQGRVROESOPHAGUS603p.L601fsc.1801_1801delCFrame_Shift_Del615.49KYSE450Y2110N
PDE4DIPANLDQGRVROESOPHAGUS603p.L601fsc.1801_1801delCFrame_Shift_Del615.49TE10Y2110N
PDE4DIPANLDQGRVROESOPHAGUS603p.L601fsc.1801_1801delCFrame_Shift_Del615.49TE14Y2110N
PDE4DIPANLDQGRVROESOPHAGUS603p.L601fsc.1801_1801delCFrame_Shift_Del615.49TE1Y2110N
PDE4DIPANLDQGRVROESOPHAGUS603p.L601fsc.1801_1801delCFrame_Shift_Del615.49TE5Y2110N
PDE4DIPANLDQGRVROESOPHAGUS603p.L601fsc.1801_1801delCFrame_Shift_Del615.49TE9Y2110N
PDE4DIPANLDQGRVROESOPHAGUS603p.L601fsc.1801_1801delCFrame_Shift_Del615.49TTY2110N
PDE4DIPATCSANLDQOESOPHAGUS599p.L601fsc.1801_1801delCFrame_Shift_Del615.49KYSE140N000N
PDE4DIPATCSANLDQOESOPHAGUS599p.L601fsc.1801_1801delCFrame_Shift_Del615.49KYSE150N000N
PDE4DIPATCSANLDQOESOPHAGUS599p.L601fsc.1801_1801delCFrame_Shift_Del615.49KYSE180N000N
PDE4DIPATCSANLDQOESOPHAGUS599p.L601fsc.1801_1801delCFrame_Shift_Del615.49KYSE450N000N
PDE4DIPATCSANLDQOESOPHAGUS599p.L601fsc.1801_1801delCFrame_Shift_Del615.49TE10N000N
PDE4DIPATCSANLDQOESOPHAGUS599p.L601fsc.1801_1801delCFrame_Shift_Del615.49TE14N000N
PDE4DIPATCSANLDQOESOPHAGUS599p.L601fsc.1801_1801delCFrame_Shift_Del615.49TE1N000N
PDE4DIPATCSANLDQOESOPHAGUS599p.L601fsc.1801_1801delCFrame_Shift_Del615.49TE5N000N
PDE4DIPATCSANLDQOESOPHAGUS599p.L601fsc.1801_1801delCFrame_Shift_Del615.49TE9N000N
PDE4DIPATCSANLDQOESOPHAGUS599p.L601fsc.1801_1801delCFrame_Shift_Del615.49TTN000N
PDE4DIPCSANLDQGROESOPHAGUS601p.L601fsc.1801_1801delCFrame_Shift_Del515.49KYSE140N300N
PDE4DIPCSANLDQGROESOPHAGUS601p.L601fsc.1801_1801delCFrame_Shift_Del515.49KYSE150N300N
PDE4DIPCSANLDQGROESOPHAGUS601p.L601fsc.1801_1801delCFrame_Shift_Del515.49KYSE180N300N
PDE4DIPCSANLDQGROESOPHAGUS601p.L601fsc.1801_1801delCFrame_Shift_Del515.49KYSE450N300N
PDE4DIPCSANLDQGROESOPHAGUS601p.L601fsc.1801_1801delCFrame_Shift_Del515.49TE10N300N
PDE4DIPCSANLDQGROESOPHAGUS601p.L601fsc.1801_1801delCFrame_Shift_Del515.49TE14N300N
PDE4DIPCSANLDQGROESOPHAGUS601p.L601fsc.1801_1801delCFrame_Shift_Del515.49TE1N300N
PDE4DIPCSANLDQGROESOPHAGUS601p.L601fsc.1801_1801delCFrame_Shift_Del515.49TE5N300N
PDE4DIPCSANLDQGROESOPHAGUS601p.L601fsc.1801_1801delCFrame_Shift_Del515.49TE9N300N
PDE4DIPCSANLDQGROESOPHAGUS601p.L601fsc.1801_1801delCFrame_Shift_Del515.49TTN300N
PDE4DIPDLSATCSANOESOPHAGUS596p.L601fsc.1801_1801delCFrame_Shift_Del415.49KYSE140N000N
PDE4DIPDLSATCSANOESOPHAGUS596p.L601fsc.1801_1801delCFrame_Shift_Del415.49KYSE150N000N
PDE4DIPDLSATCSANOESOPHAGUS596p.L601fsc.1801_1801delCFrame_Shift_Del415.49KYSE180N000N
PDE4DIPDLSATCSANOESOPHAGUS596p.L601fsc.1801_1801delCFrame_Shift_Del415.49KYSE450N000N
PDE4DIPDLSATCSANOESOPHAGUS596p.L601fsc.1801_1801delCFrame_Shift_Del415.49TE10N000N
PDE4DIPDLSATCSANOESOPHAGUS596p.L601fsc.1801_1801delCFrame_Shift_Del415.49TE14N000N
PDE4DIPDLSATCSANOESOPHAGUS596p.L601fsc.1801_1801delCFrame_Shift_Del415.49TE1N000N
PDE4DIPDLSATCSANOESOPHAGUS596p.L601fsc.1801_1801delCFrame_Shift_Del415.49TE5N000N
PDE4DIPDLSATCSANOESOPHAGUS596p.L601fsc.1801_1801delCFrame_Shift_Del415.49TE9N000N
PDE4DIPDLSATCSANOESOPHAGUS596p.L601fsc.1801_1801delCFrame_Shift_Del415.49TTN000N
PDE4DIPEDLSATCSAOESOPHAGUS595p.L601fsc.1801_1801delCFrame_Shift_Del315.49KYSE140N400N
PDE4DIPEDLSATCSAOESOPHAGUS595p.L601fsc.1801_1801delCFrame_Shift_Del315.49KYSE150N400N
PDE4DIPEDLSATCSAOESOPHAGUS595p.L601fsc.1801_1801delCFrame_Shift_Del315.49KYSE180N400N
PDE4DIPEDLSATCSAOESOPHAGUS595p.L601fsc.1801_1801delCFrame_Shift_Del315.49KYSE450N400N
PDE4DIPEDLSATCSAOESOPHAGUS595p.L601fsc.1801_1801delCFrame_Shift_Del315.49TE10N400N
PDE4DIPEDLSATCSAOESOPHAGUS595p.L601fsc.1801_1801delCFrame_Shift_Del315.49TE14N400N
PDE4DIPEDLSATCSAOESOPHAGUS595p.L601fsc.1801_1801delCFrame_Shift_Del315.49TE1N400N
PDE4DIPEDLSATCSAOESOPHAGUS595p.L601fsc.1801_1801delCFrame_Shift_Del315.49TE5N400N
PDE4DIPEDLSATCSAOESOPHAGUS595p.L601fsc.1801_1801delCFrame_Shift_Del315.49TE9N400N
PDE4DIPEDLSATCSAOESOPHAGUS595p.L601fsc.1801_1801delCFrame_Shift_Del315.49TTN400N
PDE4DIPEVEDLSATCOESOPHAGUS593p.L601fsc.1801_1801delCFrame_Shift_Del115.49KYSE140N200N
PDE4DIPEVEDLSATCOESOPHAGUS593p.L601fsc.1801_1801delCFrame_Shift_Del115.49KYSE150N200N
PDE4DIPEVEDLSATCOESOPHAGUS593p.L601fsc.1801_1801delCFrame_Shift_Del115.49KYSE180N200N
PDE4DIPEVEDLSATCOESOPHAGUS593p.L601fsc.1801_1801delCFrame_Shift_Del115.49KYSE450N200N
PDE4DIPEVEDLSATCOESOPHAGUS593p.L601fsc.1801_1801delCFrame_Shift_Del115.49TE10N200N
PDE4DIPEVEDLSATCOESOPHAGUS593p.L601fsc.1801_1801delCFrame_Shift_Del115.49TE14N200N
PDE4DIPEVEDLSATCOESOPHAGUS593p.L601fsc.1801_1801delCFrame_Shift_Del115.49TE1N200N
PDE4DIPEVEDLSATCOESOPHAGUS593p.L601fsc.1801_1801delCFrame_Shift_Del115.49TE5N200N
PDE4DIPEVEDLSATCOESOPHAGUS593p.L601fsc.1801_1801delCFrame_Shift_Del115.49TE9N200N
PDE4DIPEVEDLSATCOESOPHAGUS593p.L601fsc.1801_1801delCFrame_Shift_Del115.49TTN200N
PDE4DIPLSATCSANLOESOPHAGUS597p.L601fsc.1801_1801delCFrame_Shift_Del415.49KYSE140N1102N
PDE4DIPLSATCSANLOESOPHAGUS597p.L601fsc.1801_1801delCFrame_Shift_Del415.49KYSE150N1102N
PDE4DIPLSATCSANLOESOPHAGUS597p.L601fsc.1801_1801delCFrame_Shift_Del415.49KYSE180N1102N
PDE4DIPLSATCSANLOESOPHAGUS597p.L601fsc.1801_1801delCFrame_Shift_Del415.49KYSE450N1102N
PDE4DIPLSATCSANLOESOPHAGUS597p.L601fsc.1801_1801delCFrame_Shift_Del415.49TE10N1102N
PDE4DIPLSATCSANLOESOPHAGUS597p.L601fsc.1801_1801delCFrame_Shift_Del415.49TE14N1102N
PDE4DIPLSATCSANLOESOPHAGUS597p.L601fsc.1801_1801delCFrame_Shift_Del415.49TE1N1102N
PDE4DIPLSATCSANLOESOPHAGUS597p.L601fsc.1801_1801delCFrame_Shift_Del415.49TE5N1102N
PDE4DIPLSATCSANLOESOPHAGUS597p.L601fsc.1801_1801delCFrame_Shift_Del415.49TE9N1102N
PDE4DIPLSATCSANLOESOPHAGUS597p.L601fsc.1801_1801delCFrame_Shift_Del415.49TTN1102N
PDE4DIPSANLDQGRVOESOPHAGUS602p.L601fsc.1801_1801delCFrame_Shift_Del515.49KYSE140N400N
PDE4DIPSANLDQGRVOESOPHAGUS602p.L601fsc.1801_1801delCFrame_Shift_Del515.49KYSE150N400N
PDE4DIPSANLDQGRVOESOPHAGUS602p.L601fsc.1801_1801delCFrame_Shift_Del515.49KYSE180N400N
PDE4DIPSANLDQGRVOESOPHAGUS602p.L601fsc.1801_1801delCFrame_Shift_Del515.49KYSE450N400N
PDE4DIPSANLDQGRVOESOPHAGUS602p.L601fsc.1801_1801delCFrame_Shift_Del515.49TE10N400N
PDE4DIPSANLDQGRVOESOPHAGUS602p.L601fsc.1801_1801delCFrame_Shift_Del515.49TE14N400N
PDE4DIPSANLDQGRVOESOPHAGUS602p.L601fsc.1801_1801delCFrame_Shift_Del515.49TE1N400N
PDE4DIPSANLDQGRVOESOPHAGUS602p.L601fsc.1801_1801delCFrame_Shift_Del515.49TE5N400N
PDE4DIPSANLDQGRVOESOPHAGUS602p.L601fsc.1801_1801delCFrame_Shift_Del515.49TE9N400N
PDE4DIPSANLDQGRVOESOPHAGUS602p.L601fsc.1801_1801delCFrame_Shift_Del515.49TTN400N
PDE4DIPSATCSANLDOESOPHAGUS598p.L601fsc.1801_1801delCFrame_Shift_Del515.49KYSE140N000N
PDE4DIPSATCSANLDOESOPHAGUS598p.L601fsc.1801_1801delCFrame_Shift_Del515.49KYSE150N000N
PDE4DIPSATCSANLDOESOPHAGUS598p.L601fsc.1801_1801delCFrame_Shift_Del515.49KYSE180N000N
PDE4DIPSATCSANLDOESOPHAGUS598p.L601fsc.1801_1801delCFrame_Shift_Del515.49KYSE450N000N
PDE4DIPSATCSANLDOESOPHAGUS598p.L601fsc.1801_1801delCFrame_Shift_Del515.49TE10N000N
PDE4DIPSATCSANLDOESOPHAGUS598p.L601fsc.1801_1801delCFrame_Shift_Del515.49TE14N000N
PDE4DIPSATCSANLDOESOPHAGUS598p.L601fsc.1801_1801delCFrame_Shift_Del515.49TE1N000N
PDE4DIPSATCSANLDOESOPHAGUS598p.L601fsc.1801_1801delCFrame_Shift_Del515.49TE5N000N
PDE4DIPSATCSANLDOESOPHAGUS598p.L601fsc.1801_1801delCFrame_Shift_Del515.49TE9N000N
PDE4DIPSATCSANLDOESOPHAGUS598p.L601fsc.1801_1801delCFrame_Shift_Del515.49TTN000N
PDE4DIPTCSANLDQGOESOPHAGUS600p.L601fsc.1801_1801delCFrame_Shift_Del615.49KYSE140N100N
PDE4DIPTCSANLDQGOESOPHAGUS600p.L601fsc.1801_1801delCFrame_Shift_Del615.49KYSE150N100N
PDE4DIPTCSANLDQGOESOPHAGUS600p.L601fsc.1801_1801delCFrame_Shift_Del615.49KYSE180N100N
PDE4DIPTCSANLDQGOESOPHAGUS600p.L601fsc.1801_1801delCFrame_Shift_Del615.49KYSE450N100N
PDE4DIPTCSANLDQGOESOPHAGUS600p.L601fsc.1801_1801delCFrame_Shift_Del615.49TE10N100N
PDE4DIPTCSANLDQGOESOPHAGUS600p.L601fsc.1801_1801delCFrame_Shift_Del615.49TE14N100N
PDE4DIPTCSANLDQGOESOPHAGUS600p.L601fsc.1801_1801delCFrame_Shift_Del615.49TE1N100N
PDE4DIPTCSANLDQGOESOPHAGUS600p.L601fsc.1801_1801delCFrame_Shift_Del615.49TE5N100N
PDE4DIPTCSANLDQGOESOPHAGUS600p.L601fsc.1801_1801delCFrame_Shift_Del615.49TE9N100N
PDE4DIPTCSANLDQGOESOPHAGUS600p.L601fsc.1801_1801delCFrame_Shift_Del615.49TTN100N
PDE4DIPVEDLSATCSOESOPHAGUS594p.L601fsc.1801_1801delCFrame_Shift_Del215.49KYSE140N300N
PDE4DIPVEDLSATCSOESOPHAGUS594p.L601fsc.1801_1801delCFrame_Shift_Del215.49KYSE150N300N
PDE4DIPVEDLSATCSOESOPHAGUS594p.L601fsc.1801_1801delCFrame_Shift_Del215.49KYSE180N300N
PDE4DIPVEDLSATCSOESOPHAGUS594p.L601fsc.1801_1801delCFrame_Shift_Del215.49KYSE450N300N
PDE4DIPVEDLSATCSOESOPHAGUS594p.L601fsc.1801_1801delCFrame_Shift_Del215.49TE10N300N
PDE4DIPVEDLSATCSOESOPHAGUS594p.L601fsc.1801_1801delCFrame_Shift_Del215.49TE14N300N
PDE4DIPVEDLSATCSOESOPHAGUS594p.L601fsc.1801_1801delCFrame_Shift_Del215.49TE1N300N
PDE4DIPVEDLSATCSOESOPHAGUS594p.L601fsc.1801_1801delCFrame_Shift_Del215.49TE5N300N
PDE4DIPVEDLSATCSOESOPHAGUS594p.L601fsc.1801_1801delCFrame_Shift_Del215.49TE9N300N
PDE4DIPVEDLSATCSOESOPHAGUS594p.L601fsc.1801_1801delCFrame_Shift_Del215.49TTN300N
