Cancertope

In silico Platform for designing genome-based
Personalized immunotherapy or Vaccine against Cancer

Browse Results ...


The result page of search shows exclusive peptide/epitopes generated due to mutation [Neoepitope], the tissue of origin [Tissue], position of peptide in protein [Position], number of mismatches counted by aligning mutated and normal protein sequence [Num Mismatch, percentage of cell lines with this peptide over total number of cell lines [Promiscuity %]. The immune information include CTL epitopes (Yes/No), MHC I binders, MHC II binders (both given as number of alleles) and B cell epitopes (Yes/No). For more information, please click HERE


Result Reset Search:
ProteinNeoepitopesTissuePositionProt MutationcDNA MutationMutation TypeNum MismatchPromiscuity (%)Cell LineCTLMHC INHLApredMHC IIBcell
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86ALEXANDERCELLSN000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HUH6N000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HUH7N000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHH1N000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHH2N000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHH4N000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHH6N000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86LI7N000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NCIH684N000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKHEP1N000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU182N000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU387N000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU398N000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU423N000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU475N000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU761N000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU878N000N
AKAP12AIEEDLEPELIVER1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU886N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86ALEXANDERCELLSN000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HUH6N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HUH7N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHH1N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHH2N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHH4N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHH6N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86LI7N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NCIH684N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKHEP1N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU182N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU387N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU398N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU423N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU475N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU761N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU878N000N
AKAP12EEDLEPENGLIVER1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU886N000N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86ALEXANDERCELLSN200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HUH6N200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HUH7N200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHH1N200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHH2N200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHH4N200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHH6N200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86LI7N200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NCIH684N200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKHEP1N200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU182N200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU387N200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU398N200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU423N200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU475N200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU761N200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU878N200N
AKAP12IEEDLEPENLIVER1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU886N200N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86ALEXANDERCELLSN000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HUH6N000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HUH7N000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHH1N000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHH2N000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHH4N000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JHH6N000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86LI7N000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NCIH684N000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKHEP1N000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU182N000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU387N000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU398N000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU423N000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU475N000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU761N000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU878N000N
AKAP12KVSVAIEEDLIVER1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU886N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86ALEXANDERCELLSN000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HUH6N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HUH7N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHH1N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHH2N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHH4N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHH6N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86LI7N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NCIH684N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKHEP1N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU182N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU387N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU398N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU423N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU475N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU761N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU878N000N
AKAP12SVAIEEDLELIVER1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU886N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86ALEXANDERCELLSN000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HUH6N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HUH7N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHH1N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHH2N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHH4N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JHH6N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86LI7N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NCIH684N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKHEP1N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU182N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU387N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU398N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU423N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU475N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU761N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU878N000N
AKAP12VAIEEDLEPLIVER1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU886N000N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86ALEXANDERCELLSN002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HUH6N002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HUH7N002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHH1N002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHH2N002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHH4N002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JHH6N002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86LI7N002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NCIH684N002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKHEP1N002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU182N002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU387N002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU398N002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU423N002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU475N002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU761N002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU878N002N
AKAP12VKVSVAIEELIVER1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU886N002N
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86ALEXANDERCELLSN1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HUH6N1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HUH7N1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHH1N1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHH2N1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHH4N1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JHH6N1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86LI7N1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NCIH684N1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKHEP1N1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU182N1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU387N1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU398N1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU423N1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU475N1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU761N1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU878N1500Y
AKAP12VSVAIEEDLLIVER1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU886N1500Y
AKAP12CVSREDPTQLIVER470p.G473Rc.1417G>AMissense_Mutation10.11SNU449N000Y
AKAP12ETCVSREDPLIVER468p.G473Rc.1417G>AMissense_Mutation10.11SNU449N000N
AKAP12KETCVSREDLIVER467p.G473Rc.1417G>AMissense_Mutation10.11SNU449N000N
AKAP12KLKETCVSRLIVER465p.G473Rc.1417G>AMissense_Mutation10.11SNU449Y7100N
AKAP12LKETCVSRELIVER466p.G473Rc.1417G>AMissense_Mutation10.11SNU449N000N
AKAP12REDPTQGADLIVER473p.G473Rc.1417G>AMissense_Mutation10.11SNU449N000N
AKAP12SREDPTQGALIVER472p.G473Rc.1417G>AMissense_Mutation10.11SNU449N200N
AKAP12TCVSREDPTLIVER469p.G473Rc.1417G>AMissense_Mutation10.11SNU449N100N
AKAP12VSREDPTQGLIVER471p.G473Rc.1417G>AMissense_Mutation10.11SNU449N000N
AKAP9DLEKTKQLELIVER1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HEPG2N000N
AKAP9DLEKTKQLELIVER1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27JHH2N000N
AKAP9DLEKTKQLELIVER1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27JHH7N000N
AKAP9DLEKTKQLELIVER1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27NCIH684N000N
AKAP9DLEKTKQLELIVER1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKHEP1N000N
AKAP9DLEKTKQLELIVER1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU182N000N
AKAP9EKTKQLEEQLIVER1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HEPG2N000N
AKAP9EKTKQLEEQLIVER1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27JHH2N000N
AKAP9EKTKQLEEQLIVER1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27JHH7N000N
AKAP9EKTKQLEEQLIVER1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27NCIH684N000N
AKAP9EKTKQLEEQLIVER1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKHEP1N000N
AKAP9EKTKQLEEQLIVER1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU182N000N
AKAP9KQLEEQVQELIVER1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HEPG2N000N
AKAP9KQLEEQVQELIVER1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27JHH2N000N
AKAP9KQLEEQVQELIVER1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27JHH7N000N
AKAP9KQLEEQVQELIVER1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27NCIH684N000N
AKAP9KQLEEQVQELIVER1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKHEP1N000N
AKAP9KQLEEQVQELIVER1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU182N000N
AKAP9KTKQLEEQVLIVER1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HEPG2N200N
AKAP9KTKQLEEQVLIVER1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27JHH2N200N
AKAP9KTKQLEEQVLIVER1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27JHH7N200N
AKAP9KTKQLEEQVLIVER1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27NCIH684N200N
AKAP9KTKQLEEQVLIVER1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SKHEP1N200N
AKAP9KTKQLEEQVLIVER1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SNU182N200N
AKAP9LEKTKQLEELIVER1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HEPG2N000N
AKAP9LEKTKQLEELIVER1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27JHH2N000N
AKAP9LEKTKQLEELIVER1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27JHH7N000N
AKAP9LEKTKQLEELIVER1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27NCIH684N000N
AKAP9LEKTKQLEELIVER1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKHEP1N000N
AKAP9LEKTKQLEELIVER1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU182N000N
AKAP9LQDLEKTKQLIVER1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HEPG2N000N
AKAP9LQDLEKTKQLIVER1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27JHH2N000N
AKAP9LQDLEKTKQLIVER1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27JHH7N000N
AKAP9LQDLEKTKQLIVER1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27NCIH684N000N
AKAP9LQDLEKTKQLIVER1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SKHEP1N000N
AKAP9LQDLEKTKQLIVER1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SNU182N000N
AKAP9QDLEKTKQLLIVER1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HEPG2N900N
AKAP9QDLEKTKQLLIVER1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27JHH2N900N
AKAP9QDLEKTKQLLIVER1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27JHH7N900N
AKAP9QDLEKTKQLLIVER1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27NCIH684N900N
AKAP9QDLEKTKQLLIVER1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKHEP1N900N
AKAP9QDLEKTKQLLIVER1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU182N900N
AKAP9QLEEQVQELLIVER1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HEPG2N1200N
AKAP9QLEEQVQELLIVER1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27JHH2N1200N
AKAP9QLEEQVQELLIVER1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27JHH7N1200N
AKAP9QLEEQVQELLIVER1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27NCIH684N1200N
AKAP9QLEEQVQELLIVER1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SKHEP1N1200N
AKAP9QLEEQVQELLIVER1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SNU182N1200N
AKAP9TKQLEEQVQLIVER1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HEPG2N000N
AKAP9TKQLEEQVQLIVER1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27JHH2N000N
AKAP9TKQLEEQVQLIVER1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27JHH7N000N
AKAP9TKQLEEQVQLIVER1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27NCIH684N000N
AKAP9TKQLEEQVQLIVER1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKHEP1N000N
AKAP9TKQLEEQVQLIVER1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU182N000N
ALPK2ATRETVTIALIVER1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HLFY1140N
ALPK2ATRETVTIALIVER1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74JHH6Y1140N
ALPK2ATRETVTIALIVER1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74JHH7Y1140N
ALPK2ATRETVTIALIVER1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74NCIH684Y1140N
ALPK2ATRETVTIALIVER1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SNU182Y1140N
ALPK2ATRETVTIALIVER1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SNU387Y1140N
ALPK2ATRETVTIALIVER1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SNU423Y1140N
ALPK2ATRETVTIALIVER1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SNU475Y1140N
ALPK2CFQATRETVLIVER998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HLFY2110N
ALPK2CFQATRETVLIVER998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74JHH6Y2110N
ALPK2CFQATRETVLIVER998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74JHH7Y2110N
ALPK2CFQATRETVLIVER998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74NCIH684Y2110N
ALPK2CFQATRETVLIVER998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SNU182Y2110N
ALPK2CFQATRETVLIVER998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SNU387Y2110N
ALPK2CFQATRETVLIVER998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SNU423Y2110N
ALPK2CFQATRETVLIVER998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SNU475Y2110N
ALPK2ETVTIATEVLIVER1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HLFN400N
ALPK2ETVTIATEVLIVER1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74JHH6N400N
ALPK2ETVTIATEVLIVER1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74JHH7N400N
ALPK2ETVTIATEVLIVER1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74NCIH684N400N
ALPK2ETVTIATEVLIVER1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SNU182N400N
ALPK2ETVTIATEVLIVER1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SNU387N400N
ALPK2ETVTIATEVLIVER1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SNU423N400N
ALPK2ETVTIATEVLIVER1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SNU475N400N
ALPK2FQATRETVTLIVER999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HLFN600N
ALPK2FQATRETVTLIVER999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74JHH6N600N
ALPK2FQATRETVTLIVER999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74JHH7N600N
ALPK2FQATRETVTLIVER999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74NCIH684N600N
ALPK2FQATRETVTLIVER999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SNU182N600N
ALPK2FQATRETVTLIVER999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SNU387N600N
ALPK2FQATRETVTLIVER999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SNU423N600N
ALPK2FQATRETVTLIVER999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SNU475N600N
ALPK2QATRETVTILIVER1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HLFN600N
ALPK2QATRETVTILIVER1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74JHH6N600N
ALPK2QATRETVTILIVER1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74JHH7N600N
ALPK2QATRETVTILIVER1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74NCIH684N600N
ALPK2QATRETVTILIVER1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SNU182N600N
ALPK2QATRETVTILIVER1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SNU387N600N
ALPK2QATRETVTILIVER1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SNU423N600N
ALPK2QATRETVTILIVER1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SNU475N600N
ALPK2RETVTIATELIVER1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HLFN100N
ALPK2RETVTIATELIVER1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74JHH6N100N
ALPK2RETVTIATELIVER1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74JHH7N100N
ALPK2RETVTIATELIVER1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74NCIH684N100N
ALPK2RETVTIATELIVER1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SNU182N100N
ALPK2RETVTIATELIVER1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SNU387N100N
ALPK2RETVTIATELIVER1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SNU423N100N
ALPK2RETVTIATELIVER1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SNU475N100N
ALPK2TRETVTIATLIVER1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HLFN200N
ALPK2TRETVTIATLIVER1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74JHH6N200N
ALPK2TRETVTIATLIVER1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74JHH7N200N
ALPK2TRETVTIATLIVER1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74NCIH684N200N
ALPK2TRETVTIATLIVER1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SNU182N200N
ALPK2TRETVTIATLIVER1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SNU387N200N
ALPK2TRETVTIATLIVER1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SNU423N200N
ALPK2TRETVTIATLIVER1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SNU475N200N
ALPK2AGEEDSQGLLIVER1200p.A1207Gc.3620C>GMissense_Mutation10.11JHH7N900N
ALPK2DSQGLSNVPLIVER1204p.A1207Gc.3620C>GMissense_Mutation10.11JHH7N000N
ALPK2EDSQGLSNVLIVER1203p.A1207Gc.3620C>GMissense_Mutation10.11JHH7N300N
ALPK2EEDSQGLSNLIVER1202p.A1207Gc.3620C>GMissense_Mutation10.11JHH7N200N
ALPK2GEEDSQGLSLIVER1201p.A1207Gc.3620C>GMissense_Mutation10.11JHH7N400N
ALPK2GLSNVPSLSLIVER1207p.A1207Gc.3620C>GMissense_Mutation10.11JHH7N000N
ALPK2QGLSNVPSLLIVER1206p.A1207Gc.3620C>GMissense_Mutation10.11JHH7N1500N
ALPK2SQGLSNVPSLIVER1205p.A1207Gc.3620C>GMissense_Mutation10.11JHH7N000N
ALPK2TAGEEDSQGLIVER1199p.A1207Gc.3620C>GMissense_Mutation10.11JHH7N000N
ALPK2ASPKDEGLYLIVER1848p.Q1853Ec.5557C>GMissense_Mutation10.22LI7N400N
ALPK2DEGLYYCCILIVER1852p.Q1853Ec.5557C>GMissense_Mutation10.22LI7N700N
ALPK2EGLYYCCIKLIVER1853p.Q1853Ec.5557C>GMissense_Mutation10.22LI7N000N
ALPK2IVQASPKDELIVER1845p.Q1853Ec.5557C>GMissense_Mutation10.22LI7N004N
ALPK2KDEGLYYCCLIVER1851p.Q1853Ec.5557C>GMissense_Mutation10.22LI7N100N
ALPK2PKDEGLYYCLIVER1850p.Q1853Ec.5557C>GMissense_Mutation10.22LI7N000N
ALPK2QASPKDEGLLIVER1847p.Q1853Ec.5557C>GMissense_Mutation10.22LI7N1100N
ALPK2SPKDEGLYYLIVER1849p.Q1853Ec.5557C>GMissense_Mutation10.22LI7N1000N
ALPK2VQASPKDEGLIVER1846p.Q1853Ec.5557C>GMissense_Mutation10.22LI7N001N
ATMAATKGCCSQLIVER193p.V194Ac.581T>CMissense_Mutation10.11LI7N000N
ATMARIIHAATKLIVER188p.V194Ac.581T>CMissense_Mutation10.11LI7N200N
ATMATKGCCSQTLIVER194p.V194Ac.581T>CMissense_Mutation10.11LI7N100N
ATMDQSSMNVFNLIVER851p.L857Vc.2569C>GMissense_Mutation10.11JHH5N000N
ATMEDQSSMNVFLIVER850p.L857Vc.2569C>GMissense_Mutation10.11JHH5N400N
ATMEEYRLPMEDLIVER957p.P960Rc.2879C>GMissense_Mutation10.11JHH2N000N
ATMELPGEEYRLLIVER953p.P960Rc.2879C>GMissense_Mutation10.11JHH2Y7150N
ATMEYRLPMEDVLIVER958p.P960Rc.2879C>GMissense_Mutation10.11JHH2Y3100N
ATMGEEYRLPMELIVER956p.P960Rc.2879C>GMissense_Mutation10.11JHH2N000N
ATMHAATKGCCSLIVER192p.V194Ac.581T>CMissense_Mutation10.11LI7N100N
ATMIHAATKGCCLIVER191p.V194Ac.581T>CMissense_Mutation10.11LI7N103N
ATMIIHAATKGCLIVER190p.V194Ac.581T>CMissense_Mutation10.11LI7N008N
ATMKELPGEEYRLIVER952p.P960Rc.2879C>GMissense_Mutation10.11JHH2Y490N
ATMLPGEEYRLPLIVER954p.P960Rc.2879C>GMissense_Mutation10.11JHH2N100N
ATMLVARIIHAALIVER186p.V194Ac.581T>CMissense_Mutation10.11LI7N3018N
ATMMNVFNDYPDLIVER855p.L857Vc.2569C>GMissense_Mutation10.11JHH5N200N
ATMNVFNDYPDSLIVER856p.L857Vc.2569C>GMissense_Mutation10.11JHH5N100N
ATMPGEEYRLPMLIVER955p.P960Rc.2879C>GMissense_Mutation10.11JHH2N100N
ATMQSSMNVFNDLIVER852p.L857Vc.2569C>GMissense_Mutation10.11JHH5N200N
ATMRIIHAATKGLIVER189p.V194Ac.581T>CMissense_Mutation10.11LI7N000N
ATMRLPMEDVLELIVER960p.P960Rc.2879C>GMissense_Mutation10.11JHH2N000N
ATMSMNVFNDYPLIVER854p.L857Vc.2569C>GMissense_Mutation10.11JHH5N000N
ATMSSMNVFNDYLIVER853p.L857Vc.2569C>GMissense_Mutation10.11JHH5N700N
ATMVARIIHAATLIVER187p.V194Ac.581T>CMissense_Mutation10.11LI7N400N
ATMVEDQSSMNVLIVER849p.L857Vc.2569C>GMissense_Mutation10.11JHH5Y8110N
ATMVFNDYPDSSLIVER857p.L857Vc.2569C>GMissense_Mutation10.11JHH5N0011N
ATMYRLPMEDVLLIVER959p.P960Rc.2879C>GMissense_Mutation10.11JHH2N1100N
ATMETIPFRLTRLIVER2904p.V2906Ic.8716G>AMissense_Mutation10.22C3AY7100N
ATMETIPFRLTRLIVER2904p.V2906Ic.8716G>AMissense_Mutation10.22HEPG2Y7100N
ATMILPTPETIPLIVER2899p.V2906Ic.8716G>AMissense_Mutation10.22C3AN100N
ATMILPTPETIPLIVER2899p.V2906Ic.8716G>AMissense_Mutation10.22HEPG2N100N
ATMIPFRLTRDILIVER2906p.V2906Ic.8716G>AMissense_Mutation10.22C3AN14012N
ATMIPFRLTRDILIVER2906p.V2906Ic.8716G>AMissense_Mutation10.22HEPG2N14012N
ATMKILPTPETILIVER2898p.V2906Ic.8716G>AMissense_Mutation10.22C3AY7100N
ATMKILPTPETILIVER2898p.V2906Ic.8716G>AMissense_Mutation10.22HEPG2Y7100N
ATMLPTPETIPFLIVER2900p.V2906Ic.8716G>AMissense_Mutation10.22C3AN1200N
ATMLPTPETIPFLIVER2900p.V2906Ic.8716G>AMissense_Mutation10.22HEPG2N1200N
ATMPETIPFRLTLIVER2903p.V2906Ic.8716G>AMissense_Mutation10.22C3AN000N
ATMPETIPFRLTLIVER2903p.V2906Ic.8716G>AMissense_Mutation10.22HEPG2N000N
ATMPTPETIPFRLIVER2901p.V2906Ic.8716G>AMissense_Mutation10.22C3AN100N
ATMPTPETIPFRLIVER2901p.V2906Ic.8716G>AMissense_Mutation10.22HEPG2N100N
ATMTIPFRLTRDLIVER2905p.V2906Ic.8716G>AMissense_Mutation10.22C3AN000N
ATMTIPFRLTRDLIVER2905p.V2906Ic.8716G>AMissense_Mutation10.22HEPG2N000N