PDE4DIPADSRKKSSKOESOPHAGUS242p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE140N000Y
PDE4DIPADSRKKSSKOESOPHAGUS242p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE150N000Y
PDE4DIPADSRKKSSKOESOPHAGUS242p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE180N000Y
PDE4DIPADSRKKSSKOESOPHAGUS242p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE450N000Y
PDE4DIPADSRKKSSKOESOPHAGUS242p.E243fsc.729_729delAFrame_Shift_Del517.59TE10N000Y
PDE4DIPADSRKKSSKOESOPHAGUS242p.E243fsc.729_729delAFrame_Shift_Del517.59TE11N000Y
PDE4DIPADSRKKSSKOESOPHAGUS242p.E243fsc.729_729delAFrame_Shift_Del517.59TE14N000Y
PDE4DIPADSRKKSSKOESOPHAGUS242p.E243fsc.729_729delAFrame_Shift_Del517.59TE1N000Y
PDE4DIPADSRKKSSKOESOPHAGUS242p.E243fsc.729_729delAFrame_Shift_Del517.59TE5N000Y
PDE4DIPADSRKKSSKOESOPHAGUS242p.E243fsc.729_729delAFrame_Shift_Del517.59TE9N000Y
PDE4DIPADSRKKSSKOESOPHAGUS242p.E243fsc.729_729delAFrame_Shift_Del517.59TTN000Y
PDE4DIPDSHLADSRKOESOPHAGUS238p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE140N200N
PDE4DIPDSHLADSRKOESOPHAGUS238p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE150N200N
PDE4DIPDSHLADSRKOESOPHAGUS238p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE180N200N
PDE4DIPDSHLADSRKOESOPHAGUS238p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE450N200N
PDE4DIPDSHLADSRKOESOPHAGUS238p.E243fsc.729_729delAFrame_Shift_Del417.59TE10N200N
PDE4DIPDSHLADSRKOESOPHAGUS238p.E243fsc.729_729delAFrame_Shift_Del417.59TE11N200N
PDE4DIPDSHLADSRKOESOPHAGUS238p.E243fsc.729_729delAFrame_Shift_Del417.59TE14N200N
PDE4DIPDSHLADSRKOESOPHAGUS238p.E243fsc.729_729delAFrame_Shift_Del417.59TE1N200N
PDE4DIPDSHLADSRKOESOPHAGUS238p.E243fsc.729_729delAFrame_Shift_Del417.59TE5N200N
PDE4DIPDSHLADSRKOESOPHAGUS238p.E243fsc.729_729delAFrame_Shift_Del417.59TE9N200N
PDE4DIPDSHLADSRKOESOPHAGUS238p.E243fsc.729_729delAFrame_Shift_Del417.59TTN200N
PDE4DIPDSRKKSSKQOESOPHAGUS243p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE140N200Y
PDE4DIPDSRKKSSKQOESOPHAGUS243p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE150N200Y
PDE4DIPDSRKKSSKQOESOPHAGUS243p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE180N200Y
PDE4DIPDSRKKSSKQOESOPHAGUS243p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE450N200Y
PDE4DIPDSRKKSSKQOESOPHAGUS243p.E243fsc.729_729delAFrame_Shift_Del417.59TE10N200Y
PDE4DIPDSRKKSSKQOESOPHAGUS243p.E243fsc.729_729delAFrame_Shift_Del417.59TE11N200Y
PDE4DIPDSRKKSSKQOESOPHAGUS243p.E243fsc.729_729delAFrame_Shift_Del417.59TE14N200Y
PDE4DIPDSRKKSSKQOESOPHAGUS243p.E243fsc.729_729delAFrame_Shift_Del417.59TE1N200Y
PDE4DIPDSRKKSSKQOESOPHAGUS243p.E243fsc.729_729delAFrame_Shift_Del417.59TE5N200Y
PDE4DIPDSRKKSSKQOESOPHAGUS243p.E243fsc.729_729delAFrame_Shift_Del417.59TE9N200Y
PDE4DIPDSRKKSSKQOESOPHAGUS243p.E243fsc.729_729delAFrame_Shift_Del417.59TTN200Y
PDE4DIPHLADSRKKSOESOPHAGUS240p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE140N000N
PDE4DIPHLADSRKKSOESOPHAGUS240p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE150N000N
PDE4DIPHLADSRKKSOESOPHAGUS240p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE180N000N
PDE4DIPHLADSRKKSOESOPHAGUS240p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE450N000N
PDE4DIPHLADSRKKSOESOPHAGUS240p.E243fsc.729_729delAFrame_Shift_Del517.59TE10N000N
PDE4DIPHLADSRKKSOESOPHAGUS240p.E243fsc.729_729delAFrame_Shift_Del517.59TE11N000N
PDE4DIPHLADSRKKSOESOPHAGUS240p.E243fsc.729_729delAFrame_Shift_Del517.59TE14N000N
PDE4DIPHLADSRKKSOESOPHAGUS240p.E243fsc.729_729delAFrame_Shift_Del517.59TE1N000N
PDE4DIPHLADSRKKSOESOPHAGUS240p.E243fsc.729_729delAFrame_Shift_Del517.59TE5N000N
PDE4DIPHLADSRKKSOESOPHAGUS240p.E243fsc.729_729delAFrame_Shift_Del517.59TE9N000N
PDE4DIPHLADSRKKSOESOPHAGUS240p.E243fsc.729_729delAFrame_Shift_Del517.59TTN000N
PDE4DIPKKSSKQRPPOESOPHAGUS246p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE140N100Y
PDE4DIPKKSSKQRPPOESOPHAGUS246p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE150N100Y
PDE4DIPKKSSKQRPPOESOPHAGUS246p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE180N100Y
PDE4DIPKKSSKQRPPOESOPHAGUS246p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE450N100Y
PDE4DIPKKSSKQRPPOESOPHAGUS246p.E243fsc.729_729delAFrame_Shift_Del517.59TE10N100Y
PDE4DIPKKSSKQRPPOESOPHAGUS246p.E243fsc.729_729delAFrame_Shift_Del517.59TE11N100Y
PDE4DIPKKSSKQRPPOESOPHAGUS246p.E243fsc.729_729delAFrame_Shift_Del517.59TE14N100Y
PDE4DIPKKSSKQRPPOESOPHAGUS246p.E243fsc.729_729delAFrame_Shift_Del517.59TE1N100Y
PDE4DIPKKSSKQRPPOESOPHAGUS246p.E243fsc.729_729delAFrame_Shift_Del517.59TE5N100Y
PDE4DIPKKSSKQRPPOESOPHAGUS246p.E243fsc.729_729delAFrame_Shift_Del517.59TE9N100Y
PDE4DIPKKSSKQRPPOESOPHAGUS246p.E243fsc.729_729delAFrame_Shift_Del517.59TTN100Y
PDE4DIPKQRPPTRFFOESOPHAGUS250p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE140Y7100Y
PDE4DIPKQRPPTRFFOESOPHAGUS250p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE150Y7100Y
PDE4DIPKQRPPTRFFOESOPHAGUS250p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE180Y7100Y
PDE4DIPKQRPPTRFFOESOPHAGUS250p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE450Y7100Y
PDE4DIPKQRPPTRFFOESOPHAGUS250p.E243fsc.729_729delAFrame_Shift_Del617.59TE10Y7100Y
PDE4DIPKQRPPTRFFOESOPHAGUS250p.E243fsc.729_729delAFrame_Shift_Del617.59TE11Y7100Y
PDE4DIPKQRPPTRFFOESOPHAGUS250p.E243fsc.729_729delAFrame_Shift_Del617.59TE14Y7100Y
PDE4DIPKQRPPTRFFOESOPHAGUS250p.E243fsc.729_729delAFrame_Shift_Del617.59TE1Y7100Y
PDE4DIPKQRPPTRFFOESOPHAGUS250p.E243fsc.729_729delAFrame_Shift_Del617.59TE5Y7100Y
PDE4DIPKQRPPTRFFOESOPHAGUS250p.E243fsc.729_729delAFrame_Shift_Del617.59TE9Y7100Y
PDE4DIPKQRPPTRFFOESOPHAGUS250p.E243fsc.729_729delAFrame_Shift_Del617.59TTY7100Y
PDE4DIPKSSKQRPPTOESOPHAGUS247p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE140N200Y
PDE4DIPKSSKQRPPTOESOPHAGUS247p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE150N200Y
PDE4DIPKSSKQRPPTOESOPHAGUS247p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE180N200Y
PDE4DIPKSSKQRPPTOESOPHAGUS247p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE450N200Y
PDE4DIPKSSKQRPPTOESOPHAGUS247p.E243fsc.729_729delAFrame_Shift_Del517.59TE10N200Y
PDE4DIPKSSKQRPPTOESOPHAGUS247p.E243fsc.729_729delAFrame_Shift_Del517.59TE11N200Y
PDE4DIPKSSKQRPPTOESOPHAGUS247p.E243fsc.729_729delAFrame_Shift_Del517.59TE14N200Y
PDE4DIPKSSKQRPPTOESOPHAGUS247p.E243fsc.729_729delAFrame_Shift_Del517.59TE1N200Y
PDE4DIPKSSKQRPPTOESOPHAGUS247p.E243fsc.729_729delAFrame_Shift_Del517.59TE5N200Y
PDE4DIPKSSKQRPPTOESOPHAGUS247p.E243fsc.729_729delAFrame_Shift_Del517.59TE9N200Y
PDE4DIPKSSKQRPPTOESOPHAGUS247p.E243fsc.729_729delAFrame_Shift_Del517.59TTN200Y
PDE4DIPLADSRKKSSOESOPHAGUS241p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE140N100N
PDE4DIPLADSRKKSSOESOPHAGUS241p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE150N100N
PDE4DIPLADSRKKSSOESOPHAGUS241p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE180N100N
PDE4DIPLADSRKKSSOESOPHAGUS241p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE450N100N
PDE4DIPLADSRKKSSOESOPHAGUS241p.E243fsc.729_729delAFrame_Shift_Del517.59TE10N100N
PDE4DIPLADSRKKSSOESOPHAGUS241p.E243fsc.729_729delAFrame_Shift_Del517.59TE11N100N
PDE4DIPLADSRKKSSOESOPHAGUS241p.E243fsc.729_729delAFrame_Shift_Del517.59TE14N100N
PDE4DIPLADSRKKSSOESOPHAGUS241p.E243fsc.729_729delAFrame_Shift_Del517.59TE1N100N
PDE4DIPLADSRKKSSOESOPHAGUS241p.E243fsc.729_729delAFrame_Shift_Del517.59TE5N100N
PDE4DIPLADSRKKSSOESOPHAGUS241p.E243fsc.729_729delAFrame_Shift_Del517.59TE9N100N
PDE4DIPLADSRKKSSOESOPHAGUS241p.E243fsc.729_729delAFrame_Shift_Del517.59TTN100N
PDE4DIPPPTRFFKRNOESOPHAGUS253p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE140N000Y
PDE4DIPPPTRFFKRNOESOPHAGUS253p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE150N000Y
PDE4DIPPPTRFFKRNOESOPHAGUS253p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE180N000Y
PDE4DIPPPTRFFKRNOESOPHAGUS253p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE450N000Y
PDE4DIPPPTRFFKRNOESOPHAGUS253p.E243fsc.729_729delAFrame_Shift_Del517.59TE10N000Y
PDE4DIPPPTRFFKRNOESOPHAGUS253p.E243fsc.729_729delAFrame_Shift_Del517.59TE11N000Y
PDE4DIPPPTRFFKRNOESOPHAGUS253p.E243fsc.729_729delAFrame_Shift_Del517.59TE14N000Y
PDE4DIPPPTRFFKRNOESOPHAGUS253p.E243fsc.729_729delAFrame_Shift_Del517.59TE1N000Y
PDE4DIPPPTRFFKRNOESOPHAGUS253p.E243fsc.729_729delAFrame_Shift_Del517.59TE5N000Y
PDE4DIPPPTRFFKRNOESOPHAGUS253p.E243fsc.729_729delAFrame_Shift_Del517.59TE9N000Y
PDE4DIPPPTRFFKRNOESOPHAGUS253p.E243fsc.729_729delAFrame_Shift_Del517.59TTN000Y
PDE4DIPPTRFFKRNLOESOPHAGUS254p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE140Y2110Y
PDE4DIPPTRFFKRNLOESOPHAGUS254p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE150Y2110Y
PDE4DIPPTRFFKRNLOESOPHAGUS254p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE180Y2110Y
PDE4DIPPTRFFKRNLOESOPHAGUS254p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE450Y2110Y
PDE4DIPPTRFFKRNLOESOPHAGUS254p.E243fsc.729_729delAFrame_Shift_Del617.59TE10Y2110Y
PDE4DIPPTRFFKRNLOESOPHAGUS254p.E243fsc.729_729delAFrame_Shift_Del617.59TE11Y2110Y
PDE4DIPPTRFFKRNLOESOPHAGUS254p.E243fsc.729_729delAFrame_Shift_Del617.59TE14Y2110Y
PDE4DIPPTRFFKRNLOESOPHAGUS254p.E243fsc.729_729delAFrame_Shift_Del617.59TE1Y2110Y
PDE4DIPPTRFFKRNLOESOPHAGUS254p.E243fsc.729_729delAFrame_Shift_Del617.59TE5Y2110Y
PDE4DIPPTRFFKRNLOESOPHAGUS254p.E243fsc.729_729delAFrame_Shift_Del617.59TE9Y2110Y
PDE4DIPPTRFFKRNLOESOPHAGUS254p.E243fsc.729_729delAFrame_Shift_Del617.59TTY2110Y
PDE4DIPQRPPTRFFKOESOPHAGUS251p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE140Y2100Y
PDE4DIPQRPPTRFFKOESOPHAGUS251p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE150Y2100Y
PDE4DIPQRPPTRFFKOESOPHAGUS251p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE180Y2100Y
PDE4DIPQRPPTRFFKOESOPHAGUS251p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE450Y2100Y
PDE4DIPQRPPTRFFKOESOPHAGUS251p.E243fsc.729_729delAFrame_Shift_Del617.59TE10Y2100Y
PDE4DIPQRPPTRFFKOESOPHAGUS251p.E243fsc.729_729delAFrame_Shift_Del617.59TE11Y2100Y
PDE4DIPQRPPTRFFKOESOPHAGUS251p.E243fsc.729_729delAFrame_Shift_Del617.59TE14Y2100Y
PDE4DIPQRPPTRFFKOESOPHAGUS251p.E243fsc.729_729delAFrame_Shift_Del617.59TE1Y2100Y
PDE4DIPQRPPTRFFKOESOPHAGUS251p.E243fsc.729_729delAFrame_Shift_Del617.59TE5Y2100Y
PDE4DIPQRPPTRFFKOESOPHAGUS251p.E243fsc.729_729delAFrame_Shift_Del617.59TE9Y2100Y
PDE4DIPQRPPTRFFKOESOPHAGUS251p.E243fsc.729_729delAFrame_Shift_Del617.59TTY2100Y
PDE4DIPRFFKRNLMKOESOPHAGUS256p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE140Y2130N
PDE4DIPRFFKRNLMKOESOPHAGUS256p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE150Y2130N
PDE4DIPRFFKRNLMKOESOPHAGUS256p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE180Y2130N
PDE4DIPRFFKRNLMKOESOPHAGUS256p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE450Y2130N
PDE4DIPRFFKRNLMKOESOPHAGUS256p.E243fsc.729_729delAFrame_Shift_Del617.59TE10Y2130N
PDE4DIPRFFKRNLMKOESOPHAGUS256p.E243fsc.729_729delAFrame_Shift_Del617.59TE11Y2130N
PDE4DIPRFFKRNLMKOESOPHAGUS256p.E243fsc.729_729delAFrame_Shift_Del617.59TE14Y2130N
PDE4DIPRFFKRNLMKOESOPHAGUS256p.E243fsc.729_729delAFrame_Shift_Del617.59TE1Y2130N
PDE4DIPRFFKRNLMKOESOPHAGUS256p.E243fsc.729_729delAFrame_Shift_Del617.59TE5Y2130N
PDE4DIPRFFKRNLMKOESOPHAGUS256p.E243fsc.729_729delAFrame_Shift_Del617.59TE9Y2130N
PDE4DIPRFFKRNLMKOESOPHAGUS256p.E243fsc.729_729delAFrame_Shift_Del617.59TTY2130N
PDE4DIPRKKSSKQRPOESOPHAGUS245p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE140N100Y
PDE4DIPRKKSSKQRPOESOPHAGUS245p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE150N100Y
PDE4DIPRKKSSKQRPOESOPHAGUS245p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE180N100Y
PDE4DIPRKKSSKQRPOESOPHAGUS245p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE450N100Y
PDE4DIPRKKSSKQRPOESOPHAGUS245p.E243fsc.729_729delAFrame_Shift_Del417.59TE10N100Y
PDE4DIPRKKSSKQRPOESOPHAGUS245p.E243fsc.729_729delAFrame_Shift_Del417.59TE11N100Y
PDE4DIPRKKSSKQRPOESOPHAGUS245p.E243fsc.729_729delAFrame_Shift_Del417.59TE14N100Y
PDE4DIPRKKSSKQRPOESOPHAGUS245p.E243fsc.729_729delAFrame_Shift_Del417.59TE1N100Y
PDE4DIPRKKSSKQRPOESOPHAGUS245p.E243fsc.729_729delAFrame_Shift_Del417.59TE5N100Y
PDE4DIPRKKSSKQRPOESOPHAGUS245p.E243fsc.729_729delAFrame_Shift_Del417.59TE9N100Y
PDE4DIPRKKSSKQRPOESOPHAGUS245p.E243fsc.729_729delAFrame_Shift_Del417.59TTN100Y
PDE4DIPRPPTRFFKROESOPHAGUS252p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE140Y590Y
PDE4DIPRPPTRFFKROESOPHAGUS252p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE150Y590Y
PDE4DIPRPPTRFFKROESOPHAGUS252p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE180Y590Y
PDE4DIPRPPTRFFKROESOPHAGUS252p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE450Y590Y
PDE4DIPRPPTRFFKROESOPHAGUS252p.E243fsc.729_729delAFrame_Shift_Del617.59TE10Y590Y
PDE4DIPRPPTRFFKROESOPHAGUS252p.E243fsc.729_729delAFrame_Shift_Del617.59TE11Y590Y
PDE4DIPRPPTRFFKROESOPHAGUS252p.E243fsc.729_729delAFrame_Shift_Del617.59TE14Y590Y
PDE4DIPRPPTRFFKROESOPHAGUS252p.E243fsc.729_729delAFrame_Shift_Del617.59TE1Y590Y
PDE4DIPRPPTRFFKROESOPHAGUS252p.E243fsc.729_729delAFrame_Shift_Del617.59TE5Y590Y
PDE4DIPRPPTRFFKROESOPHAGUS252p.E243fsc.729_729delAFrame_Shift_Del617.59TE9Y590Y
PDE4DIPRPPTRFFKROESOPHAGUS252p.E243fsc.729_729delAFrame_Shift_Del617.59TTY590Y
PDE4DIPSDSHLADSROESOPHAGUS237p.E243fsc.729_729delAFrame_Shift_Del317.59KYSE140N000N
PDE4DIPSDSHLADSROESOPHAGUS237p.E243fsc.729_729delAFrame_Shift_Del317.59KYSE150N000N
PDE4DIPSDSHLADSROESOPHAGUS237p.E243fsc.729_729delAFrame_Shift_Del317.59KYSE180N000N
PDE4DIPSDSHLADSROESOPHAGUS237p.E243fsc.729_729delAFrame_Shift_Del317.59KYSE450N000N
PDE4DIPSDSHLADSROESOPHAGUS237p.E243fsc.729_729delAFrame_Shift_Del317.59TE10N000N
PDE4DIPSDSHLADSROESOPHAGUS237p.E243fsc.729_729delAFrame_Shift_Del317.59TE11N000N
PDE4DIPSDSHLADSROESOPHAGUS237p.E243fsc.729_729delAFrame_Shift_Del317.59TE14N000N
PDE4DIPSDSHLADSROESOPHAGUS237p.E243fsc.729_729delAFrame_Shift_Del317.59TE1N000N
PDE4DIPSDSHLADSROESOPHAGUS237p.E243fsc.729_729delAFrame_Shift_Del317.59TE5N000N
PDE4DIPSDSHLADSROESOPHAGUS237p.E243fsc.729_729delAFrame_Shift_Del317.59TE9N000N
PDE4DIPSDSHLADSROESOPHAGUS237p.E243fsc.729_729delAFrame_Shift_Del317.59TTN000N
PDE4DIPSHLADSRKKOESOPHAGUS239p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE140N000N
PDE4DIPSHLADSRKKOESOPHAGUS239p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE150N000N
PDE4DIPSHLADSRKKOESOPHAGUS239p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE180N000N
PDE4DIPSHLADSRKKOESOPHAGUS239p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE450N000N
PDE4DIPSHLADSRKKOESOPHAGUS239p.E243fsc.729_729delAFrame_Shift_Del417.59TE10N000N
PDE4DIPSHLADSRKKOESOPHAGUS239p.E243fsc.729_729delAFrame_Shift_Del417.59TE11N000N
PDE4DIPSHLADSRKKOESOPHAGUS239p.E243fsc.729_729delAFrame_Shift_Del417.59TE14N000N
PDE4DIPSHLADSRKKOESOPHAGUS239p.E243fsc.729_729delAFrame_Shift_Del417.59TE1N000N
PDE4DIPSHLADSRKKOESOPHAGUS239p.E243fsc.729_729delAFrame_Shift_Del417.59TE5N000N
PDE4DIPSHLADSRKKOESOPHAGUS239p.E243fsc.729_729delAFrame_Shift_Del417.59TE9N000N
PDE4DIPSHLADSRKKOESOPHAGUS239p.E243fsc.729_729delAFrame_Shift_Del417.59TTN000N
PDE4DIPSKQRPPTRFOESOPHAGUS249p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE140N200Y
PDE4DIPSKQRPPTRFOESOPHAGUS249p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE150N200Y
PDE4DIPSKQRPPTRFOESOPHAGUS249p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE180N200Y
PDE4DIPSKQRPPTRFOESOPHAGUS249p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE450N200Y
PDE4DIPSKQRPPTRFOESOPHAGUS249p.E243fsc.729_729delAFrame_Shift_Del517.59TE10N200Y
PDE4DIPSKQRPPTRFOESOPHAGUS249p.E243fsc.729_729delAFrame_Shift_Del517.59TE11N200Y
PDE4DIPSKQRPPTRFOESOPHAGUS249p.E243fsc.729_729delAFrame_Shift_Del517.59TE14N200Y
PDE4DIPSKQRPPTRFOESOPHAGUS249p.E243fsc.729_729delAFrame_Shift_Del517.59TE1N200Y
PDE4DIPSKQRPPTRFOESOPHAGUS249p.E243fsc.729_729delAFrame_Shift_Del517.59TE5N200Y
PDE4DIPSKQRPPTRFOESOPHAGUS249p.E243fsc.729_729delAFrame_Shift_Del517.59TE9N200Y
PDE4DIPSKQRPPTRFOESOPHAGUS249p.E243fsc.729_729delAFrame_Shift_Del517.59TTN200Y
PDE4DIPSRKKSSKQROESOPHAGUS244p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE140Y390Y
PDE4DIPSRKKSSKQROESOPHAGUS244p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE150Y390Y
PDE4DIPSRKKSSKQROESOPHAGUS244p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE180Y390Y
PDE4DIPSRKKSSKQROESOPHAGUS244p.E243fsc.729_729delAFrame_Shift_Del417.59KYSE450Y390Y
PDE4DIPSRKKSSKQROESOPHAGUS244p.E243fsc.729_729delAFrame_Shift_Del417.59TE10Y390Y
PDE4DIPSRKKSSKQROESOPHAGUS244p.E243fsc.729_729delAFrame_Shift_Del417.59TE11Y390Y
PDE4DIPSRKKSSKQROESOPHAGUS244p.E243fsc.729_729delAFrame_Shift_Del417.59TE14Y390Y
PDE4DIPSRKKSSKQROESOPHAGUS244p.E243fsc.729_729delAFrame_Shift_Del417.59TE1Y390Y
PDE4DIPSRKKSSKQROESOPHAGUS244p.E243fsc.729_729delAFrame_Shift_Del417.59TE5Y390Y
PDE4DIPSRKKSSKQROESOPHAGUS244p.E243fsc.729_729delAFrame_Shift_Del417.59TE9Y390Y
PDE4DIPSRKKSSKQROESOPHAGUS244p.E243fsc.729_729delAFrame_Shift_Del417.59TTY390Y
PDE4DIPSSKQRPPTROESOPHAGUS248p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE140Y390Y
PDE4DIPSSKQRPPTROESOPHAGUS248p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE150Y390Y
PDE4DIPSSKQRPPTROESOPHAGUS248p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE180Y390Y
PDE4DIPSSKQRPPTROESOPHAGUS248p.E243fsc.729_729delAFrame_Shift_Del517.59KYSE450Y390Y
PDE4DIPSSKQRPPTROESOPHAGUS248p.E243fsc.729_729delAFrame_Shift_Del517.59TE10Y390Y
PDE4DIPSSKQRPPTROESOPHAGUS248p.E243fsc.729_729delAFrame_Shift_Del517.59TE11Y390Y
PDE4DIPSSKQRPPTROESOPHAGUS248p.E243fsc.729_729delAFrame_Shift_Del517.59TE14Y390Y
PDE4DIPSSKQRPPTROESOPHAGUS248p.E243fsc.729_729delAFrame_Shift_Del517.59TE1Y390Y
PDE4DIPSSKQRPPTROESOPHAGUS248p.E243fsc.729_729delAFrame_Shift_Del517.59TE5Y390Y
PDE4DIPSSKQRPPTROESOPHAGUS248p.E243fsc.729_729delAFrame_Shift_Del517.59TE9Y390Y
PDE4DIPSSKQRPPTROESOPHAGUS248p.E243fsc.729_729delAFrame_Shift_Del517.59TTY390Y
PDE4DIPSVSDSHLADOESOPHAGUS235p.E243fsc.729_729delAFrame_Shift_Del117.59KYSE140N000N
PDE4DIPSVSDSHLADOESOPHAGUS235p.E243fsc.729_729delAFrame_Shift_Del117.59KYSE150N000N
PDE4DIPSVSDSHLADOESOPHAGUS235p.E243fsc.729_729delAFrame_Shift_Del117.59KYSE180N000N