ATMTPETIPFRLLIVER2902p.V2906Ic.8716G>AMissense_Mutation10.22C3AY19100N
ATMTPETIPFRLLIVER2902p.V2906Ic.8716G>AMissense_Mutation10.22HEPG2Y19100N
BRAFATEKSRWSGLIVER598p.V600Ec.1799T>AMissense_Mutation16.08SKHEP1N000N
BRAFDFGLATEKSLIVER594p.V600Ec.1799T>AMissense_Mutation16.08SKHEP1N000N
BRAFEKSRWSGSHLIVER600p.V600Ec.1799T>AMissense_Mutation16.08SKHEP1N100N
BRAFFGLATEKSRLIVER595p.V600Ec.1799T>AMissense_Mutation16.08SKHEP1N302N
BRAFGDFGLATEKLIVER593p.V600Ec.1799T>AMissense_Mutation16.08SKHEP1N100N
BRAFGLATEKSRWLIVER596p.V600Ec.1799T>AMissense_Mutation16.08SKHEP1N400N
BRAFIGDFGLATELIVER592p.V600Ec.1799T>AMissense_Mutation16.08SKHEP1N000N
BRAFLATEKSRWSLIVER597p.V600Ec.1799T>AMissense_Mutation16.08SKHEP1N200N
BRAFTEKSRWSGSLIVER599p.V600Ec.1799T>AMissense_Mutation16.08SKHEP1N300N
CHD1DQRSYGSRSLIVER1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HUH6N100N
CHD1DQRSYGSRSLIVER1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86JHH6N100N
CHD1DQRSYGSRSLIVER1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SNU886N100N
CHD1LDQRSYGSRLIVER1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HUH6N000N
CHD1LDQRSYGSRLIVER1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86JHH6N000N
CHD1LDQRSYGSRLIVER1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SNU886N000N
CHD1PLDQRSYGSLIVER1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HUH6N000N
CHD1PLDQRSYGSLIVER1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86JHH6N000N
CHD1PLDQRSYGSLIVER1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SNU886N000N
CHD1QRSYGSRSPLIVER1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HUH6N000N
CHD1QRSYGSRSPLIVER1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86JHH6N000N
CHD1QRSYGSRSPLIVER1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SNU886N000N
CHD1RSPLDQRSYLIVER1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HUH6N600N
CHD1RSPLDQRSYLIVER1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86JHH6N600N
CHD1RSPLDQRSYLIVER1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SNU886N600N
CHD1RSYGSRSPFLIVER1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HUH6N900N
CHD1RSYGSRSPFLIVER1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86JHH6N900N
CHD1RSYGSRSPFLIVER1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SNU886N900N
CHD1SPLDQRSYGLIVER1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HUH6N000N
CHD1SPLDQRSYGLIVER1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86JHH6N000N
CHD1SPLDQRSYGLIVER1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SNU886N000N
CHD1SYGSRSPFELIVER1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HUH6N000N
CHD1SYGSRSPFELIVER1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86JHH6N000N
CHD1SYGSRSPFELIVER1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SNU886N000N
CHD1DDSSMDSYSLIVER1537p.R1541Mc.4622G>TMissense_Mutation10.11ALEXANDERCELLSN300N
CHD1DSSMDSYSSLIVER1538p.R1541Mc.4622G>TMissense_Mutation10.11ALEXANDERCELLSN100N
CHD1HDDSSMDSYLIVER1536p.R1541Mc.4622G>TMissense_Mutation10.11ALEXANDERCELLSN500N
CHD1MDSYSSDRHLIVER1541p.R1541Mc.4622G>TMissense_Mutation10.11ALEXANDERCELLSN000Y
CHD1NHDDSSMDSLIVER1535p.R1541Mc.4622G>TMissense_Mutation10.11ALEXANDERCELLSN200N
CHD1NTNHDDSSMLIVER1533p.R1541Mc.4622G>TMissense_Mutation10.11ALEXANDERCELLSN200N
CHD1SMDSYSSDRLIVER1540p.R1541Mc.4622G>TMissense_Mutation10.11ALEXANDERCELLSN800Y
CHD1SSMDSYSSDLIVER1539p.R1541Mc.4622G>TMissense_Mutation10.11ALEXANDERCELLSN100Y
CHD1TNHDDSSMDLIVER1534p.R1541Mc.4622G>TMissense_Mutation10.11ALEXANDERCELLSN000N
CREB3L2FTHITSDSFLIVER95p.T100delc.299_301delCCAIn_Frame_Del444.47JHH2N801N
CREB3L2FTHITSDSFLIVER95p.T100delc.299_301delCCAIn_Frame_Del444.47JHH4N801N
CREB3L2FTHITSDSFLIVER95p.T100delc.299_301delCCAIn_Frame_Del444.47JHH6N801N
CREB3L2FTHITSDSFLIVER95p.T100delc.299_301delCCAIn_Frame_Del444.47JHH7N801N
CREB3L2FTHITSDSFLIVER95p.T100delc.299_301delCCAIn_Frame_Del444.47NCIH684N801N
CREB3L2FTHITSDSFLIVER95p.T100delc.299_301delCCAIn_Frame_Del444.47SNU182N801N
CREB3L2FTHITSDSFLIVER95p.T100delc.299_301delCCAIn_Frame_Del444.47SNU398N801N
CREB3L2FTHITSDSFLIVER95p.T100delc.299_301delCCAIn_Frame_Del444.47SNU423N801N
CREB3L2FTHITSDSFLIVER95p.T100delc.299_301delCCAIn_Frame_Del444.47SNU449N801N
CREB3L2FTHITSDSFLIVER95p.T100delc.299_301delCCAIn_Frame_Del444.47SNU475N801N
CREB3L2HITSDSFNDLIVER97p.T100delc.299_301delCCAIn_Frame_Del244.47JHH2N000N
CREB3L2HITSDSFNDLIVER97p.T100delc.299_301delCCAIn_Frame_Del244.47JHH4N000N
CREB3L2HITSDSFNDLIVER97p.T100delc.299_301delCCAIn_Frame_Del244.47JHH6N000N
CREB3L2HITSDSFNDLIVER97p.T100delc.299_301delCCAIn_Frame_Del244.47JHH7N000N
CREB3L2HITSDSFNDLIVER97p.T100delc.299_301delCCAIn_Frame_Del244.47NCIH684N000N
CREB3L2HITSDSFNDLIVER97p.T100delc.299_301delCCAIn_Frame_Del244.47SNU182N000N
CREB3L2HITSDSFNDLIVER97p.T100delc.299_301delCCAIn_Frame_Del244.47SNU398N000N
CREB3L2HITSDSFNDLIVER97p.T100delc.299_301delCCAIn_Frame_Del244.47SNU423N000N
CREB3L2HITSDSFNDLIVER97p.T100delc.299_301delCCAIn_Frame_Del244.47SNU449N000N
CREB3L2HITSDSFNDLIVER97p.T100delc.299_301delCCAIn_Frame_Del244.47SNU475N000N
CREB3L2ITSDSFNDDLIVER98p.T100delc.299_301delCCAIn_Frame_Del144.47JHH2N000N
CREB3L2ITSDSFNDDLIVER98p.T100delc.299_301delCCAIn_Frame_Del144.47JHH4N000N
CREB3L2ITSDSFNDDLIVER98p.T100delc.299_301delCCAIn_Frame_Del144.47JHH6N000N
CREB3L2ITSDSFNDDLIVER98p.T100delc.299_301delCCAIn_Frame_Del144.47JHH7N000N
CREB3L2ITSDSFNDDLIVER98p.T100delc.299_301delCCAIn_Frame_Del144.47NCIH684N000N
CREB3L2ITSDSFNDDLIVER98p.T100delc.299_301delCCAIn_Frame_Del144.47SNU182N000N
CREB3L2ITSDSFNDDLIVER98p.T100delc.299_301delCCAIn_Frame_Del144.47SNU398N000N
CREB3L2ITSDSFNDDLIVER98p.T100delc.299_301delCCAIn_Frame_Del144.47SNU423N000N
CREB3L2ITSDSFNDDLIVER98p.T100delc.299_301delCCAIn_Frame_Del144.47SNU449N000N
CREB3L2ITSDSFNDDLIVER98p.T100delc.299_301delCCAIn_Frame_Del144.47SNU475N000N
CREB3L2PFTHITSDSLIVER94p.T100delc.299_301delCCAIn_Frame_Del344.47JHH2N000N
CREB3L2PFTHITSDSLIVER94p.T100delc.299_301delCCAIn_Frame_Del344.47JHH4N000N
CREB3L2PFTHITSDSLIVER94p.T100delc.299_301delCCAIn_Frame_Del344.47JHH6N000N
CREB3L2PFTHITSDSLIVER94p.T100delc.299_301delCCAIn_Frame_Del344.47JHH7N000N
CREB3L2PFTHITSDSLIVER94p.T100delc.299_301delCCAIn_Frame_Del344.47NCIH684N000N
CREB3L2PFTHITSDSLIVER94p.T100delc.299_301delCCAIn_Frame_Del344.47SNU182N000N
CREB3L2PFTHITSDSLIVER94p.T100delc.299_301delCCAIn_Frame_Del344.47SNU398N000N
CREB3L2PFTHITSDSLIVER94p.T100delc.299_301delCCAIn_Frame_Del344.47SNU423N000N
CREB3L2PFTHITSDSLIVER94p.T100delc.299_301delCCAIn_Frame_Del344.47SNU449N000N
CREB3L2PFTHITSDSLIVER94p.T100delc.299_301delCCAIn_Frame_Del344.47SNU475N000N
CREB3L2QSPFTHITSLIVER92p.T100delc.299_301delCCAIn_Frame_Del144.47JHH2N000N
CREB3L2QSPFTHITSLIVER92p.T100delc.299_301delCCAIn_Frame_Del144.47JHH4N000N
CREB3L2QSPFTHITSLIVER92p.T100delc.299_301delCCAIn_Frame_Del144.47JHH6N000N
CREB3L2QSPFTHITSLIVER92p.T100delc.299_301delCCAIn_Frame_Del144.47JHH7N000N
CREB3L2QSPFTHITSLIVER92p.T100delc.299_301delCCAIn_Frame_Del144.47NCIH684N000N
CREB3L2QSPFTHITSLIVER92p.T100delc.299_301delCCAIn_Frame_Del144.47SNU182N000N
CREB3L2QSPFTHITSLIVER92p.T100delc.299_301delCCAIn_Frame_Del144.47SNU398N000N
CREB3L2QSPFTHITSLIVER92p.T100delc.299_301delCCAIn_Frame_Del144.47SNU423N000N
CREB3L2QSPFTHITSLIVER92p.T100delc.299_301delCCAIn_Frame_Del144.47SNU449N000N
CREB3L2QSPFTHITSLIVER92p.T100delc.299_301delCCAIn_Frame_Del144.47SNU475N000N
CREB3L2SPFTHITSDLIVER93p.T100delc.299_301delCCAIn_Frame_Del244.47JHH2N100N
CREB3L2SPFTHITSDLIVER93p.T100delc.299_301delCCAIn_Frame_Del244.47JHH4N100N
CREB3L2SPFTHITSDLIVER93p.T100delc.299_301delCCAIn_Frame_Del244.47JHH6N100N
CREB3L2SPFTHITSDLIVER93p.T100delc.299_301delCCAIn_Frame_Del244.47JHH7N100N
CREB3L2SPFTHITSDLIVER93p.T100delc.299_301delCCAIn_Frame_Del244.47NCIH684N100N
CREB3L2SPFTHITSDLIVER93p.T100delc.299_301delCCAIn_Frame_Del244.47SNU182N100N
CREB3L2SPFTHITSDLIVER93p.T100delc.299_301delCCAIn_Frame_Del244.47SNU398N100N
CREB3L2SPFTHITSDLIVER93p.T100delc.299_301delCCAIn_Frame_Del244.47SNU423N100N
CREB3L2SPFTHITSDLIVER93p.T100delc.299_301delCCAIn_Frame_Del244.47SNU449N100N
CREB3L2SPFTHITSDLIVER93p.T100delc.299_301delCCAIn_Frame_Del244.47SNU475N100N
CREB3L2THITSDSFNLIVER96p.T100delc.299_301delCCAIn_Frame_Del344.47JHH2N100N
CREB3L2THITSDSFNLIVER96p.T100delc.299_301delCCAIn_Frame_Del344.47JHH4N100N
CREB3L2THITSDSFNLIVER96p.T100delc.299_301delCCAIn_Frame_Del344.47JHH6N100N
CREB3L2THITSDSFNLIVER96p.T100delc.299_301delCCAIn_Frame_Del344.47JHH7N100N
CREB3L2THITSDSFNLIVER96p.T100delc.299_301delCCAIn_Frame_Del344.47NCIH684N100N
CREB3L2THITSDSFNLIVER96p.T100delc.299_301delCCAIn_Frame_Del344.47SNU182N100N
CREB3L2THITSDSFNLIVER96p.T100delc.299_301delCCAIn_Frame_Del344.47SNU398N100N
CREB3L2THITSDSFNLIVER96p.T100delc.299_301delCCAIn_Frame_Del344.47SNU423N100N
CREB3L2THITSDSFNLIVER96p.T100delc.299_301delCCAIn_Frame_Del344.47SNU449N100N
CREB3L2THITSDSFNLIVER96p.T100delc.299_301delCCAIn_Frame_Del344.47SNU475N100N
CTBP2APSPNQPTNLIVER966p.K974fsc.2922_2922delAFrame_Shift_Del124.34HEPG2N300N
CTBP2APSPNQPTNLIVER966p.K974fsc.2922_2922delAFrame_Shift_Del124.34HLFN300N
CTBP2APSPNQPTNLIVER966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SNU387N300N
CTBP2APSPNQPTNLIVER966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SNU475N300N
CTBP2APSPNQPTNLIVER966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SNU761N300N
CTBP2APSPNQPTNLIVER966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SNU878N300N
CTBP2GTIESTPTSLIVER976p.K974fsc.2922_2922delAFrame_Shift_Del524.34HEPG2N100N
CTBP2GTIESTPTSLIVER976p.K974fsc.2922_2922delAFrame_Shift_Del524.34HLFN100N
CTBP2GTIESTPTSLIVER976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU387N100N
CTBP2GTIESTPTSLIVER976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU475N100N
CTBP2GTIESTPTSLIVER976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU761N100N
CTBP2GTIESTPTSLIVER976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU878N100N
CTBP2NQPTNTGTILIVER970p.K974fsc.2922_2922delAFrame_Shift_Del424.34HEPG2N1000N
CTBP2NQPTNTGTILIVER970p.K974fsc.2922_2922delAFrame_Shift_Del424.34HLFN1000N
CTBP2NQPTNTGTILIVER970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SNU387N1000N
CTBP2NQPTNTGTILIVER970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SNU475N1000N
CTBP2NQPTNTGTILIVER970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SNU761N1000N
CTBP2NQPTNTGTILIVER970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SNU878N1000N
CTBP2NTGTIESTPLIVER974p.K974fsc.2922_2922delAFrame_Shift_Del524.34HEPG2N000N
CTBP2NTGTIESTPLIVER974p.K974fsc.2922_2922delAFrame_Shift_Del524.34HLFN000N
CTBP2NTGTIESTPLIVER974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU387N000N
CTBP2NTGTIESTPLIVER974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU475N000N
CTBP2NTGTIESTPLIVER974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU761N000N
CTBP2NTGTIESTPLIVER974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU878N000N
CTBP2PNQPTNTGTLIVER969p.K974fsc.2922_2922delAFrame_Shift_Del324.34HEPG2N000N
CTBP2PNQPTNTGTLIVER969p.K974fsc.2922_2922delAFrame_Shift_Del324.34HLFN000N
CTBP2PNQPTNTGTLIVER969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SNU387N000N
CTBP2PNQPTNTGTLIVER969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SNU475N000N
CTBP2PNQPTNTGTLIVER969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SNU761N000N
CTBP2PNQPTNTGTLIVER969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SNU878N000N
CTBP2PSPNQPTNTLIVER967p.K974fsc.2922_2922delAFrame_Shift_Del224.34HEPG2N000N
CTBP2PSPNQPTNTLIVER967p.K974fsc.2922_2922delAFrame_Shift_Del224.34HLFN000N
CTBP2PSPNQPTNTLIVER967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU387N000N
CTBP2PSPNQPTNTLIVER967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU475N000N
CTBP2PSPNQPTNTLIVER967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU761N000N
CTBP2PSPNQPTNTLIVER967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU878N000N
CTBP2PTNTGTIESLIVER972p.K974fsc.2922_2922delAFrame_Shift_Del524.34HEPG2N000N
CTBP2PTNTGTIESLIVER972p.K974fsc.2922_2922delAFrame_Shift_Del524.34HLFN000N
CTBP2PTNTGTIESLIVER972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU387N000N
CTBP2PTNTGTIESLIVER972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU475N000N
CTBP2PTNTGTIESLIVER972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU761N000N
CTBP2PTNTGTIESLIVER972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU878N000N
CTBP2QPTNTGTIELIVER971p.K974fsc.2922_2922delAFrame_Shift_Del524.34HEPG2N000N
CTBP2QPTNTGTIELIVER971p.K974fsc.2922_2922delAFrame_Shift_Del524.34HLFN000N
CTBP2QPTNTGTIELIVER971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU387N000N
CTBP2QPTNTGTIELIVER971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU475N000N
CTBP2QPTNTGTIELIVER971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU761N000N
CTBP2QPTNTGTIELIVER971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU878N000N
CTBP2SPNQPTNTGLIVER968p.K974fsc.2922_2922delAFrame_Shift_Del224.34HEPG2N000N
CTBP2SPNQPTNTGLIVER968p.K974fsc.2922_2922delAFrame_Shift_Del224.34HLFN000N
CTBP2SPNQPTNTGLIVER968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU387N000N
CTBP2SPNQPTNTGLIVER968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU475N000N
CTBP2SPNQPTNTGLIVER968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU761N000N
CTBP2SPNQPTNTGLIVER968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU878N000N
CTBP2TGTIESTPTLIVER975p.K974fsc.2922_2922delAFrame_Shift_Del524.34HEPG2N000N
CTBP2TGTIESTPTLIVER975p.K974fsc.2922_2922delAFrame_Shift_Del524.34HLFN000N
CTBP2TGTIESTPTLIVER975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU387N000N
CTBP2TGTIESTPTLIVER975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU475N000N
CTBP2TGTIESTPTLIVER975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU761N000N
CTBP2TGTIESTPTLIVER975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU878N000N
CTBP2TIESTPTSNLIVER977p.K974fsc.2922_2922delAFrame_Shift_Del524.34HEPG2N100N
CTBP2TIESTPTSNLIVER977p.K974fsc.2922_2922delAFrame_Shift_Del524.34HLFN100N
CTBP2TIESTPTSNLIVER977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU387N100N
CTBP2TIESTPTSNLIVER977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU475N100N
CTBP2TIESTPTSNLIVER977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU761N100N
CTBP2TIESTPTSNLIVER977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU878N100N
CTBP2TNTGTIESTLIVER973p.K974fsc.2922_2922delAFrame_Shift_Del524.34HEPG2N000N
CTBP2TNTGTIESTLIVER973p.K974fsc.2922_2922delAFrame_Shift_Del524.34HLFN000N
CTBP2TNTGTIESTLIVER973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU387N000N
CTBP2TNTGTIESTLIVER973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU475N000N
CTBP2TNTGTIESTLIVER973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU761N000N
CTBP2TNTGTIESTLIVER973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU878N000N
CTBP2ARVLRCLANLIVER339p.343_344SR>RCc.1029_1030CC>ATMissense_Mutation20.11ALEXANDERCELLSN300N
CTBP2CLANSCRTELIVER344p.343_344SR>RCc.1029_1030CC>ATMissense_Mutation10.11ALEXANDERCELLSN000N
CTBP2GQARVLRCLLIVER337p.343_344SR>RCc.1029_1030CC>ATMissense_Mutation20.11ALEXANDERCELLSY12110N
CTBP2LGQARVLRCLIVER336p.343_344SR>RCc.1029_1030CC>ATMissense_Mutation20.11ALEXANDERCELLSN1016N
CTBP2LRCLANSCRLIVER342p.343_344SR>RCc.1029_1030CC>ATMissense_Mutation20.11ALEXANDERCELLSN3011N
CTBP2NLGQARVLRLIVER335p.343_344SR>RCc.1029_1030CC>ATMissense_Mutation10.11ALEXANDERCELLSN500N
CTBP2QARVLRCLALIVER338p.343_344SR>RCc.1029_1030CC>ATMissense_Mutation20.11ALEXANDERCELLSN600N
CTBP2RCLANSCRTLIVER343p.343_344SR>RCc.1029_1030CC>ATMissense_Mutation20.11ALEXANDERCELLSN200N
CTBP2RVLRCLANSLIVER340p.343_344SR>RCc.1029_1030CC>ATMissense_Mutation20.11ALEXANDERCELLSN000N
CTBP2VLRCLANSCLIVER341p.343_344SR>RCc.1029_1030CC>ATMissense_Mutation20.11ALEXANDERCELLSN1013N
CTNNB1CGATTTAPSLIVER37p.S37Cc.110C>GMissense_Mutation10.22SNU398N000N
CTNNB1DSGIHCGATLIVER32p.S37Cc.110C>GMissense_Mutation10.22SNU398N100N
CTNNB1DSVIHSGATLIVER32p.G34Vc.101G>TMissense_Mutation10.22HUH6N100N
CTNNB1GIHCGATTTLIVER34p.S37Cc.110C>GMissense_Mutation10.22SNU398N000N
CTNNB1HCGATTTAPLIVER36p.S37Cc.110C>GMissense_Mutation10.22SNU398N000N
CTNNB1IHCGATTTALIVER35p.S37Cc.110C>GMissense_Mutation10.22SNU398N201N
CTNNB1LDSGIHCGALIVER31p.S37Cc.110C>GMissense_Mutation10.22SNU398N400N
CTNNB1LDSVIHSGALIVER31p.G34Vc.101G>TMissense_Mutation10.22HUH6N400N
CTNNB1QQQSYLDSVLIVER26p.G34Vc.101G>TMissense_Mutation10.22HUH6N800N
CTNNB1QQSYLDSVILIVER27p.G34Vc.101G>TMissense_Mutation10.22HUH6N500N
CTNNB1QSYLDSVIHLIVER28p.G34Vc.101G>TMissense_Mutation10.22HUH6N000N
CTNNB1SGIHCGATTLIVER33p.S37Cc.110C>GMissense_Mutation10.22SNU398N100N
CTNNB1SVIHSGATTLIVER33p.G34Vc.101G>TMissense_Mutation10.22HUH6N200N
CTNNB1SYLDSGIHCLIVER29p.S37Cc.110C>GMissense_Mutation10.22SNU398Y3100N
CTNNB1SYLDSVIHSLIVER29p.G34Vc.101G>TMissense_Mutation10.22HUH6Y2100N
CTNNB1VIHSGATTTLIVER34p.G34Vc.101G>TMissense_Mutation10.22HUH6N100N
CTNNB1YLDSGIHCGLIVER30p.S37Cc.110C>GMissense_Mutation10.22SNU398N300N
CTNNB1YLDSVIHSGLIVER30p.G34Vc.101G>TMissense_Mutation10.22HUH6N300N
EGFRAAACTGPRELIVER237p.G239Ac.716G>CMissense_Mutation10.11SNU886N000N
EGFRAACTGPRESLIVER238p.G239Ac.716G>CMissense_Mutation10.11SNU886N100N
EGFRACTGPRESDLIVER239p.G239Ac.716G>CMissense_Mutation10.11SNU886N000N
EGFRCAAACTGPRLIVER236p.G239Ac.716G>CMissense_Mutation10.11SNU886N300N
EGFRCCHNQCAAALIVER231p.G239Ac.716G>CMissense_Mutation10.11SNU886N100N
EGFRCHNQCAAACLIVER232p.G239Ac.716G>CMissense_Mutation10.11SNU886N100N
EGFRHNQCAAACTLIVER233p.G239Ac.716G>CMissense_Mutation10.11SNU886N000N
EGFRNQCAAACTGLIVER234p.G239Ac.716G>CMissense_Mutation10.11SNU886N000N
EGFRQCAAACTGPLIVER235p.G239Ac.716G>CMissense_Mutation10.11SNU886N000N
FLT3AQFTKMFMLLIVER425p.T432Mc.1295C>TMissense_Mutation10.22SNU475Y2290N
FLT3DAQFTKMFMLIVER424p.T432Mc.1295C>TMissense_Mutation10.22SNU475N400Y
FLT3FMLNIRRKPLIVER431p.T432Mc.1295C>TMissense_Mutation10.22SNU475N2015N
FLT3FTKMFMLNILIVER427p.T432Mc.1295C>TMissense_Mutation10.22SNU475Y7156N
FLT3KMFMLNIRRLIVER429p.T432Mc.1295C>TMissense_Mutation10.22SNU475Y890N
FLT3MFMLNIRRKLIVER430p.T432Mc.1295C>TMissense_Mutation10.22SNU475Y01225N
FLT3MLNIRRKPQLIVER432p.T432Mc.1295C>TMissense_Mutation10.22SNU475N0022N
FLT3QFTKMFMLNLIVER426p.T432Mc.1295C>TMissense_Mutation10.22SNU475N000N
FLT3TKMFMLNIRLIVER428p.T432Mc.1295C>TMissense_Mutation10.22SNU475N100N
FMN2LPPLPGAAILIVER934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03C3AN1401N
FMN2LPPLPGAAILIVER934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03SKHEP1N1401N
FMN2LPPLPGAAILIVER934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03SNU886N1401N
FMN2PLPPLPGAALIVER933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03C3AN000N
FMN2PLPPLPGAALIVER933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03SKHEP1N000N
FMN2PLPPLPGAALIVER933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03SNU886N000N
FMN2ADAETESQSLIVER639p.E639Ac.1916A>CMissense_Mutation10.11HUH7N300N
FMN2DEEHRLADALIVER633p.E639Ac.1916A>CMissense_Mutation10.11HUH7N500N
FMN2EEHRLADAELIVER634p.E639Ac.1916A>CMissense_Mutation10.11HUH7N000N
FMN2EHRLADAETLIVER635p.E639Ac.1916A>CMissense_Mutation10.11HUH7N000N
FMN2HRLADAETELIVER636p.E639Ac.1916A>CMissense_Mutation10.11HUH7N100N
FMN2LADAETESQLIVER638p.E639Ac.1916A>CMissense_Mutation10.11HUH7N000N
FMN2PDEEHRLADLIVER632p.E639Ac.1916A>CMissense_Mutation10.11HUH7N000N
FMN2PPDEEHRLALIVER631p.E639Ac.1916A>CMissense_Mutation10.11HUH7N300N
FMN2RLADAETESLIVER637p.E639Ac.1916A>CMissense_Mutation10.11HUH7N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7C3AN000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HEPG2N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HUH6N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HUH7N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7JHH1N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7JHH2N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7JHH6N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7JHH7N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7LI7N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SKHEP1N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU182N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU387N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU398N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU423N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU475N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU761N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU878N000N
GPR112ASISDMFIQLIVER2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU886N000N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7C3AY11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HEPG2Y11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HUH6Y11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HUH7Y11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7JHH1Y11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7JHH2Y11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7JHH6Y11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7JHH7Y11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7LI7Y11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SKHEP1Y11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU182Y11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU387Y11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU398Y11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU423Y11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU475Y11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU761Y11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU878Y11100N
GPR112ISDMFIQNLLIVER2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU886Y11100N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7C3AN700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HEPG2N700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HUH6N700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HUH7N700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7JHH1N700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7JHH2N700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7JHH6N700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7JHH7N700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7LI7N700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SKHEP1N700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU182N700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU387N700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU398N700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU423N700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU475N700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU761N700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU878N700N
GPR112SASISDMFILIVER2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU886N700N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7C3AN400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HEPG2N400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HUH6N400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HUH7N400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7JHH1N400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7JHH2N400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7JHH6N400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7JHH7N400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7LI7N400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SKHEP1N400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU182N400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU387N400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU398N400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU423N400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU475N400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU761N400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU878N400N