PDE4DIPSVSDSHLADOESOPHAGUS235p.E243fsc.729_729delAFrame_Shift_Del117.59KYSE450N000N
PDE4DIPSVSDSHLADOESOPHAGUS235p.E243fsc.729_729delAFrame_Shift_Del117.59TE10N000N
PDE4DIPSVSDSHLADOESOPHAGUS235p.E243fsc.729_729delAFrame_Shift_Del117.59TE11N000N
PDE4DIPSVSDSHLADOESOPHAGUS235p.E243fsc.729_729delAFrame_Shift_Del117.59TE14N000N
PDE4DIPSVSDSHLADOESOPHAGUS235p.E243fsc.729_729delAFrame_Shift_Del117.59TE1N000N
PDE4DIPSVSDSHLADOESOPHAGUS235p.E243fsc.729_729delAFrame_Shift_Del117.59TE5N000N
PDE4DIPSVSDSHLADOESOPHAGUS235p.E243fsc.729_729delAFrame_Shift_Del117.59TE9N000N
PDE4DIPSVSDSHLADOESOPHAGUS235p.E243fsc.729_729delAFrame_Shift_Del117.59TTN000N
PDE4DIPTRFFKRNLMOESOPHAGUS255p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE140Y390Y
PDE4DIPTRFFKRNLMOESOPHAGUS255p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE150Y390Y
PDE4DIPTRFFKRNLMOESOPHAGUS255p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE180Y390Y
PDE4DIPTRFFKRNLMOESOPHAGUS255p.E243fsc.729_729delAFrame_Shift_Del617.59KYSE450Y390Y
PDE4DIPTRFFKRNLMOESOPHAGUS255p.E243fsc.729_729delAFrame_Shift_Del617.59TE10Y390Y
PDE4DIPTRFFKRNLMOESOPHAGUS255p.E243fsc.729_729delAFrame_Shift_Del617.59TE11Y390Y
PDE4DIPTRFFKRNLMOESOPHAGUS255p.E243fsc.729_729delAFrame_Shift_Del617.59TE14Y390Y
PDE4DIPTRFFKRNLMOESOPHAGUS255p.E243fsc.729_729delAFrame_Shift_Del617.59TE1Y390Y
PDE4DIPTRFFKRNLMOESOPHAGUS255p.E243fsc.729_729delAFrame_Shift_Del617.59TE5Y390Y
PDE4DIPTRFFKRNLMOESOPHAGUS255p.E243fsc.729_729delAFrame_Shift_Del617.59TE9Y390Y
PDE4DIPTRFFKRNLMOESOPHAGUS255p.E243fsc.729_729delAFrame_Shift_Del617.59TTY390Y
PDE4DIPVSDSHLADSOESOPHAGUS236p.E243fsc.729_729delAFrame_Shift_Del217.59KYSE140N100N
PDE4DIPVSDSHLADSOESOPHAGUS236p.E243fsc.729_729delAFrame_Shift_Del217.59KYSE150N100N
PDE4DIPVSDSHLADSOESOPHAGUS236p.E243fsc.729_729delAFrame_Shift_Del217.59KYSE180N100N
PDE4DIPVSDSHLADSOESOPHAGUS236p.E243fsc.729_729delAFrame_Shift_Del217.59KYSE450N100N
PDE4DIPVSDSHLADSOESOPHAGUS236p.E243fsc.729_729delAFrame_Shift_Del217.59TE10N100N
PDE4DIPVSDSHLADSOESOPHAGUS236p.E243fsc.729_729delAFrame_Shift_Del217.59TE11N100N
PDE4DIPVSDSHLADSOESOPHAGUS236p.E243fsc.729_729delAFrame_Shift_Del217.59TE14N100N
PDE4DIPVSDSHLADSOESOPHAGUS236p.E243fsc.729_729delAFrame_Shift_Del217.59TE1N100N
PDE4DIPVSDSHLADSOESOPHAGUS236p.E243fsc.729_729delAFrame_Shift_Del217.59TE5N100N
PDE4DIPVSDSHLADSOESOPHAGUS236p.E243fsc.729_729delAFrame_Shift_Del217.59TE9N100N
PDE4DIPVSDSHLADSOESOPHAGUS236p.E243fsc.729_729delAFrame_Shift_Del217.59TTN100N
PDE4DIPDKAVLWSGLOESOPHAGUS483p.V486fsc.1458_1458delTFrame_Shift_Del518.58COLO680NN400N
PDE4DIPDKAVLWSGLOESOPHAGUS483p.V486fsc.1458_1458delTFrame_Shift_Del518.58OE21N400N
PDE4DIPDKAVLWSGLOESOPHAGUS483p.V486fsc.1458_1458delTFrame_Shift_Del518.58TE4N400N
PDE4DIPHDKAVLWSGOESOPHAGUS482p.V486fsc.1458_1458delTFrame_Shift_Del418.58COLO680NN000N
PDE4DIPHDKAVLWSGOESOPHAGUS482p.V486fsc.1458_1458delTFrame_Shift_Del418.58OE21N000N
PDE4DIPHDKAVLWSGOESOPHAGUS482p.V486fsc.1458_1458delTFrame_Shift_Del418.58TE4N000N
PDE4DIPIHDKAVLWSOESOPHAGUS481p.V486fsc.1458_1458delTFrame_Shift_Del318.58COLO680NN2020N
PDE4DIPIHDKAVLWSOESOPHAGUS481p.V486fsc.1458_1458delTFrame_Shift_Del318.58OE21N2020N
PDE4DIPIHDKAVLWSOESOPHAGUS481p.V486fsc.1458_1458delTFrame_Shift_Del318.58TE4N2020N
PDE4DIPQRIHDKAVLOESOPHAGUS479p.V486fsc.1458_1458delTFrame_Shift_Del118.58COLO680NN600N
PDE4DIPQRIHDKAVLOESOPHAGUS479p.V486fsc.1458_1458delTFrame_Shift_Del118.58OE21N600N
PDE4DIPQRIHDKAVLOESOPHAGUS479p.V486fsc.1458_1458delTFrame_Shift_Del118.58TE4N600N
PDE4DIPRIHDKAVLWOESOPHAGUS480p.V486fsc.1458_1458delTFrame_Shift_Del218.58COLO680NN400N
PDE4DIPRIHDKAVLWOESOPHAGUS480p.V486fsc.1458_1458delTFrame_Shift_Del218.58OE21N400N
PDE4DIPRIHDKAVLWOESOPHAGUS480p.V486fsc.1458_1458delTFrame_Shift_Del218.58TE4N400N
PDE4DIPAAVRHQWSPOESOPHAGUS1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NN000N
PDE4DIPAAVRHQWSPOESOPHAGUS1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21N000N
PDE4DIPAAVRHQWSPOESOPHAGUS1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4N000N
PDE4DIPACQLPRIPPOESOPHAGUS1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NN000N
PDE4DIPACQLPRIPPOESOPHAGUS1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21N000N
PDE4DIPACQLPRIPPOESOPHAGUS1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4N000N
PDE4DIPAFIFTPYPSOESOPHAGUS1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPAFIFTPYPSOESOPHAGUS1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPAFIFTPYPSOESOPHAGUS1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPAFLRHHCPQOESOPHAGUS1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPAFLRHHCPQOESOPHAGUS1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPAFLRHHCPQOESOPHAGUS1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPALFLLLPQLOESOPHAGUS1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NY16110N
PDE4DIPALFLLLPQLOESOPHAGUS1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21Y16110N
PDE4DIPALFLLLPQLOESOPHAGUS1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4Y16110N
PDE4DIPALSSLAAVROESOPHAGUS1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NY6100N
PDE4DIPALSSLAAVROESOPHAGUS1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21Y6100N
PDE4DIPALSSLAAVROESOPHAGUS1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4Y6100N
PDE4DIPAPLALSSLAOESOPHAGUS1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN1000N
PDE4DIPAPLALSSLAOESOPHAGUS1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N1000N
PDE4DIPAPLALSSLAOESOPHAGUS1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N1000N
PDE4DIPASCLSAPLAOESOPHAGUS1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NN100N
PDE4DIPASCLSAPLAOESOPHAGUS1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21N100N
PDE4DIPASCLSAPLAOESOPHAGUS1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4N100N
PDE4DIPASRGLRPNPOESOPHAGUS1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000Y
PDE4DIPASRGLRPNPOESOPHAGUS1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000Y
PDE4DIPASRGLRPNPOESOPHAGUS1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000Y
PDE4DIPATPSACQLPOESOPHAGUS1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPATPSACQLPOESOPHAGUS1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPATPSACQLPOESOPHAGUS1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPAVRHQWSPWOESOPHAGUS1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NN100N
PDE4DIPAVRHQWSPWOESOPHAGUS1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21N100N
PDE4DIPAVRHQWSPWOESOPHAGUS1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4N100N
PDE4DIPCCRSSWEKVOESOPHAGUS1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN100N
PDE4DIPCCRSSWEKVOESOPHAGUS1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N100N
PDE4DIPCCRSSWEKVOESOPHAGUS1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N100N
PDE4DIPCLSAPLALSOESOPHAGUS1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPCLSAPLALSOESOPHAGUS1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPCLSAPLALSOESOPHAGUS1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPCPQLHPASCOESOPHAGUS1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN400N
PDE4DIPCPQLHPASCOESOPHAGUS1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N400N
PDE4DIPCPQLHPASCOESOPHAGUS1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N400N
PDE4DIPCQLPRIPPROESOPHAGUS1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN600Y
PDE4DIPCQLPRIPPROESOPHAGUS1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N600Y
PDE4DIPCQLPRIPPROESOPHAGUS1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N600Y
PDE4DIPCRSSWEKVPOESOPHAGUS1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPCRSSWEKVPOESOPHAGUS1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPCRSSWEKVPOESOPHAGUS1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPEKVPALFLLOESOPHAGUS1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NN800N
PDE4DIPEKVPALFLLOESOPHAGUS1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21N800N
PDE4DIPEKVPALFLLOESOPHAGUS1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4N800N
PDE4DIPFIFTPYPSWOESOPHAGUS1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NN500N
PDE4DIPFIFTPYPSWOESOPHAGUS1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21N500N
PDE4DIPFIFTPYPSWOESOPHAGUS1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4N500N
PDE4DIPFLLLPQLHCOESOPHAGUS1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN7023N
PDE4DIPFLLLPQLHCOESOPHAGUS1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N7023N
PDE4DIPFLLLPQLHCOESOPHAGUS1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N7023N
PDE4DIPFLRHHCPQLOESOPHAGUS1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NY1399N
PDE4DIPFLRHHCPQLOESOPHAGUS1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21Y1399N
PDE4DIPFLRHHCPQLOESOPHAGUS1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4Y1399N
PDE4DIPFTPYPSWLAOESOPHAGUS1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NN602N
PDE4DIPFTPYPSWLAOESOPHAGUS1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21N602N
PDE4DIPFTPYPSWLAOESOPHAGUS1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4N602N