GPR112SDMFIQNLALIVER2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU886N400N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7C3AN000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HEPG2N000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HUH6N000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HUH7N000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7JHH1N000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7JHH2N000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7JHH6N000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7JHH7N000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7LI7N000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SKHEP1N000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU182N000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU387N000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU398N000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU423N000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU475N000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU761N000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU878N000N
GPR112SISDMFIQNLIVER2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU886N000N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7C3AN900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HEPG2N900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HUH6N900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HUH7N900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7JHH1N900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7JHH2N900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7JHH6N900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7JHH7N900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7LI7N900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SKHEP1N900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU182N900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU387N900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU398N900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU423N900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU475N900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU761N900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU878N900N
GPR112VSASISDMFLIVER2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU886N900N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7C3AN5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HEPG2N5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HUH6N5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HUH7N5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7JHH1N5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7JHH2N5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7JHH6N5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7JHH7N5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7LI7N5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SKHEP1N5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU182N5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU387N5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU398N5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU423N5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU475N5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU761N5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU878N5020N
GPR112VVSASISDMLIVER2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU886N5020N
GPR112AFGPTKNVKLIVER1777p.S1778Fc.5333C>TMissense_Mutation10.11SNU423Y1150N
GPR112FGPTKNVKTLIVER1778p.S1778Fc.5333C>TMissense_Mutation10.11SNU423N403N
GPR112FKSAFGPTKLIVER1774p.S1778Fc.5333C>TMissense_Mutation10.11SNU423N302N
GPR112KSAFGPTKNLIVER1775p.S1778Fc.5333C>TMissense_Mutation10.11SNU423N100N
GPR112LTSFKSAFGLIVER1771p.S1778Fc.5333C>TMissense_Mutation10.11SNU423N000N
GPR112SAFGPTKNVLIVER1776p.S1778Fc.5333C>TMissense_Mutation10.11SNU423N800N
GPR112SFKSAFGPTLIVER1773p.S1778Fc.5333C>TMissense_Mutation10.11SNU423N100N
GPR112SLTSFKSAFLIVER1770p.S1778Fc.5333C>TMissense_Mutation10.11SNU423N500Y
GPR112TSFKSAFGPLIVER1772p.S1778Fc.5333C>TMissense_Mutation10.11SNU423N000N
HSP90B1DEEETAKESLIVER787p.E791delc.2362_2364delGAAIn_Frame_Del121.79C3AN300N
HSP90B1DEEETAKESLIVER787p.E791delc.2362_2364delGAAIn_Frame_Del121.79HEPG2N300N
HSP90B1DEEETAKESLIVER787p.E791delc.2362_2364delGAAIn_Frame_Del121.79HUH6N300N
HSP90B1DEEETAKESLIVER787p.E791delc.2362_2364delGAAIn_Frame_Del121.79JHH4N300N
HSP90B1DEEETAKESLIVER787p.E791delc.2362_2364delGAAIn_Frame_Del121.79JHH5N300N
HSP90B1DEEETAKESLIVER787p.E791delc.2362_2364delGAAIn_Frame_Del121.79JHH7N300N
HSP90B1DEEETAKESLIVER787p.E791delc.2362_2364delGAAIn_Frame_Del121.79LI7N300N
HSP90B1DEEETAKESLIVER787p.E791delc.2362_2364delGAAIn_Frame_Del121.79SKHEP1N300N
HSP90B1DEEETAKESLIVER787p.E791delc.2362_2364delGAAIn_Frame_Del121.79SNU182N300N
HSP90B1DEEETAKESLIVER787p.E791delc.2362_2364delGAAIn_Frame_Del121.79SNU761N300N
HSP90B1DVGTDEEETLIVER783p.E791delc.2362_2364delGAAIn_Frame_Del121.79C3AN200N
HSP90B1DVGTDEEETLIVER783p.E791delc.2362_2364delGAAIn_Frame_Del121.79HEPG2N200N
HSP90B1DVGTDEEETLIVER783p.E791delc.2362_2364delGAAIn_Frame_Del121.79HUH6N200N
HSP90B1DVGTDEEETLIVER783p.E791delc.2362_2364delGAAIn_Frame_Del121.79JHH4N200N
HSP90B1DVGTDEEETLIVER783p.E791delc.2362_2364delGAAIn_Frame_Del121.79JHH5N200N
HSP90B1DVGTDEEETLIVER783p.E791delc.2362_2364delGAAIn_Frame_Del121.79JHH7N200N
HSP90B1DVGTDEEETLIVER783p.E791delc.2362_2364delGAAIn_Frame_Del121.79LI7N200N
HSP90B1DVGTDEEETLIVER783p.E791delc.2362_2364delGAAIn_Frame_Del121.79SKHEP1N200N
HSP90B1DVGTDEEETLIVER783p.E791delc.2362_2364delGAAIn_Frame_Del121.79SNU182N200N
HSP90B1DVGTDEEETLIVER783p.E791delc.2362_2364delGAAIn_Frame_Del121.79SNU761N200N
HSP90B1GTDEEETAKLIVER785p.E791delc.2362_2364delGAAIn_Frame_Del321.79C3AN400N
HSP90B1GTDEEETAKLIVER785p.E791delc.2362_2364delGAAIn_Frame_Del321.79HEPG2N400N
HSP90B1GTDEEETAKLIVER785p.E791delc.2362_2364delGAAIn_Frame_Del321.79HUH6N400N
HSP90B1GTDEEETAKLIVER785p.E791delc.2362_2364delGAAIn_Frame_Del321.79JHH4N400N
HSP90B1GTDEEETAKLIVER785p.E791delc.2362_2364delGAAIn_Frame_Del321.79JHH5N400N
HSP90B1GTDEEETAKLIVER785p.E791delc.2362_2364delGAAIn_Frame_Del321.79JHH7N400N
HSP90B1GTDEEETAKLIVER785p.E791delc.2362_2364delGAAIn_Frame_Del321.79LI7N400N
HSP90B1GTDEEETAKLIVER785p.E791delc.2362_2364delGAAIn_Frame_Del321.79SKHEP1N400N
HSP90B1GTDEEETAKLIVER785p.E791delc.2362_2364delGAAIn_Frame_Del321.79SNU182N400N
HSP90B1GTDEEETAKLIVER785p.E791delc.2362_2364delGAAIn_Frame_Del321.79SNU761N400N
HSP90B1TDEEETAKELIVER786p.E791delc.2362_2364delGAAIn_Frame_Del221.79C3AN000N
HSP90B1TDEEETAKELIVER786p.E791delc.2362_2364delGAAIn_Frame_Del221.79HEPG2N000N
HSP90B1TDEEETAKELIVER786p.E791delc.2362_2364delGAAIn_Frame_Del221.79HUH6N000N
HSP90B1TDEEETAKELIVER786p.E791delc.2362_2364delGAAIn_Frame_Del221.79JHH4N000N
HSP90B1TDEEETAKELIVER786p.E791delc.2362_2364delGAAIn_Frame_Del221.79JHH5N000N
HSP90B1TDEEETAKELIVER786p.E791delc.2362_2364delGAAIn_Frame_Del221.79JHH7N000N
HSP90B1TDEEETAKELIVER786p.E791delc.2362_2364delGAAIn_Frame_Del221.79LI7N000N
HSP90B1TDEEETAKELIVER786p.E791delc.2362_2364delGAAIn_Frame_Del221.79SKHEP1N000N
HSP90B1TDEEETAKELIVER786p.E791delc.2362_2364delGAAIn_Frame_Del221.79SNU182N000N
HSP90B1TDEEETAKELIVER786p.E791delc.2362_2364delGAAIn_Frame_Del221.79SNU761N000N
HSP90B1VGTDEEETALIVER784p.E791delc.2362_2364delGAAIn_Frame_Del221.79C3AN100N
HSP90B1VGTDEEETALIVER784p.E791delc.2362_2364delGAAIn_Frame_Del221.79HEPG2N100N
HSP90B1VGTDEEETALIVER784p.E791delc.2362_2364delGAAIn_Frame_Del221.79HUH6N100N
HSP90B1VGTDEEETALIVER784p.E791delc.2362_2364delGAAIn_Frame_Del221.79JHH4N100N
HSP90B1VGTDEEETALIVER784p.E791delc.2362_2364delGAAIn_Frame_Del221.79JHH5N100N
HSP90B1VGTDEEETALIVER784p.E791delc.2362_2364delGAAIn_Frame_Del221.79JHH7N100N
HSP90B1VGTDEEETALIVER784p.E791delc.2362_2364delGAAIn_Frame_Del221.79LI7N100N
HSP90B1VGTDEEETALIVER784p.E791delc.2362_2364delGAAIn_Frame_Del221.79SKHEP1N100N
HSP90B1VGTDEEETALIVER784p.E791delc.2362_2364delGAAIn_Frame_Del221.79SNU182N100N
HSP90B1VGTDEEETALIVER784p.E791delc.2362_2364delGAAIn_Frame_Del221.79SNU761N100N
MAP3K1ALSPSSSTPLIVER982p.T985delc.2953_2955delACCIn_Frame_Del30.44ALEXANDERCELLSN000N
MAP3K1FPALSPSSSLIVER980p.T985delc.2953_2955delACCIn_Frame_Del20.44ALEXANDERCELLSN702N
MAP3K1LMFPALSPSLIVER978p.T985delc.2953_2955delACCIn_Frame_Del20.44ALEXANDERCELLSN300N
MAP3K1LSPSSSTPSLIVER983p.T985delc.2953_2955delACCIn_Frame_Del20.44ALEXANDERCELLSN000N
MAP3K1MFPALSPSSLIVER979p.T985delc.2953_2955delACCIn_Frame_Del20.44ALEXANDERCELLSN004N
MAP3K1PALSPSSSTLIVER981p.T985delc.2953_2955delACCIn_Frame_Del30.44ALEXANDERCELLSN000N
MAP3K1QLMFPALSPLIVER977p.T985delc.2953_2955delACCIn_Frame_Del10.44ALEXANDERCELLSN000N
MAP3K1SPSSSTPSVLIVER984p.T985delc.2953_2955delACCIn_Frame_Del10.44ALEXANDERCELLSN1100N
MAP3K1STTTTTTTELIVER941p.T949delc.2822_2824delCAAIn_Frame_Del176.44ALEXANDERCELLSN000N
MAP3K1STTTTTTTELIVER941p.T949delc.2822_2824delCAAIn_Frame_Del176.44C3AN000N
MAP3K1STTTTTTTELIVER941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HEPG2N000N
MAP3K1STTTTTTTELIVER941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HUH6N000N
MAP3K1STTTTTTTELIVER941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HUH7N000N
MAP3K1STTTTTTTELIVER941p.T949delc.2822_2824delCAAIn_Frame_Del176.44JHH1N000N
MAP3K1STTTTTTTELIVER941p.T949delc.2822_2824delCAAIn_Frame_Del176.44JHH2N000N
MAP3K1STTTTTTTELIVER941p.T949delc.2822_2824delCAAIn_Frame_Del176.44JHH5N000N
MAP3K1STTTTTTTELIVER941p.T949delc.2822_2824delCAAIn_Frame_Del176.44JHH6N000N
MAP3K1STTTTTTTELIVER941p.T949delc.2822_2824delCAAIn_Frame_Del176.44LI7N000N
MAP3K1STTTTTTTELIVER941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SKHEP1N000N
MAP3K1STTTTTTTELIVER941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SNU387N000N
MAP3K1STTTTTTTELIVER941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SNU423N000N
MAP3K1STTTTTTTELIVER941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SNU475N000N
MAP3K1STTTTTTTELIVER941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SNU878N000N
MAP3K4GGSLPKKLILIVER171p.S178Lc.533C>TMissense_Mutation10.11JHH1N800N
MAP3K4GSLPKKLIPLIVER172p.S178Lc.533C>TMissense_Mutation10.11JHH1N000N
MAP3K4KKLIPDVDLLIVER176p.S178Lc.533C>TMissense_Mutation10.11JHH1N600N
MAP3K4KLIPDVDLNLIVER177p.S178Lc.533C>TMissense_Mutation10.11JHH1N000N
MAP3K4LIPDVDLNKLIVER178p.S178Lc.533C>TMissense_Mutation10.11JHH1N300N
MAP3K4LPKKLIPDVLIVER174p.S178Lc.533C>TMissense_Mutation10.11JHH1N1500N
MAP3K4PKKLIPDVDLIVER175p.S178Lc.533C>TMissense_Mutation10.11JHH1N000N
MAP3K4SLPKKLIPDLIVER173p.S178Lc.533C>TMissense_Mutation10.11JHH1N000N
MAP3K4VGGSLPKKLLIVER170p.S178Lc.533C>TMissense_Mutation10.11JHH1N1002N
METDVLPEFRDYLIVER236p.S244Yc.731C>AMissense_Mutation10.11C3AN500N
METDYYPIKYVHLIVER243p.S244Yc.731C>AMissense_Mutation10.11C3AN100N
METEFRDYYPIKLIVER240p.S244Yc.731C>AMissense_Mutation10.11C3AN000N
METFRDYYPIKYLIVER241p.S244Yc.731C>AMissense_Mutation10.11C3AY7107N
METLPEFRDYYPLIVER238p.S244Yc.731C>AMissense_Mutation10.11C3AN200N
METPEFRDYYPILIVER239p.S244Yc.731C>AMissense_Mutation10.11C3AN500N
METRDYYPIKYVLIVER242p.S244Yc.731C>AMissense_Mutation10.11C3AN800N
METVLPEFRDYYLIVER237p.S244Yc.731C>AMissense_Mutation10.11C3AY9120N
METYYPIKYVHALIVER244p.S244Yc.731C>AMissense_Mutation10.11C3AN701N
MLL3AEQFKHVTELIVER3231p.L3234Fc.9700C>TMissense_Mutation10.11HUH7N000N
MLL3CFILCSSTALIVER4242p.Y4246Cc.12737A>GMissense_Mutation10.11JHH7N100N
MLL3CSNNCFILCLIVER4238p.Y4246Cc.12737A>GMissense_Mutation10.11JHH7N100N
MLL3CSSTAQAKNLIVER4246p.Y4246Cc.12737A>GMissense_Mutation10.11JHH7N000N
MLL3DAEQFKHVTLIVER3230p.L3234Fc.9700C>TMissense_Mutation10.11HUH7N300N
MLL3EDAEQFKHVLIVER3229p.L3234Fc.9700C>TMissense_Mutation10.11HUH7N400N
MLL3EEDAEQFKHLIVER3228p.L3234Fc.9700C>TMissense_Mutation10.11HUH7N000N
MLL3EQFKHVTEQLIVER3232p.L3234Fc.9700C>TMissense_Mutation10.11HUH7N000N
MLL3FILCSSTAQLIVER4243p.Y4246Cc.12737A>GMissense_Mutation10.11JHH7N2016N
MLL3FKHVTEQQSLIVER3234p.L3234Fc.9700C>TMissense_Mutation10.11HUH7N200N
MLL3FPEEDAEQFLIVER3226p.L3234Fc.9700C>TMissense_Mutation10.11HUH7N1000N
MLL3ILCSSTAQALIVER4244p.Y4246Cc.12737A>GMissense_Mutation10.11JHH7N6012N
MLL3LCSSTAQAKLIVER4245p.Y4246Cc.12737A>GMissense_Mutation10.11JHH7N100N
MLL3NCFILCSSTLIVER4241p.Y4246Cc.12737A>GMissense_Mutation10.11JHH7N000N
MLL3NNCFILCSSLIVER4240p.Y4246Cc.12737A>GMissense_Mutation10.11JHH7N000N
MLL3PEEDAEQFKLIVER3227p.L3234Fc.9700C>TMissense_Mutation10.11HUH7N000N