PDE4DIPGLRPNPTATOESOPHAGUS1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN200N
PDE4DIPGLRPNPTATOESOPHAGUS1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N200N
PDE4DIPGLRPNPTATOESOPHAGUS1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N200N
PDE4DIPHCPQLHPASOESOPHAGUS1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN100N
PDE4DIPHCPQLHPASOESOPHAGUS1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N100N
PDE4DIPHCPQLHPASOESOPHAGUS1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N100N
PDE4DIPHHCPQLHPAOESOPHAGUS1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NN200N
PDE4DIPHHCPQLHPAOESOPHAGUS1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21N200N
PDE4DIPHHCPQLHPAOESOPHAGUS1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4N200N
PDE4DIPHPASCLSAPOESOPHAGUS1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN100N
PDE4DIPHPASCLSAPOESOPHAGUS1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N100N
PDE4DIPHPASCLSAPOESOPHAGUS1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N100N
PDE4DIPHQWSPWLRLOESOPHAGUS1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NY14120Y
PDE4DIPHQWSPWLRLOESOPHAGUS1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21Y14120Y
PDE4DIPHQWSPWLRLOESOPHAGUS1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4Y14120Y
PDE4DIPIFTPYPSWLOESOPHAGUS1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NN900N
PDE4DIPIFTPYPSWLOESOPHAGUS1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21N900N
PDE4DIPIFTPYPSWLOESOPHAGUS1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4N900N
PDE4DIPIPPRRPTRPOESOPHAGUS1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN100N
PDE4DIPIPPRRPTRPOESOPHAGUS1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N100N
PDE4DIPIPPRRPTRPOESOPHAGUS1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N100N
PDE4DIPIQAFIFTPYOESOPHAGUS1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NN900N
PDE4DIPIQAFIFTPYOESOPHAGUS1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21N900N
PDE4DIPIQAFIFTPYOESOPHAGUS1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4N900N
PDE4DIPKPSSTSASROESOPHAGUS1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35COLO680NY490N
PDE4DIPKPSSTSASROESOPHAGUS1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35OE21Y490N
PDE4DIPKPSSTSASROESOPHAGUS1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35TE4Y490N
PDE4DIPKVPALFLLLOESOPHAGUS1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NY1890N
PDE4DIPKVPALFLLLOESOPHAGUS1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21Y1890N
PDE4DIPKVPALFLLLOESOPHAGUS1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4Y1890N
PDE4DIPLAAVRHQWSOESOPHAGUS1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN100N
PDE4DIPLAAVRHQWSOESOPHAGUS1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N100N
PDE4DIPLAAVRHQWSOESOPHAGUS1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N100N
PDE4DIPLAFLRHHCPOESOPHAGUS1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NN000N
PDE4DIPLAFLRHHCPOESOPHAGUS1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21N000N
PDE4DIPLAFLRHHCPOESOPHAGUS1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4N000N
PDE4DIPLALSSLAAVOESOPHAGUS1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NN1000N
PDE4DIPLALSSLAAVOESOPHAGUS1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21N1000N
PDE4DIPLALSSLAAVOESOPHAGUS1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4N1000N
PDE4DIPLFLLLPQLHOESOPHAGUS1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN0032N
PDE4DIPLFLLLPQLHOESOPHAGUS1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N0032N
PDE4DIPLFLLLPQLHOESOPHAGUS1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N0032N
PDE4DIPLHPASCLSAOESOPHAGUS1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NN307N
PDE4DIPLHPASCLSAOESOPHAGUS1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21N307N
PDE4DIPLHPASCLSAOESOPHAGUS1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4N307N
PDE4DIPLPRIPPRRPOESOPHAGUS1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN100N
PDE4DIPLPRIPPRRPOESOPHAGUS1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N100N
PDE4DIPLPRIPPRRPOESOPHAGUS1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N100N
PDE4DIPLRHHCPQLHOESOPHAGUS1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN2020N
PDE4DIPLRHHCPQLHOESOPHAGUS1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N2020N
PDE4DIPLRHHCPQLHOESOPHAGUS1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N2020N
PDE4DIPLRLSRSYRCOESOPHAGUS1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NN3033N
PDE4DIPLRLSRSYRCOESOPHAGUS1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21N3033N
PDE4DIPLRLSRSYRCOESOPHAGUS1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4N3033N
PDE4DIPLRPNPTATPOESOPHAGUS1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN1029N
PDE4DIPLRPNPTATPOESOPHAGUS1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N1029N
PDE4DIPLRPNPTATPOESOPHAGUS1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N1029N
PDE4DIPLSAPLALSSOESOPHAGUS1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NN200N
PDE4DIPLSAPLALSSOESOPHAGUS1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21N200N
PDE4DIPLSAPLALSSOESOPHAGUS1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4N200N
PDE4DIPLSRSYRCCROESOPHAGUS1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN300N
PDE4DIPLSRSYRCCROESOPHAGUS1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N300N
PDE4DIPLSRSYRCCROESOPHAGUS1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N300N
PDE4DIPLSSLAAVRHOESOPHAGUS1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPLSSLAAVRHOESOPHAGUS1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPLSSLAAVRHOESOPHAGUS1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPNPTATPSACOESOPHAGUS1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NN400N
PDE4DIPNPTATPSACOESOPHAGUS1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21N400N
PDE4DIPNPTATPSACOESOPHAGUS1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4N400N
PDE4DIPPALFLLLPQOESOPHAGUS1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPPALFLLLPQOESOPHAGUS1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPPALFLLLPQOESOPHAGUS1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPPASCLSAPLOESOPHAGUS1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NN000N
PDE4DIPPASCLSAPLOESOPHAGUS1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21N000N
PDE4DIPPASCLSAPLOESOPHAGUS1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4N000N
PDE4DIPPIQAFIFTPOESOPHAGUS1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NN000N
PDE4DIPPIQAFIFTPOESOPHAGUS1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21N000N
PDE4DIPPIQAFIFTPOESOPHAGUS1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4N000N
PDE4DIPPLALSSLAAOESOPHAGUS1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NN100N
PDE4DIPPLALSSLAAOESOPHAGUS1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21N100N
PDE4DIPPLALSSLAAOESOPHAGUS1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4N100N
PDE4DIPPNPTATPSAOESOPHAGUS1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPPNPTATPSAOESOPHAGUS1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPPNPTATPSAOESOPHAGUS1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPPPRRPTRPIOESOPHAGUS1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN900N
PDE4DIPPPRRPTRPIOESOPHAGUS1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N900N
PDE4DIPPPRRPTRPIOESOPHAGUS1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N900N
PDE4DIPPQLHPASCLOESOPHAGUS1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN200N
PDE4DIPPQLHPASCLOESOPHAGUS1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N200N
PDE4DIPPQLHPASCLOESOPHAGUS1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N200N
PDE4DIPPRIPPRRPTOESOPHAGUS1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPPRIPPRRPTOESOPHAGUS1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPPRIPPRRPTOESOPHAGUS1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPPRRPTRPIQOESOPHAGUS1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPPRRPTRPIQOESOPHAGUS1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPPRRPTRPIQOESOPHAGUS1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPPSACQLPRIOESOPHAGUS1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPPSACQLPRIOESOPHAGUS1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPPSACQLPRIOESOPHAGUS1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPPSSTSASRGOESOPHAGUS1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35COLO680NN000Y
PDE4DIPPSSTSASRGOESOPHAGUS1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35OE21N000Y
PDE4DIPPSSTSASRGOESOPHAGUS1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35TE4N000Y