MLL3QFKHVTEQQLIVER3233p.L3234Fc.9700C>TMissense_Mutation10.11HUH7N000N
MLL3SNNCFILCSLIVER4239p.Y4246Cc.12737A>GMissense_Mutation10.11JHH7N000N
MSH2ALNLFQVSVLIVER309p.G315Vc.944G>TMissense_Mutation10.11SKHEP1Y6100N
MSH2EEFQYIGELLIVER852p.S860Lc.2579C>TMissense_Mutation10.11ALEXANDERCELLSY11110N
MSH2EFQYIGELQLIVER853p.S860Lc.2579C>TMissense_Mutation10.11ALEXANDERCELLSN000N
MSH2ELQGYDIMELIVER859p.S860Lc.2579C>TMissense_Mutation10.11ALEXANDERCELLSN000N
MSH2FQVSVEDTTLIVER313p.G315Vc.944G>TMissense_Mutation10.11SKHEP1N400N
MSH2FQYIGELQGLIVER854p.S860Lc.2579C>TMissense_Mutation10.11ALEXANDERCELLSN206N
MSH2GELQGYDIMLIVER858p.S860Lc.2579C>TMissense_Mutation10.11ALEXANDERCELLSN1000N
MSH2IGELQGYDILIVER857p.S860Lc.2579C>TMissense_Mutation10.11ALEXANDERCELLSN701N
MSH2LFQVSVEDTLIVER312p.G315Vc.944G>TMissense_Mutation10.11SKHEP1N100N
MSH2LNLFQVSVELIVER310p.G315Vc.944G>TMissense_Mutation10.11SKHEP1N0012N
MSH2LQGYDIMEPLIVER860p.S860Lc.2579C>TMissense_Mutation10.11ALEXANDERCELLSN009N
MSH2NLFQVSVEDLIVER311p.G315Vc.944G>TMissense_Mutation10.11SKHEP1N000N
MSH2QVSVEDTTGLIVER314p.G315Vc.944G>TMissense_Mutation10.11SKHEP1N000N
MSH2QYIGELQGYLIVER855p.S860Lc.2579C>TMissense_Mutation10.11ALEXANDERCELLSN500N
MSH2RALNLFQVSLIVER308p.G315Vc.944G>TMissense_Mutation10.11SKHEP1N300N
MSH2VRALNLFQVLIVER307p.G315Vc.944G>TMissense_Mutation10.11SKHEP1Y7925N
MSH2VSVEDTTGSLIVER315p.G315Vc.944G>TMissense_Mutation10.11SKHEP1N005N
MSH2YIGELQGYDLIVER856p.S860Lc.2579C>TMissense_Mutation10.11ALEXANDERCELLSN200N
MSH2AEMLETTSILIVER727p.A733Tc.2197G>AMissense_Mutation10.22SNU886N600N
MSH2EMLETTSILLIVER728p.A733Tc.2197G>AMissense_Mutation10.22SNU886N1900N
MSH2ETTSILRSALIVER731p.A733Tc.2197G>AMissense_Mutation10.22SNU886N100N
MSH2FMAEMLETTLIVER725p.A733Tc.2197G>AMissense_Mutation10.22SNU886N400N
MSH2LETTSILRSLIVER730p.A733Tc.2197G>AMissense_Mutation10.22SNU886N404N
MSH2MAEMLETTSLIVER726p.A733Tc.2197G>AMissense_Mutation10.22SNU886N200N
MSH2MLETTSILRLIVER729p.A733Tc.2197G>AMissense_Mutation10.22SNU886N702N
MSH2TSILRSATKLIVER733p.A733Tc.2197G>AMissense_Mutation10.22SNU886N200N
MSH2TTSILRSATLIVER732p.A733Tc.2197G>AMissense_Mutation10.22SNU886N100N
MSH2IKALEKHEGLIVER418p.Q419Kc.1255C>AMissense_Mutation10.66JHH7N0018N
MSH2INQLPNVIKLIVER411p.Q419Kc.1255C>AMissense_Mutation10.66JHH7N005Y
MSH2KALEKHEGKLIVER419p.Q419Kc.1255C>AMissense_Mutation10.66JHH7N400N
MSH2LPNVIKALELIVER414p.Q419Kc.1255C>AMissense_Mutation10.66JHH7N202N
MSH2NQLPNVIKALIVER412p.Q419Kc.1255C>AMissense_Mutation10.66JHH7Y790N
MSH2NVIKALEKHLIVER416p.Q419Kc.1255C>AMissense_Mutation10.66JHH7N100N
MSH2PNVIKALEKLIVER415p.Q419Kc.1255C>AMissense_Mutation10.66JHH7N000N
MSH2QLPNVIKALLIVER413p.Q419Kc.1255C>AMissense_Mutation10.66JHH7Y15120N
MSH2VIKALEKHELIVER417p.Q419Kc.1255C>AMissense_Mutation10.66JHH7N000N
MSH3AAAAPPAPALIVER59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23C3AN200N
MSH3AAAAPPAPALIVER59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HEPG2N200N
MSH3AAAAPPAPALIVER59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23JHH7N200N
MSH3AAAPPAPAFLIVER60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23C3AY8100N
MSH3AAAPPAPAFLIVER60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23HEPG2Y8100N
MSH3AAAPPAPAFLIVER60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23JHH7Y8100N
MSH3AAPPAPAFPLIVER61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23C3AN000N
MSH3AAPPAPAFPLIVER61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HEPG2N000N
MSH3AAPPAPAFPLIVER61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23JHH7N000N
MSH6CQIKKRRVILIVER243p.R243Cc.727C>TMissense_Mutation10.11NCIH684N700N
MSH6GSRRSSCQILIVER237p.R243Cc.727C>TMissense_Mutation10.11NCIH684Y5120N
MSH6QGSRRSSCQLIVER236p.R243Cc.727C>TMissense_Mutation10.11NCIH684N000N
MSH6RRSSCQIKKLIVER239p.R243Cc.727C>TMissense_Mutation10.11NCIH684Y290N
MSH6RSSCQIKKRLIVER240p.R243Cc.727C>TMissense_Mutation10.11NCIH684N300N
MSH6SCQIKKRRVLIVER242p.R243Cc.727C>TMissense_Mutation10.11NCIH684N100N
MSH6SRRSSCQIKLIVER238p.R243Cc.727C>TMissense_Mutation10.11NCIH684Y2110N
MSH6SSCQIKKRRLIVER241p.R243Cc.727C>TMissense_Mutation10.11NCIH684N300N
MSH6TQGSRRSSCLIVER235p.R243Cc.727C>TMissense_Mutation10.11NCIH684N200N
MYLKASKELKKDVLIVER1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02HLFN400N
MYLKASKELKKDVLIVER1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02HUH7N400N
MYLKASKELKKDVLIVER1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02LI7N400N
MYLKASKELKKDVLIVER1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU182N400N
MYLKASKELKKDVLIVER1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU387N400N
MYLKASKELKKDVLIVER1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU475N400N
MYLKASKELKKDVLIVER1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU761N400N
MYLKASKELKKDVLIVER1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU886N400N
MYLKKELKKDVKNLIVER1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02HLFN500N
MYLKKELKKDVKNLIVER1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02HUH7N500N
MYLKKELKKDVKNLIVER1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02LI7N500N
MYLKKELKKDVKNLIVER1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU182N500N
MYLKKELKKDVKNLIVER1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU387N500N
MYLKKELKKDVKNLIVER1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU475N500N
MYLKKELKKDVKNLIVER1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU761N500N
MYLKKELKKDVKNLIVER1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU886N500N
MYLKKSASKELKKLIVER1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02HLFN400N
MYLKKSASKELKKLIVER1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02HUH7N400N
MYLKKSASKELKKLIVER1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02LI7N400N
MYLKKSASKELKKLIVER1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU182N400N
MYLKKSASKELKKLIVER1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU387N400N
MYLKKSASKELKKLIVER1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU475N400N
MYLKKSASKELKKLIVER1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU761N400N
MYLKKSASKELKKLIVER1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU886N400N
MYLKLKSASKELKLIVER1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02HLFN105N
MYLKLKSASKELKLIVER1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02HUH7N105N
MYLKLKSASKELKLIVER1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02LI7N105N
MYLKLKSASKELKLIVER1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU182N105N
MYLKLKSASKELKLIVER1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU387N105N
MYLKLKSASKELKLIVER1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU475N105N
MYLKLKSASKELKLIVER1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU761N105N
MYLKLKSASKELKLIVER1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU886N105N
MYLKNLKSASKELLIVER1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02HLFY5100N
MYLKNLKSASKELLIVER1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02HUH7Y5100N
MYLKNLKSASKELLIVER1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02LI7Y5100N
MYLKNLKSASKELLIVER1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU182Y5100N
MYLKNLKSASKELLIVER1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU387Y5100N
MYLKNLKSASKELLIVER1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU475Y5100N
MYLKNLKSASKELLIVER1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU761Y5100N
MYLKNLKSASKELLIVER1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU886Y5100N
MYLKSASKELKKDLIVER1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02HLFN000N
MYLKSASKELKKDLIVER1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02HUH7N000N
MYLKSASKELKKDLIVER1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02LI7N000N
MYLKSASKELKKDLIVER1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU182N000N
MYLKSASKELKKDLIVER1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU387N000N
MYLKSASKELKKDLIVER1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU475N000N
MYLKSASKELKKDLIVER1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU761N000N
MYLKSASKELKKDLIVER1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU886N000N
MYLKSKELKKDVKLIVER1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02HLFN200N
MYLKSKELKKDVKLIVER1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02HUH7N200N
MYLKSKELKKDVKLIVER1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02LI7N200N
MYLKSKELKKDVKLIVER1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU182N200N
MYLKSKELKKDVKLIVER1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU387N200N
MYLKSKELKKDVKLIVER1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU475N200N
MYLKSKELKKDVKLIVER1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU761N200N
MYLKSKELKKDVKLIVER1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU886N200N
MYLKAEKLESEDVLIVER1783p.E1790delc.5370_5372delAGAIn_Frame_Del20.11SNU449N600N
MYLKEKLESEDVSLIVER1784p.E1790delc.5370_5372delAGAIn_Frame_Del30.11SNU449N100N
MYLKESEDVSQAFLIVER1787p.E1790delc.5370_5372delAGAIn_Frame_Del20.11SNU449N700Y
MYLKKLESEDVSQLIVER1785p.E1790delc.5370_5372delAGAIn_Frame_Del40.11SNU449N100N
MYLKLESEDVSQALIVER1786p.E1790delc.5370_5372delAGAIn_Frame_Del30.11SNU449N601N
MYLKNAEKLESEDLIVER1782p.E1790delc.5370_5372delAGAIn_Frame_Del10.11SNU449N000N
MYLKSEDVSQAFLLIVER1788p.E1790delc.5370_5372delAGAIn_Frame_Del10.11SNU449Y7100N
MYLKAHVSVSEKNLIVER205p.R206Hc.617G>AMissense_Mutation10.11SNU182N100N
MYLKAPAVETHPSLIVER146p.R152Hc.455G>AMissense_Mutation10.11SNU449N300N
MYLKARQYEILLKLIVER789p.G790Rc.2368G>CMissense_Mutation10.11ALEXANDERCELLSN200N
MYLKAVETHPSIWLIVER148p.R152Hc.455G>AMissense_Mutation10.11SNU449N100N
MYLKETHPSIWGELIVER150p.R152Hc.455G>AMissense_Mutation10.11SNU449N000N
MYLKFSAPAVETHLIVER144p.R152Hc.455G>AMissense_Mutation10.11SNU449N200Y
MYLKHARQYEILLLIVER788p.G790Rc.2368G>CMissense_Mutation10.11ALEXANDERCELLSY10100N
MYLKHPSIWGECPLIVER152p.R152Hc.455G>AMissense_Mutation10.11SNU449N100N
MYLKHVSVSEKNGLIVER206p.R206Hc.617G>AMissense_Mutation10.11SNU182N000N
MYLKKKVQPWHARLIVER782p.G790Rc.2368G>CMissense_Mutation10.11ALEXANDERCELLSN100N
MYLKKVQPWHARQLIVER783p.G790Rc.2368G>CMissense_Mutation10.11ALEXANDERCELLSN000N
MYLKLQPSAHVSVLIVER201p.R206Hc.617G>AMissense_Mutation10.11SNU182N1002N
MYLKNVPLQPSAHLIVER198p.R206Hc.617G>AMissense_Mutation10.11SNU182N000N
MYLKPAVETHPSILIVER147p.R152Hc.455G>AMissense_Mutation10.11SNU449N300N
MYLKPLQPSAHVSLIVER200p.R206Hc.617G>AMissense_Mutation10.11SNU182N000N
MYLKPSAHVSVSELIVER203p.R206Hc.617G>AMissense_Mutation10.11SNU182N000N
MYLKPWHARQYEILIVER786p.G790Rc.2368G>CMissense_Mutation10.11ALEXANDERCELLSN000N
MYLKQPSAHVSVSLIVER202p.R206Hc.617G>AMissense_Mutation10.11SNU182N200N
MYLKQPWHARQYELIVER785p.G790Rc.2368G>CMissense_Mutation10.11ALEXANDERCELLSN100N
MYLKRQYEILLKNLIVER790p.G790Rc.2368G>CMissense_Mutation10.11ALEXANDERCELLSN300N
MYLKSAHVSVSEKLIVER204p.R206Hc.617G>AMissense_Mutation10.11SNU182N200N
MYLKSAPAVETHPLIVER145p.R152Hc.455G>AMissense_Mutation10.11SNU449N000N
MYLKTHPSIWGECLIVER151p.R152Hc.455G>AMissense_Mutation10.11SNU449N100N
MYLKVETHPSIWGLIVER149p.R152Hc.455G>AMissense_Mutation10.11SNU449N001N
MYLKVPLQPSAHVLIVER199p.R206Hc.617G>AMissense_Mutation10.11SNU182Y14100N
MYLKVQPWHARQYLIVER784p.G790Rc.2368G>CMissense_Mutation10.11ALEXANDERCELLSN7012N
MYLKWHARQYEILLIVER787p.G790Rc.2368G>CMissense_Mutation10.11ALEXANDERCELLSN800N
NCOA3AMMLSRMGPLIVER1334p.S1337Lc.4010C>TMissense_Mutation10.11JHH6N000N
NCOA3LSRMGPSQNLIVER1337p.S1337Lc.4010C>TMissense_Mutation10.11JHH6N002N
NCOA3MLSRMGPSQLIVER1336p.S1337Lc.4010C>TMissense_Mutation10.11JHH6N005N
NCOA3MMLSRMGPSLIVER1335p.S1337Lc.4010C>TMissense_Mutation10.11JHH6N103N
NCOA3NAMMLSRMGLIVER1333p.S1337Lc.4010C>TMissense_Mutation10.11JHH6N000N
NCOA3PNAMMLSRMLIVER1332p.S1337Lc.4010C>TMissense_Mutation10.11JHH6N000N
NCOA3PPNAMMLSRLIVER1331p.S1337Lc.4010C>TMissense_Mutation10.11JHH6N000N
NCOA3SPPNAMMLSLIVER1330p.S1337Lc.4010C>TMissense_Mutation10.11JHH6N400N
NCOA3SSPPNAMMLLIVER1329p.S1337Lc.4010C>TMissense_Mutation10.11JHH6Y1490N
NF1ALLRLIEHPLIVER761p.R765Lc.2294G>TMissense_Mutation10.11ALEXANDERCELLSN000N