PDE4DIPPSWLAFLRHOESOPHAGUS1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPPSWLAFLRHOESOPHAGUS1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPPSWLAFLRHOESOPHAGUS1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPPTATPSACQOESOPHAGUS1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPPTATPSACQOESOPHAGUS1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPPTATPSACQOESOPHAGUS1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPPTRPIQAFIOESOPHAGUS1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPPTRPIQAFIOESOPHAGUS1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPPTRPIQAFIOESOPHAGUS1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPPWLRLSRSYOESOPHAGUS1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NN000N
PDE4DIPPWLRLSRSYOESOPHAGUS1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21N000N
PDE4DIPPWLRLSRSYOESOPHAGUS1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4N000N
PDE4DIPPYPSWLAFLOESOPHAGUS1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NY4100N
PDE4DIPPYPSWLAFLOESOPHAGUS1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21Y4100N
PDE4DIPPYPSWLAFLOESOPHAGUS1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4Y4100N
PDE4DIPQAFIFTPYPOESOPHAGUS1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NN000N
PDE4DIPQAFIFTPYPOESOPHAGUS1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21N000N
PDE4DIPQAFIFTPYPOESOPHAGUS1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4N000N
PDE4DIPQLHPASCLSOESOPHAGUS1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPQLHPASCLSOESOPHAGUS1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPQLHPASCLSOESOPHAGUS1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPQLPRIPPRROESOPHAGUS1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN500Y
PDE4DIPQLPRIPPRROESOPHAGUS1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N500Y
PDE4DIPQLPRIPPRROESOPHAGUS1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N500Y
PDE4DIPQWSPWLRLSOESOPHAGUS1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPQWSPWLRLSOESOPHAGUS1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPQWSPWLRLSOESOPHAGUS1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPRCCRSSWEKOESOPHAGUS1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NY4100N
PDE4DIPRCCRSSWEKOESOPHAGUS1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21Y4100N
PDE4DIPRCCRSSWEKOESOPHAGUS1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4Y4100N
PDE4DIPRGLRPNPTAOESOPHAGUS1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NN400N
PDE4DIPRGLRPNPTAOESOPHAGUS1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21N400N
PDE4DIPRGLRPNPTAOESOPHAGUS1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4N400N
PDE4DIPRHHCPQLHPOESOPHAGUS1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NN000N
PDE4DIPRHHCPQLHPOESOPHAGUS1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21N000N
PDE4DIPRHHCPQLHPOESOPHAGUS1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4N000N
PDE4DIPRHQWSPWLROESOPHAGUS1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN100Y
PDE4DIPRHQWSPWLROESOPHAGUS1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N100Y
PDE4DIPRHQWSPWLROESOPHAGUS1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N100Y
PDE4DIPRIPPRRPTROESOPHAGUS1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NY790N
PDE4DIPRIPPRRPTROESOPHAGUS1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21Y790N
PDE4DIPRIPPRRPTROESOPHAGUS1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4Y790N
PDE4DIPRLSRSYRCCOESOPHAGUS1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NY290N
PDE4DIPRLSRSYRCCOESOPHAGUS1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21Y290N
PDE4DIPRLSRSYRCCOESOPHAGUS1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4Y290N
PDE4DIPRPIQAFIFTOESOPHAGUS1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NN500N
PDE4DIPRPIQAFIFTOESOPHAGUS1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21N500N
PDE4DIPRPIQAFIFTOESOPHAGUS1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4N500N
PDE4DIPRPNPTATPSOESOPHAGUS1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN300N
PDE4DIPRPNPTATPSOESOPHAGUS1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N300N
PDE4DIPRPNPTATPSOESOPHAGUS1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N300N
PDE4DIPRPTRPIQAFOESOPHAGUS1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NY12100N
PDE4DIPRPTRPIQAFOESOPHAGUS1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21Y12100N
PDE4DIPRPTRPIQAFOESOPHAGUS1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4Y12100N
PDE4DIPRRPTRPIQAOESOPHAGUS1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN500N
PDE4DIPRRPTRPIQAOESOPHAGUS1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N500N
PDE4DIPRRPTRPIQAOESOPHAGUS1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N500N
PDE4DIPRSSWEKVPAOESOPHAGUS1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN200N
PDE4DIPRSSWEKVPAOESOPHAGUS1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N200N
PDE4DIPRSSWEKVPAOESOPHAGUS1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N200N
PDE4DIPRSYRCCRSSOESOPHAGUS1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN100N
PDE4DIPRSYRCCRSSOESOPHAGUS1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N100N
PDE4DIPRSYRCCRSSOESOPHAGUS1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N100N
PDE4DIPSACQLPRIPOESOPHAGUS1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPSACQLPRIPOESOPHAGUS1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPSACQLPRIPOESOPHAGUS1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPSAPLALSSLOESOPHAGUS1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NY15100N
PDE4DIPSAPLALSSLOESOPHAGUS1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21Y15100N
PDE4DIPSAPLALSSLOESOPHAGUS1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4Y15100N
PDE4DIPSASRGLRPNOESOPHAGUS1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN100Y
PDE4DIPSASRGLRPNOESOPHAGUS1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N100Y
PDE4DIPSASRGLRPNOESOPHAGUS1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N100Y
PDE4DIPSCLSAPLALOESOPHAGUS1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN1000N
PDE4DIPSCLSAPLALOESOPHAGUS1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N1000N
PDE4DIPSCLSAPLALOESOPHAGUS1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N1000N
PDE4DIPSLAAVRHQWOESOPHAGUS1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NN300N
PDE4DIPSLAAVRHQWOESOPHAGUS1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21N300N
PDE4DIPSLAAVRHQWOESOPHAGUS1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4N300N
PDE4DIPSPWLRLSRSOESOPHAGUS1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NN500Y
PDE4DIPSPWLRLSRSOESOPHAGUS1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21N500Y
PDE4DIPSPWLRLSRSOESOPHAGUS1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4N500Y
PDE4DIPSRGLRPNPTOESOPHAGUS1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN300Y
PDE4DIPSRGLRPNPTOESOPHAGUS1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N300Y
PDE4DIPSRGLRPNPTOESOPHAGUS1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N300Y
PDE4DIPSRSYRCCRSOESOPHAGUS1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN300N
PDE4DIPSRSYRCCRSOESOPHAGUS1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N300N
PDE4DIPSRSYRCCRSOESOPHAGUS1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N300N
PDE4DIPSSLAAVRHQOESOPHAGUS1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NN000Y
PDE4DIPSSLAAVRHQOESOPHAGUS1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21N000Y
PDE4DIPSSLAAVRHQOESOPHAGUS1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4N000Y
PDE4DIPSSTSASRGLOESOPHAGUS1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35COLO680NN700N
PDE4DIPSSTSASRGLOESOPHAGUS1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35OE21N700N
PDE4DIPSSTSASRGLOESOPHAGUS1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35TE4N700N
PDE4DIPSSWEKVPALOESOPHAGUS1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NY1990N
PDE4DIPSSWEKVPALOESOPHAGUS1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21Y1990N
PDE4DIPSSWEKVPALOESOPHAGUS1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4Y1990N
PDE4DIPSTSASRGLROESOPHAGUS1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35COLO680NN400N
PDE4DIPSTSASRGLROESOPHAGUS1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35OE21N400N
PDE4DIPSTSASRGLROESOPHAGUS1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35TE4N400N
PDE4DIPSWEKVPALFOESOPHAGUS1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN300N
PDE4DIPSWEKVPALFOESOPHAGUS1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N300N
PDE4DIPSWEKVPALFOESOPHAGUS1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N300N
PDE4DIPSWLAFLRHHOESOPHAGUS1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN000N
PDE4DIPSWLAFLRHHOESOPHAGUS1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N000N
PDE4DIPSWLAFLRHHOESOPHAGUS1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N000N
PDE4DIPSYRCCRSSWOESOPHAGUS1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NY2100N
PDE4DIPSYRCCRSSWOESOPHAGUS1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21Y2100N
PDE4DIPSYRCCRSSWOESOPHAGUS1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4Y2100N
PDE4DIPTATPSACQLOESOPHAGUS1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NN1100N
PDE4DIPTATPSACQLOESOPHAGUS1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21N1100N
PDE4DIPTATPSACQLOESOPHAGUS1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4N1100N
PDE4DIPTPSACQLPROESOPHAGUS1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN500N
PDE4DIPTPSACQLPROESOPHAGUS1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N500N
PDE4DIPTPSACQLPROESOPHAGUS1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N500N
PDE4DIPTPYPSWLAFOESOPHAGUS1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NY19100N
PDE4DIPTPYPSWLAFOESOPHAGUS1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21Y19100N
PDE4DIPTPYPSWLAFOESOPHAGUS1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4Y19100N
PDE4DIPTRPIQAFIFOESOPHAGUS1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN400N
PDE4DIPTRPIQAFIFOESOPHAGUS1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N400N
PDE4DIPTRPIQAFIFOESOPHAGUS1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N400N
PDE4DIPTSASRGLRPOESOPHAGUS1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NN000N
PDE4DIPTSASRGLRPOESOPHAGUS1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21N000N
PDE4DIPTSASRGLRPOESOPHAGUS1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4N000N
PDE4DIPVPALFLLLPOESOPHAGUS1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN200N
PDE4DIPVPALFLLLPOESOPHAGUS1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N200N
PDE4DIPVPALFLLLPOESOPHAGUS1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N200N
PDE4DIPVRHQWSPWLOESOPHAGUS1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NN905Y
PDE4DIPVRHQWSPWLOESOPHAGUS1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21N905Y
PDE4DIPVRHQWSPWLOESOPHAGUS1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4N905Y
PDE4DIPWEKVPALFLOESOPHAGUS1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NY12125N
PDE4DIPWEKVPALFLOESOPHAGUS1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21Y12125N
PDE4DIPWEKVPALFLOESOPHAGUS1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4Y12125N
PDE4DIPWLAFLRHHCOESOPHAGUS1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35COLO680NY41017N
PDE4DIPWLAFLRHHCOESOPHAGUS1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35OE21Y41017N
PDE4DIPWLAFLRHHCOESOPHAGUS1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35TE4Y41017N
PDE4DIPWLRLSRSYROESOPHAGUS1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NY71012N
PDE4DIPWLRLSRSYROESOPHAGUS1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21Y71012N
PDE4DIPWLRLSRSYROESOPHAGUS1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4Y71012N
PDE4DIPWSPWLRLSROESOPHAGUS1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35COLO680NN605Y
PDE4DIPWSPWLRLSROESOPHAGUS1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35OE21N605Y
PDE4DIPWSPWLRLSROESOPHAGUS1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35TE4N605Y
PDE4DIPYPSWLAFLROESOPHAGUS1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN702N
PDE4DIPYPSWLAFLROESOPHAGUS1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N702N
PDE4DIPYPSWLAFLROESOPHAGUS1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N702N
PDE4DIPYRCCRSSWEOESOPHAGUS1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35COLO680NN305N
PDE4DIPYRCCRSSWEOESOPHAGUS1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35OE21N305N
PDE4DIPYRCCRSSWEOESOPHAGUS1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35TE4N305N
PDGFRAAARVLVLLVOESOPHAGUS528p.A530Rc.1588_1589GC>AGMissense_Mutation10.11KYSE150N700N
PDGFRAAFVPLGKTDOESOPHAGUS127p.G133Ec.398G>AMissense_Mutation10.11KYSE510N000N
PDGFRAARVLVLLVIOESOPHAGUS529p.A530Rc.1588_1589GC>AGMissense_Mutation10.11KYSE150Y8100N
PDGFRADSGHYTILAOESOPHAGUS388p.V395Lc.1183G>TMissense_Mutation10.11TE4N100N
PDGFRADVAFVPLGKOESOPHAGUS125p.G133Ec.398G>AMissense_Mutation10.11KYSE510Y4130N
PDGFRAEDSGHYTILOESOPHAGUS387p.V395Lc.1183G>TMissense_Mutation10.11TE4N600N
PDGFRAELTVAARVLOESOPHAGUS524p.A530Rc.1588_1589GC>AGMissense_Mutation10.11KYSE150Y5110N
PDGFRAFVPLGKTDYOESOPHAGUS128p.G133Ec.398G>AMissense_Mutation10.11KYSE510N6018N
PDGFRAGHYTILAQNOESOPHAGUS390p.V395Lc.1183G>TMissense_Mutation10.11TE4N200N
PDGFRAGKTDYLVIVOESOPHAGUS132p.G133Ec.398G>AMissense_Mutation10.11KYSE510N300N
PDGFRAHYTILAQNEOESOPHAGUS391p.V395Lc.1183G>TMissense_Mutation10.11TE4N000N
PDGFRAILAQNEDAVOESOPHAGUS394p.V395Lc.1183G>TMissense_Mutation10.11TE4Y7120N
PDGFRAKTDYLVIVEOESOPHAGUS133p.G133Ec.398G>AMissense_Mutation10.11KYSE510N200N
PDGFRALAQNEDAVKOESOPHAGUS395p.V395Lc.1183G>TMissense_Mutation10.11TE4N100N
PDGFRALGKTDYLVIOESOPHAGUS131p.G133Ec.398G>AMissense_Mutation10.11KYSE510N1003N
PDGFRALTVAARVLVOESOPHAGUS525p.A530Rc.1588_1589GC>AGMissense_Mutation10.11KYSE150N500N
PDGFRAPLGKTDYLVOESOPHAGUS130p.G133Ec.398G>AMissense_Mutation10.11KYSE510N200N
PDGFRARSELTVAAROESOPHAGUS522p.A530Rc.1588_1589GC>AGMissense_Mutation10.11KYSE150Y4110N
PDGFRARVLVLLVIVOESOPHAGUS530p.A530Rc.1588_1589GC>AGMissense_Mutation10.11KYSE150Y10110N
PDGFRASELTVAARVOESOPHAGUS523p.A530Rc.1588_1589GC>AGMissense_Mutation10.11KYSE150Y9100N
PDGFRASGHYTILAQOESOPHAGUS389p.V395Lc.1183G>TMissense_Mutation10.11TE4N000N
PDGFRATILAQNEDAOESOPHAGUS393p.V395Lc.1183G>TMissense_Mutation10.11TE4N000N
PDGFRATVAARVLVLOESOPHAGUS526p.A530Rc.1588_1589GC>AGMissense_Mutation10.11KYSE150Y8110N
PDGFRAVAARVLVLLOESOPHAGUS527p.A530Rc.1588_1589GC>AGMissense_Mutation10.11KYSE150Y16100N
PDGFRAVAFVPLGKTOESOPHAGUS126p.G133Ec.398G>AMissense_Mutation10.11KYSE510N400N
PDGFRAVPLGKTDYLOESOPHAGUS129p.G133Ec.398G>AMissense_Mutation10.11KYSE510N2000N
PDGFRAYTILAQNEDOESOPHAGUS392p.V395Lc.1183G>TMissense_Mutation10.11TE4N202N
PIK3C2GCSWGSIGKHOESOPHAGUS124p.P129delc.384_386delCCCIn_Frame_Del447.23KYSE140N000N
PIK3C2GCSWGSIGKHOESOPHAGUS124p.P129delc.384_386delCCCIn_Frame_Del447.23KYSE410N000N
PIK3C2GCSWGSIGKHOESOPHAGUS124p.P129delc.384_386delCCCIn_Frame_Del447.23KYSE450N000N
PIK3C2GCSWGSIGKHOESOPHAGUS124p.P129delc.384_386delCCCIn_Frame_Del447.23OE21N000N
PIK3C2GCSWGSIGKHOESOPHAGUS124p.P129delc.384_386delCCCIn_Frame_Del447.23TE11N000N
PIK3C2GCSWGSIGKHOESOPHAGUS124p.P129delc.384_386delCCCIn_Frame_Del447.23TE8N000N
PIK3C2GECSWGSIGKOESOPHAGUS123p.P129delc.384_386delCCCIn_Frame_Del347.23KYSE140N100N
PIK3C2GECSWGSIGKOESOPHAGUS123p.P129delc.384_386delCCCIn_Frame_Del347.23KYSE410N100N
PIK3C2GECSWGSIGKOESOPHAGUS123p.P129delc.384_386delCCCIn_Frame_Del347.23KYSE450N100N
PIK3C2GECSWGSIGKOESOPHAGUS123p.P129delc.384_386delCCCIn_Frame_Del347.23OE21N100N
PIK3C2GECSWGSIGKOESOPHAGUS123p.P129delc.384_386delCCCIn_Frame_Del347.23TE11N100N
PIK3C2GECSWGSIGKOESOPHAGUS123p.P129delc.384_386delCCCIn_Frame_Del347.23TE8N100N
PIK3C2GGSIGKHHGAOESOPHAGUS127p.P129delc.384_386delCCCIn_Frame_Del247.23KYSE140N300N
PIK3C2GGSIGKHHGAOESOPHAGUS127p.P129delc.384_386delCCCIn_Frame_Del247.23KYSE410N300N
PIK3C2GGSIGKHHGAOESOPHAGUS127p.P129delc.384_386delCCCIn_Frame_Del247.23KYSE450N300N
PIK3C2GGSIGKHHGAOESOPHAGUS127p.P129delc.384_386delCCCIn_Frame_Del247.23OE21N300N
PIK3C2GGSIGKHHGAOESOPHAGUS127p.P129delc.384_386delCCCIn_Frame_Del247.23TE11N300N
PIK3C2GGSIGKHHGAOESOPHAGUS127p.P129delc.384_386delCCCIn_Frame_Del247.23TE8N300N
PIK3C2GKECSWGSIGOESOPHAGUS122p.P129delc.384_386delCCCIn_Frame_Del247.23KYSE140N000N
PIK3C2GKECSWGSIGOESOPHAGUS122p.P129delc.384_386delCCCIn_Frame_Del247.23KYSE410N000N
PIK3C2GKECSWGSIGOESOPHAGUS122p.P129delc.384_386delCCCIn_Frame_Del247.23KYSE450N000N
PIK3C2GKECSWGSIGOESOPHAGUS122p.P129delc.384_386delCCCIn_Frame_Del247.23OE21N000N
PIK3C2GKECSWGSIGOESOPHAGUS122p.P129delc.384_386delCCCIn_Frame_Del247.23TE11N000N
PIK3C2GKECSWGSIGOESOPHAGUS122p.P129delc.384_386delCCCIn_Frame_Del247.23TE8N000N
PIK3C2GNKECSWGSIOESOPHAGUS121p.P129delc.384_386delCCCIn_Frame_Del147.23KYSE140N100N
PIK3C2GNKECSWGSIOESOPHAGUS121p.P129delc.384_386delCCCIn_Frame_Del147.23KYSE410N100N
PIK3C2GNKECSWGSIOESOPHAGUS121p.P129delc.384_386delCCCIn_Frame_Del147.23KYSE450N100N
PIK3C2GNKECSWGSIOESOPHAGUS121p.P129delc.384_386delCCCIn_Frame_Del147.23OE21N100N
PIK3C2GNKECSWGSIOESOPHAGUS121p.P129delc.384_386delCCCIn_Frame_Del147.23TE11N100N
PIK3C2GNKECSWGSIOESOPHAGUS121p.P129delc.384_386delCCCIn_Frame_Del147.23TE8N100N
PIK3C2GSIGKHHGADOESOPHAGUS128p.P129delc.384_386delCCCIn_Frame_Del147.23KYSE140N000N
PIK3C2GSIGKHHGADOESOPHAGUS128p.P129delc.384_386delCCCIn_Frame_Del147.23KYSE410N000N
PIK3C2GSIGKHHGADOESOPHAGUS128p.P129delc.384_386delCCCIn_Frame_Del147.23KYSE450N000N
PIK3C2GSIGKHHGADOESOPHAGUS128p.P129delc.384_386delCCCIn_Frame_Del147.23OE21N000N
PIK3C2GSIGKHHGADOESOPHAGUS128p.P129delc.384_386delCCCIn_Frame_Del147.23TE11N000N
PIK3C2GSIGKHHGADOESOPHAGUS128p.P129delc.384_386delCCCIn_Frame_Del147.23TE8N000N
PIK3C2GSWGSIGKHHOESOPHAGUS125p.P129delc.384_386delCCCIn_Frame_Del447.23KYSE140N000N
PIK3C2GSWGSIGKHHOESOPHAGUS125p.P129delc.384_386delCCCIn_Frame_Del447.23KYSE410N000N
PIK3C2GSWGSIGKHHOESOPHAGUS125p.P129delc.384_386delCCCIn_Frame_Del447.23KYSE450N000N
PIK3C2GSWGSIGKHHOESOPHAGUS125p.P129delc.384_386delCCCIn_Frame_Del447.23OE21N000N
PIK3C2GSWGSIGKHHOESOPHAGUS125p.P129delc.384_386delCCCIn_Frame_Del447.23TE11N000N
PIK3C2GSWGSIGKHHOESOPHAGUS125p.P129delc.384_386delCCCIn_Frame_Del447.23TE8N000N