NF1AMFLTFINPLIVER1408p.R1412Tc.4235G>CMissense_Mutation10.11JHH6N100N
NF1AVGSAMFLTLIVER1404p.R1412Tc.4235G>CMissense_Mutation10.11JHH6N300N
NF1FLTFINPAILIVER1410p.R1412Tc.4235G>CMissense_Mutation10.11JHH6N1207N
NF1GSAMFLTFILIVER1406p.R1412Tc.4235G>CMissense_Mutation10.11JHH6Y8130N
NF1HFPQNSIGALIVER1396p.R1396Hc.4187G>AMissense_Mutation10.11JHH6N400N
NF1KKSVVSQHFLIVER1389p.R1396Hc.4187G>AMissense_Mutation10.11JHH6N400N
NF1KRVMALLRLLIVER757p.R765Lc.2294G>TMissense_Mutation10.11ALEXANDERCELLSY990N
NF1KSVVSQHFPLIVER1390p.R1396Hc.4187G>AMissense_Mutation10.11JHH6N000N
NF1LIEHPTAGNLIVER765p.R765Lc.2294G>TMissense_Mutation10.11ALEXANDERCELLSN101N
NF1LLRLIEHPTLIVER762p.R765Lc.2294G>TMissense_Mutation10.11ALEXANDERCELLSN100N
NF1LRLIEHPTALIVER763p.R765Lc.2294G>TMissense_Mutation10.11ALEXANDERCELLSN3027N
NF1LTFINPAIVLIVER1411p.R1412Tc.4235G>CMissense_Mutation10.11JHH6N1102N
NF1MALLRLIEHLIVER760p.R765Lc.2294G>TMissense_Mutation10.11ALEXANDERCELLSN007N
NF1MFLTFINPALIVER1409p.R1412Tc.4235G>CMissense_Mutation10.11JHH6N307N
NF1NKKSVVSQHLIVER1388p.R1396Hc.4187G>AMissense_Mutation10.11JHH6N100N
NF1QHFPQNSIGLIVER1395p.R1396Hc.4187G>AMissense_Mutation10.11JHH6N000N
NF1RLIEHPTAGLIVER764p.R765Lc.2294G>TMissense_Mutation10.11ALEXANDERCELLSN000N
NF1RVMALLRLILIVER758p.R765Lc.2294G>TMissense_Mutation10.11ALEXANDERCELLSN900N
NF1SAMFLTFINLIVER1407p.R1412Tc.4235G>CMissense_Mutation10.11JHH6N100N
NF1SQHFPQNSILIVER1394p.R1396Hc.4187G>AMissense_Mutation10.11JHH6Y6130N
NF1SVVSQHFPQLIVER1391p.R1396Hc.4187G>AMissense_Mutation10.11JHH6N000N
NF1TFINPAIVSLIVER1412p.R1412Tc.4235G>CMissense_Mutation10.11JHH6N000N
NF1VGSAMFLTFLIVER1405p.R1412Tc.4235G>CMissense_Mutation10.11JHH6N600N
NF1VMALLRLIELIVER759p.R765Lc.2294G>TMissense_Mutation10.11ALEXANDERCELLSN0014Y
NF1VSQHFPQNSLIVER1393p.R1396Hc.4187G>AMissense_Mutation10.11JHH6N104N
NF1VVSQHFPQNLIVER1392p.R1396Hc.4187G>AMissense_Mutation10.11JHH6N000N
NF1CQEMKCRNKLIVER1032p.F1037Cc.3110T>GMissense_Mutation10.55JHH2N200N
NF1CQEMKCRNKLIVER1032p.F1037Cc.3110T>GMissense_Mutation10.55JHH6N200N
NF1CRNKMVEYLLIVER1037p.F1037Cc.3110T>GMissense_Mutation10.55JHH2Y790N
NF1CRNKMVEYLLIVER1037p.F1037Cc.3110T>GMissense_Mutation10.55JHH6Y790N
NF1EMKCRNKMVLIVER1034p.F1037Cc.3110T>GMissense_Mutation10.55JHH2N500N
NF1EMKCRNKMVLIVER1034p.F1037Cc.3110T>GMissense_Mutation10.55JHH6N500N
NF1FCQEMKCRNLIVER1031p.F1037Cc.3110T>GMissense_Mutation10.55JHH2N100Y
NF1FCQEMKCRNLIVER1031p.F1037Cc.3110T>GMissense_Mutation10.55JHH6N100Y
NF1KCRNKMVEYLIVER1036p.F1037Cc.3110T>GMissense_Mutation10.55JHH2Y7120N
NF1KCRNKMVEYLIVER1036p.F1037Cc.3110T>GMissense_Mutation10.55JHH6Y7120N
NF1LSFCQEMKCLIVER1029p.F1037Cc.3110T>GMissense_Mutation10.55JHH2N100Y
NF1LSFCQEMKCLIVER1029p.F1037Cc.3110T>GMissense_Mutation10.55JHH6N100Y
NF1MKCRNKMVELIVER1035p.F1037Cc.3110T>GMissense_Mutation10.55JHH2N008N
NF1MKCRNKMVELIVER1035p.F1037Cc.3110T>GMissense_Mutation10.55JHH6N008N
NF1QEMKCRNKMLIVER1033p.F1037Cc.3110T>GMissense_Mutation10.55JHH2N600N
NF1QEMKCRNKMLIVER1033p.F1037Cc.3110T>GMissense_Mutation10.55JHH6N600N
NF1SFCQEMKCRLIVER1030p.F1037Cc.3110T>GMissense_Mutation10.55JHH2N200N
NF1SFCQEMKCRLIVER1030p.F1037Cc.3110T>GMissense_Mutation10.55JHH6N200N
NF1CREMKFRNKLIVER1032p.Q1033Rc.3098A>GMissense_Mutation10.66JHH2N300N
NF1CREMKFRNKLIVER1032p.Q1033Rc.3098A>GMissense_Mutation10.66JHH6N300N
NF1DDLSFCREMLIVER1027p.Q1033Rc.3098A>GMissense_Mutation10.66JHH2Y590N
NF1DDLSFCREMLIVER1027p.Q1033Rc.3098A>GMissense_Mutation10.66JHH6Y590N
NF1DLSFCREMKLIVER1028p.Q1033Rc.3098A>GMissense_Mutation10.66JHH2Y3120N
NF1DLSFCREMKLIVER1028p.Q1033Rc.3098A>GMissense_Mutation10.66JHH6Y3120N
NF1FCREMKFRNLIVER1031p.Q1033Rc.3098A>GMissense_Mutation10.66JHH2N300N
NF1FCREMKFRNLIVER1031p.Q1033Rc.3098A>GMissense_Mutation10.66JHH6N300N
NF1LSFCREMKFLIVER1029p.Q1033Rc.3098A>GMissense_Mutation10.66JHH2Y1090N
NF1LSFCREMKFLIVER1029p.Q1033Rc.3098A>GMissense_Mutation10.66JHH6Y1090N
NF1RDDLSFCRELIVER1026p.Q1033Rc.3098A>GMissense_Mutation10.66JHH2N000N
NF1RDDLSFCRELIVER1026p.Q1033Rc.3098A>GMissense_Mutation10.66JHH6N000N
NF1REMKFRNKMLIVER1033p.Q1033Rc.3098A>GMissense_Mutation10.66JHH2Y890N
NF1REMKFRNKMLIVER1033p.Q1033Rc.3098A>GMissense_Mutation10.66JHH6Y890N
NF1RRDDLSFCRLIVER1025p.Q1033Rc.3098A>GMissense_Mutation10.66JHH2N400N
NF1RRDDLSFCRLIVER1025p.Q1033Rc.3098A>GMissense_Mutation10.66JHH6N400N
NF1SFCREMKFRLIVER1030p.Q1033Rc.3098A>GMissense_Mutation10.66JHH2N200N
NF1SFCREMKFRLIVER1030p.Q1033Rc.3098A>GMissense_Mutation10.66JHH6N200N
NF2EIRNVSYSDLIVER260p.I264Vc.790A>GMissense_Mutation10.11SKHEP1N000Y
NF2FPWNEIRNVLIVER256p.I264Vc.790A>GMissense_Mutation10.11SKHEP1Y15100N
NF2IRNVSYSDKLIVER261p.I264Vc.790A>GMissense_Mutation10.11SKHEP1Y2104Y
NF2NEIRNVSYSLIVER259p.I264Vc.790A>GMissense_Mutation10.11SKHEP1N500N
NF2NVSYSDKEFLIVER263p.I264Vc.790A>GMissense_Mutation10.11SKHEP1N100Y
NF2PWNEIRNVSLIVER257p.I264Vc.790A>GMissense_Mutation10.11SKHEP1N000N
NF2RNVSYSDKELIVER262p.I264Vc.790A>GMissense_Mutation10.11SKHEP1N000Y
NF2VSYSDKEFTLIVER264p.I264Vc.790A>GMissense_Mutation10.11SKHEP1N100Y
NF2WNEIRNVSYLIVER258p.I264Vc.790A>GMissense_Mutation10.11SKHEP1N601N
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13ALEXANDERCELLSN101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13C3AN101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HEPG2N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13HLFN101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13HUH6N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HUH6N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HUH7N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13JHH1N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13JHH1N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13JHH2N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13JHH4N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13JHH5N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13JHH5N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13JHH6N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13LI7N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13NCIH684N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SKHEP1N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU182N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SNU387N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU398N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SNU398N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU423N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SNU423N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU449N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU475N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU761N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU878N101Y
NR1H2IRKQQQQQELIVER170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU886N101Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13ALEXANDERCELLSN000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13C3AN000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HEPG2N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13HLFN000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13HUH6N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HUH6N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HUH7N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13JHH1N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13JHH1N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13JHH2N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13JHH4N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13JHH5N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13JHH5N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13JHH6N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13LI7N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13NCIH684N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SKHEP1N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU182N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SNU387N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU398N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SNU398N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU423N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SNU423N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU449N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU475N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU761N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU878N000Y
NR1H2KIRKQQQQQLIVER169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU886N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13ALEXANDERCELLSN000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13C3AN000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HEPG2N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13HLFN000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13HUH6N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HUH6N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HUH7N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13JHH1N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13JHH1N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13JHH2N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13JHH4N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13JHH5N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13JHH5N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13JHH6N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13LI7N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13NCIH684N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SKHEP1N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU182N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SNU387N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU398N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SNU398N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU423N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SNU423N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU449N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU475N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU761N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU878N000Y
NR1H2KQQQQQESQLIVER172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU886N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13ALEXANDERCELLSN000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13C3AN000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HEPG2N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13HLFN000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13HUH6N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HUH6N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HUH7N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13JHH1N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13JHH1N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13JHH2N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13JHH4N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13JHH5N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13JHH5N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13JHH6N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13LI7N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13NCIH684N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SKHEP1N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU182N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SNU387N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU398N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SNU398N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU423N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SNU423N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU449N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU475N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU761N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU878N000Y