PIK3C2GWGSIGKHHGOESOPHAGUS126p.P129delc.384_386delCCCIn_Frame_Del347.23KYSE140N107Y
PIK3C2GWGSIGKHHGOESOPHAGUS126p.P129delc.384_386delCCCIn_Frame_Del347.23KYSE410N107Y
PIK3C2GWGSIGKHHGOESOPHAGUS126p.P129delc.384_386delCCCIn_Frame_Del347.23KYSE450N107Y
PIK3C2GWGSIGKHHGOESOPHAGUS126p.P129delc.384_386delCCCIn_Frame_Del347.23OE21N107Y
PIK3C2GWGSIGKHHGOESOPHAGUS126p.P129delc.384_386delCCCIn_Frame_Del347.23TE11N107Y
PIK3C2GWGSIGKHHGOESOPHAGUS126p.P129delc.384_386delCCCIn_Frame_Del347.23TE8N107Y
PIK3C2GCTDPTYNQIOESOPHAGUS1387p.I1394Lc.4180A>CMissense_Mutation10.22KYSE180Y3110N
PIK3C2GDPTYNQIVVOESOPHAGUS1389p.I1394Lc.4180A>CMissense_Mutation10.22KYSE180N1400N
PIK3C2GHSSSQVSLSOESOPHAGUS31p.G39Sc.115G>AMissense_Mutation10.22KYSE140N000N
PIK3C2GKCTDPTYNQOESOPHAGUS1386p.I1394Lc.4180A>CMissense_Mutation10.22KYSE180N000N
PIK3C2GLSFDQIVDEOESOPHAGUS38p.G39Sc.115G>AMissense_Mutation10.22KYSE140N002N
PIK3C2GNQIVVYDEVOESOPHAGUS1393p.I1394Lc.4180A>CMissense_Mutation10.22KYSE180Y7120N
PIK3C2GPTYNQIVVYOESOPHAGUS1390p.I1394Lc.4180A>CMissense_Mutation10.22KYSE180N200N
PIK3C2GQIVVYDEVTOESOPHAGUS1394p.I1394Lc.4180A>CMissense_Mutation10.22KYSE180N000N
PIK3C2GQVSLSFDQIOESOPHAGUS35p.G39Sc.115G>AMissense_Mutation10.22KYSE140N400N
PIK3C2GSFDQIVDEIOESOPHAGUS39p.G39Sc.115G>AMissense_Mutation10.22KYSE140Y8100N
PIK3C2GSLSFDQIVDOESOPHAGUS37p.G39Sc.115G>AMissense_Mutation10.22KYSE140N000N
PIK3C2GSQVSLSFDQOESOPHAGUS34p.G39Sc.115G>AMissense_Mutation10.22KYSE140N000N
PIK3C2GSSQVSLSFDOESOPHAGUS33p.G39Sc.115G>AMissense_Mutation10.22KYSE140N000N
PIK3C2GSSSQVSLSFOESOPHAGUS32p.G39Sc.115G>AMissense_Mutation10.22KYSE140N600N
PIK3C2GTDPTYNQIVOESOPHAGUS1388p.I1394Lc.4180A>CMissense_Mutation10.22KYSE180N600N
PIK3C2GTYNQIVVYDOESOPHAGUS1391p.I1394Lc.4180A>CMissense_Mutation10.22KYSE180N000N
PIK3C2GVSLSFDQIVOESOPHAGUS36p.G39Sc.115G>AMissense_Mutation10.22KYSE140N1000Y
PIK3C2GYNQIVVYDEOESOPHAGUS1392p.I1394Lc.4180A>CMissense_Mutation10.22KYSE180N207Y
PIK3CADPLSEITKQOESOPHAGUS538p.E545Kc.1633G>AMissense_Mutation11.88KYSE510N000N
PIK3CADPLSEITKQOESOPHAGUS538p.E545Kc.1633G>AMissense_Mutation11.88TE5N000N
PIK3CAEITKQEKDFOESOPHAGUS542p.E545Kc.1633G>AMissense_Mutation11.88KYSE510N200N
PIK3CAEITKQEKDFOESOPHAGUS542p.E545Kc.1633G>AMissense_Mutation11.88TE5N200N
PIK3CAITKQEKDFLOESOPHAGUS543p.E545Kc.1633G>AMissense_Mutation11.88KYSE510N700N
PIK3CAITKQEKDFLOESOPHAGUS543p.E545Kc.1633G>AMissense_Mutation11.88TE5N700N
PIK3CAKQEKDFLWSOESOPHAGUS545p.E545Kc.1633G>AMissense_Mutation11.88KYSE510N200N
PIK3CAKQEKDFLWSOESOPHAGUS545p.E545Kc.1633G>AMissense_Mutation11.88TE5N200N
PIK3CALSEITKQEKOESOPHAGUS540p.E545Kc.1633G>AMissense_Mutation11.88KYSE510N200N
PIK3CALSEITKQEKOESOPHAGUS540p.E545Kc.1633G>AMissense_Mutation11.88TE5N200N
PIK3CAPLSEITKQEOESOPHAGUS539p.E545Kc.1633G>AMissense_Mutation11.88KYSE510N000N
PIK3CAPLSEITKQEOESOPHAGUS539p.E545Kc.1633G>AMissense_Mutation11.88TE5N000N
PIK3CARDPLSEITKOESOPHAGUS537p.E545Kc.1633G>AMissense_Mutation11.88KYSE510N000N
PIK3CARDPLSEITKOESOPHAGUS537p.E545Kc.1633G>AMissense_Mutation11.88TE5N000N
PIK3CASEITKQEKDOESOPHAGUS541p.E545Kc.1633G>AMissense_Mutation11.88KYSE510N200N
PIK3CASEITKQEKDOESOPHAGUS541p.E545Kc.1633G>AMissense_Mutation11.88TE5N200N
PIK3CATKQEKDFLWOESOPHAGUS544p.E545Kc.1633G>AMissense_Mutation11.88KYSE510N200N
PIK3CATKQEKDFLWOESOPHAGUS544p.E545Kc.1633G>AMissense_Mutation11.88TE5N200N
PIK3CATIKQHALNWOESOPHAGUS1061p.*1069Wc.3207A>GNonstop_Mutation50.22KYSE70Y390N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48COLO680NN000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ECGI10N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE140N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE150N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE180N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE270N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE30N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE410N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE450N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE510N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE520N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE70N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OE19N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OE21N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OE33N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE10N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE11N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE14N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE1N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE4N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE5N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE6N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE8N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE9N000N
PRKDCAGHAMLAGPOESOPHAGUS1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN000N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48COLO680NN100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ECGI10N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE140N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE150N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE180N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE270N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE30N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE410N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE450N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE510N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE520N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE70N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OE19N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OE21N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OE33N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE10N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE11N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE14N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE1N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE4N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE5N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE6N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE8N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE9N100N
PRKDCAGPAPGRVGOESOPHAGUS1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTN100N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48COLO680NY290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ECGI10Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE140Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE150Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE180Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE270Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE30Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE410Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE450Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE510Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE520Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE70Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OE19Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OE21Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OE33Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE10Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE11Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE14Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE1Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE4Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE5Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE6Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE8Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE9Y290N
PRKDCAIQPAGHAMOESOPHAGUS1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TTY290N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48COLO680NN000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ECGI10N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE140N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE150N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE180N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE270N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE30N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE410N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE450N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE510N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE520N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYSE70N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OE19N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OE21N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OE33N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE10N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE11N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE14N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE1N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE4N000N
PRKDCAMLAGPAPGOESOPHAGUS1254p.L1244fsc.3730_3731in