NR1H2QQQQQESQSLIVER173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU886N000Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13ALEXANDERCELLSN100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13C3AN100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13HEPG2N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13HLFN100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13HUH6N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13HUH6N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13HUH7N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13JHH1N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13JHH1N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13JHH2N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13JHH4N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13JHH5N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13JHH5N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13JHH6N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13LI7N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13NCIH684N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SKHEP1N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SNU182N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13SNU387N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SNU398N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13SNU398N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SNU423N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13SNU423N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SNU449N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SNU475N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SNU761N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SNU878N100Y
NR1H2RKQQQQQESLIVER171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SNU886N100Y
NRASAGLEEYSAMLIVER59p.Q61Lc.182A>TMissense_Mutation11.11C3AY1090N
NRASAGLEEYSAMLIVER59p.Q61Lc.182A>TMissense_Mutation11.11HEPG2Y1090N
NRASDILDTAGLELIVER54p.Q61Lc.182A>TMissense_Mutation11.11C3AN000N
NRASDILDTAGLELIVER54p.Q61Lc.182A>TMissense_Mutation11.11HEPG2N000N
NRASDTAGLEEYSLIVER57p.Q61Lc.182A>TMissense_Mutation11.11C3AN000N
NRASDTAGLEEYSLIVER57p.Q61Lc.182A>TMissense_Mutation11.11HEPG2N000N
NRASGLEEYSAMRLIVER60p.Q61Lc.182A>TMissense_Mutation11.11C3AN800N
NRASGLEEYSAMRLIVER60p.Q61Lc.182A>TMissense_Mutation11.11HEPG2N800N
NRASILDTAGLEELIVER55p.Q61Lc.182A>TMissense_Mutation11.11C3AN000N
NRASILDTAGLEELIVER55p.Q61Lc.182A>TMissense_Mutation11.11HEPG2N000N
NRASLDILDTAGLLIVER53p.Q61Lc.182A>TMissense_Mutation11.11C3AN804N
NRASLDILDTAGLLIVER53p.Q61Lc.182A>TMissense_Mutation11.11HEPG2N804N
NRASLDTAGLEEYLIVER56p.Q61Lc.182A>TMissense_Mutation11.11C3AN400N
NRASLDTAGLEEYLIVER56p.Q61Lc.182A>TMissense_Mutation11.11HEPG2N400N
NRASLEEYSAMRDLIVER61p.Q61Lc.182A>TMissense_Mutation11.11C3AN000N
NRASLEEYSAMRDLIVER61p.Q61Lc.182A>TMissense_Mutation11.11HEPG2N000N
NRASTAGLEEYSALIVER58p.Q61Lc.182A>TMissense_Mutation11.11C3AN200N
NRASTAGLEEYSALIVER58p.Q61Lc.182A>TMissense_Mutation11.11HEPG2N200N
NRASAGKEEYSAMLIVER59p.Q61Kc.181C>AMissense_Mutation11.66SNU387Y6100N
NRASDILDTAGKELIVER54p.Q61Kc.181C>AMissense_Mutation11.66SNU387N000N
NRASDTAGKEEYSLIVER57p.Q61Kc.181C>AMissense_Mutation11.66SNU387N000N
NRASGKEEYSAMRLIVER60p.Q61Kc.181C>AMissense_Mutation11.66SNU387N200N
NRASILDTAGKEELIVER55p.Q61Kc.181C>AMissense_Mutation11.66SNU387N000N
NRASKEEYSAMRDLIVER61p.Q61Kc.181C>AMissense_Mutation11.66SNU387N000N
NRASLDILDTAGKLIVER53p.Q61Kc.181C>AMissense_Mutation11.66SNU387N006N
NRASLDTAGKEEYLIVER56p.Q61Kc.181C>AMissense_Mutation11.66SNU387N500N
NRASTAGKEEYSALIVER58p.Q61Kc.181C>AMissense_Mutation11.66SNU387N300N
PDE4DIPANLDQGRVRLIVER603p.L601fsc.1801_1801delCFrame_Shift_Del615.49HUH6Y2110N
PDE4DIPANLDQGRVRLIVER603p.L601fsc.1801_1801delCFrame_Shift_Del615.49JHH4Y2110N
PDE4DIPANLDQGRVRLIVER603p.L601fsc.1801_1801delCFrame_Shift_Del615.49JHH5Y2110N
PDE4DIPANLDQGRVRLIVER603p.L601fsc.1801_1801delCFrame_Shift_Del615.49JHH7Y2110N
PDE4DIPANLDQGRVRLIVER603p.L601fsc.1801_1801delCFrame_Shift_Del615.49LI7Y2110N
PDE4DIPANLDQGRVRLIVER603p.L601fsc.1801_1801delCFrame_Shift_Del615.49SNU387Y2110N
PDE4DIPANLDQGRVRLIVER603p.L601fsc.1801_1801delCFrame_Shift_Del615.49SNU423Y2110N
PDE4DIPANLDQGRVRLIVER603p.L601fsc.1801_1801delCFrame_Shift_Del615.49SNU475Y2110N
PDE4DIPANLDQGRVRLIVER603p.L601fsc.1801_1801delCFrame_Shift_Del615.49SNU878Y2110N
PDE4DIPATCSANLDQLIVER599p.L601fsc.1801_1801delCFrame_Shift_Del615.49HUH6N000N
PDE4DIPATCSANLDQLIVER599p.L601fsc.1801_1801delCFrame_Shift_Del615.49JHH4N000N
PDE4DIPATCSANLDQLIVER599p.L601fsc.1801_1801delCFrame_Shift_Del615.49JHH5N000N
PDE4DIPATCSANLDQLIVER599p.L601fsc.1801_1801delCFrame_Shift_Del615.49JHH7N000N
PDE4DIPATCSANLDQLIVER599p.L601fsc.1801_1801delCFrame_Shift_Del615.49LI7N000N
PDE4DIPATCSANLDQLIVER599p.L601fsc.1801_1801delCFrame_Shift_Del615.49SNU387N000N
PDE4DIPATCSANLDQLIVER599p.L601fsc.1801_1801delCFrame_Shift_Del615.49SNU423N000N
PDE4DIPATCSANLDQLIVER599p.L601fsc.1801_1801delCFrame_Shift_Del615.49SNU475N000N
PDE4DIPATCSANLDQLIVER599p.L601fsc.1801_1801delCFrame_Shift_Del615.49SNU878N000N
PDE4DIPCSANLDQGRLIVER601p.L601fsc.1801_1801delCFrame_Shift_Del515.49HUH6N300N
PDE4DIPCSANLDQGRLIVER601p.L601fsc.1801_1801delCFrame_Shift_Del515.49JHH4N300N
PDE4DIPCSANLDQGRLIVER601p.L601fsc.1801_1801delCFrame_Shift_Del515.49JHH5N300N
PDE4DIPCSANLDQGRLIVER601p.L601fsc.1801_1801delCFrame_Shift_Del515.49JHH7N300N
PDE4DIPCSANLDQGRLIVER601p.L601fsc.1801_1801delCFrame_Shift_Del515.49LI7N300N
PDE4DIPCSANLDQGRLIVER601p.L601fsc.1801_1801delCFrame_Shift_Del515.49SNU387N300N
PDE4DIPCSANLDQGRLIVER601p.L601fsc.1801_1801delCFrame_Shift_Del515.49SNU423N300N
PDE4DIPCSANLDQGRLIVER601p.L601fsc.1801_1801delCFrame_Shift_Del515.49SNU475N300N
PDE4DIPCSANLDQGRLIVER601p.L601fsc.1801_1801delCFrame_Shift_Del515.49SNU878N300N
PDE4DIPDLSATCSANLIVER596p.L601fsc.1801_1801delCFrame_Shift_Del415.49HUH6N000N
PDE4DIPDLSATCSANLIVER596p.L601fsc.1801_1801delCFrame_Shift_Del415.49JHH4N000N
PDE4DIPDLSATCSANLIVER596p.L601fsc.1801_1801delCFrame_Shift_Del415.49JHH5N000N
PDE4DIPDLSATCSANLIVER596p.L601fsc.1801_1801delCFrame_Shift_Del415.49JHH7N000N
PDE4DIPDLSATCSANLIVER596p.L601fsc.1801_1801delCFrame_Shift_Del415.49LI7N000N
PDE4DIPDLSATCSANLIVER596p.L601fsc.1801_1801delCFrame_Shift_Del415.49SNU387N000N
PDE4DIPDLSATCSANLIVER596p.L601fsc.1801_1801delCFrame_Shift_Del415.49SNU423N000N
PDE4DIPDLSATCSANLIVER596p.L601fsc.1801_1801delCFrame_Shift_Del415.49SNU475N000N
PDE4DIPDLSATCSANLIVER596p.L601fsc.1801_1801delCFrame_Shift_Del415.49SNU878N000N
PDE4DIPEDLSATCSALIVER595p.L601fsc.1801_1801delCFrame_Shift_Del315.49HUH6N400N
PDE4DIPEDLSATCSALIVER595p.L601fsc.1801_1801delCFrame_Shift_Del315.49JHH4N400N
PDE4DIPEDLSATCSALIVER595p.L601fsc.1801_1801delCFrame_Shift_Del315.49JHH5N400N
PDE4DIPEDLSATCSALIVER595p.L601fsc.1801_1801delCFrame_Shift_Del315.49JHH7N400N
PDE4DIPEDLSATCSALIVER595p.L601fsc.1801_1801delCFrame_Shift_Del315.49LI7N400N
PDE4DIPEDLSATCSALIVER595p.L601fsc.1801_1801delCFrame_Shift_Del315.49SNU387N400N
PDE4DIPEDLSATCSALIVER595p.L601fsc.1801_1801delCFrame_Shift_Del315.49SNU423N400N
PDE4DIPEDLSATCSALIVER595p.L601fsc.1801_1801delCFrame_Shift_Del315.49SNU475N400N
PDE4DIPEDLSATCSALIVER595p.L601fsc.1801_1801delCFrame_Shift_Del315.49SNU878N400N
PDE4DIPEVEDLSATCLIVER593p.L601fsc.1801_1801delCFrame_Shift_Del115.49HUH6N200N
PDE4DIPEVEDLSATCLIVER593p.L601fsc.1801_1801delCFrame_Shift_Del115.49JHH4N200N
PDE4DIPEVEDLSATCLIVER593p.L601fsc.1801_1801delCFrame_Shift_Del115.49JHH5N200N
PDE4DIPEVEDLSATCLIVER593p.L601fsc.1801_1801delCFrame_Shift_Del115.49JHH7N200N
PDE4DIPEVEDLSATCLIVER593p.L601fsc.1801_1801delCFrame_Shift_Del115.49LI7N200N
PDE4DIPEVEDLSATCLIVER593p.L601fsc.1801_1801delCFrame_Shift_Del115.49SNU387N200N
PDE4DIPEVEDLSATCLIVER593p.L601fsc.1801_1801delCFrame_Shift_Del115.49SNU423N200N
PDE4DIPEVEDLSATCLIVER593p.L601fsc.1801_1801delCFrame_Shift_Del115.49SNU475N200N
PDE4DIPEVEDLSATCLIVER593p.L601fsc.1801_1801delCFrame_Shift_Del115.49SNU878N200N
PDE4DIPLSATCSANLLIVER597p.L601fsc.1801_1801delCFrame_Shift_Del415.49HUH6N1102N
PDE4DIPLSATCSANLLIVER597p.L601fsc.1801_1801delCFrame_Shift_Del415.49JHH4N1102N
PDE4DIPLSATCSANLLIVER597p.L601fsc.1801_1801delCFrame_Shift_Del415.49JHH5N1102N
PDE4DIPLSATCSANLLIVER597p.L601fsc.1801_1801delCFrame_Shift_Del415.49JHH7N1102N
PDE4DIPLSATCSANLLIVER597p.L601fsc.1801_1801delCFrame_Shift_Del415.49LI7N1102N
PDE4DIPLSATCSANLLIVER597p.L601fsc.1801_1801delCFrame_Shift_Del415.49SNU387N1102N
PDE4DIPLSATCSANLLIVER597p.L601fsc.1801_1801delCFrame_Shift_Del415.49SNU423N1102N
PDE4DIPLSATCSANLLIVER597p.L601fsc.1801_1801delCFrame_Shift_Del415.49SNU475N1102N
PDE4DIPLSATCSANLLIVER597p.L601fsc.1801_1801delCFrame_Shift_Del415.49SNU878N1102N
PDE4DIPSANLDQGRVLIVER602p.L601fsc.1801_1801delCFrame_Shift_Del515.49HUH6N400N
PDE4DIPSANLDQGRVLIVER602p.L601fsc.1801_1801delCFrame_Shift_Del515.49JHH4N400N
PDE4DIPSANLDQGRVLIVER602p.L601fsc.1801_1801delCFrame_Shift_Del515.49JHH5N400N
PDE4DIPSANLDQGRVLIVER602p.L601fsc.1801_1801delCFrame_Shift_Del515.49JHH7N400N
PDE4DIPSANLDQGRVLIVER602p.L601fsc.1801_1801delCFrame_Shift_Del515.49LI7N400N
PDE4DIPSANLDQGRVLIVER602p.L601fsc.1801_1801delCFrame_Shift_Del515.49SNU387N400N
PDE4DIPSANLDQGRVLIVER602p.L601fsc.1801_1801delCFrame_Shift_Del515.49SNU423N400N
PDE4DIPSANLDQGRVLIVER602p.L601fsc.1801_1801delCFrame_Shift_Del515.49SNU475N400N
PDE4DIPSANLDQGRVLIVER602p.L601fsc.1801_1801delCFrame_Shift_Del515.49SNU878N400N
PDE4DIPSATCSANLDLIVER598p.L601fsc.1801_1801delCFrame_Shift_Del515.49HUH6N000N
PDE4DIPSATCSANLDLIVER598p.L601fsc.1801_1801delCFrame_Shift_Del515.49JHH4N000N
PDE4DIPSATCSANLDLIVER598p.L601fsc.1801_1801delCFrame_Shift_Del515.49JHH5N000N
PDE4DIPSATCSANLDLIVER598p.L601fsc.1801_1801delCFrame_Shift_Del515.49JHH7N000N
PDE4DIPSATCSANLDLIVER598p.L601fsc.1801_1801delCFrame_Shift_Del515.49LI7N000N
PDE4DIPSATCSANLDLIVER598p.L601fsc.1801_1801delCFrame_Shift_Del515.49SNU387N000N
PDE4DIPSATCSANLDLIVER598p.L601fsc.1801_1801delCFrame_Shift_Del515.49SNU423N000N
PDE4DIPSATCSANLDLIVER598p.L601fsc.1801_1801delCFrame_Shift_Del515.49SNU475N000N
PDE4DIPSATCSANLDLIVER598p.L601fsc.1801_1801delCFrame_Shift_Del515.49SNU878N000N
PDE4DIPTCSANLDQGLIVER600p.L601fsc.1801_1801delCFrame_Shift_Del615.49HUH6N100N
PDE4DIPTCSANLDQGLIVER600p.L601fsc.1801_1801delCFrame_Shift_Del615.49JHH4N100N
PDE4DIPTCSANLDQGLIVER600p.L601fsc.1801_1801delCFrame_Shift_Del615.49JHH5N100N
PDE4DIPTCSANLDQGLIVER600p.L601fsc.1801_1801delCFrame_Shift_Del615.49JHH7N100N
PDE4DIPTCSANLDQGLIVER600p.L601fsc.1801_1801delCFrame_Shift_Del615.49LI7N100N
PDE4DIPTCSANLDQGLIVER600p.L601fsc.1801_1801delCFrame_Shift_Del615.49SNU387N100N
PDE4DIPTCSANLDQGLIVER600p.L601fsc.1801_1801delCFrame_Shift_Del615.49SNU423N100N
PDE4DIPTCSANLDQGLIVER600p.L601fsc.1801_1801delCFrame_Shift_Del615.49SNU475N100N
PDE4DIPTCSANLDQGLIVER600p.L601fsc.1801_1801delCFrame_Shift_Del615.49SNU878N100N
PDE4DIPVEDLSATCSLIVER594p.L601fsc.1801_1801delCFrame_Shift_Del215.49HUH6N300N
PDE4DIPVEDLSATCSLIVER594p.L601fsc.1801_1801delCFrame_Shift_Del215.49JHH4N300N
PDE4DIPVEDLSATCSLIVER594p.L601fsc.1801_1801delCFrame_Shift_Del215.49JHH5N300N
PDE4DIPVEDLSATCSLIVER594p.L601fsc.1801_1801delCFrame_Shift_Del215.49JHH7N300N
PDE4DIPVEDLSATCSLIVER594p.L601fsc.1801_1801delCFrame_Shift_Del215.49LI7N300N
PDE4DIPVEDLSATCSLIVER594p.L601fsc.1801_1801delCFrame_Shift_Del215.49SNU387N300N
PDE4DIPVEDLSATCSLIVER594p.L601fsc.1801_1801delCFrame_Shift_Del215.49SNU423N300N
PDE4DIPVEDLSATCSLIVER594p.L601fsc.1801_1801delCFrame_Shift_Del215.49SNU475N300N
PDE4DIPVEDLSATCSLIVER594p.L601fsc.1801_1801delCFrame_Shift_Del215.49SNU878N300N
PDE4DIPADSRKKSSKLIVER242p.E243fsc.729_729delAFrame_Shift_Del517.59HUH6N000Y
PDE4DIPADSRKKSSKLIVER242p.E243fsc.729_729delAFrame_Shift_Del517.59JHH1N000Y
PDE4DIPADSRKKSSKLIVER242p.E243fsc.729_729delAFrame_Shift_Del517.59JHH4N000Y
PDE4DIPADSRKKSSKLIVER242p.E243fsc.729_729delAFrame_Shift_Del517.59JHH5N000Y
PDE4DIPADSRKKSSKLIVER242p.E243fsc.729_729delAFrame_Shift_Del517.59JHH7N000Y
PDE4DIPADSRKKSSKLIVER242p.E243fsc.729_729delAFrame_Shift_Del517.59LI7N000Y
PDE4DIPADSRKKSSKLIVER242p.E243fsc.729_729delAFrame_Shift_Del517.59SNU387N000Y
PDE4DIPADSRKKSSKLIVER242p.E243fsc.729_729delAFrame_Shift_Del517.59SNU423N000Y
PDE4DIPADSRKKSSKLIVER242p.E243fsc.729_729delAFrame_Shift_Del517.59SNU475N000Y
PDE4DIPADSRKKSSKLIVER242p.E243fsc.729_729delAFrame_Shift_Del517.59SNU878N000Y
PDE4DIPDSHLADSRKLIVER238p.E243fsc.729_729delAFrame_Shift_Del417.59HUH6N200N
PDE4DIPDSHLADSRKLIVER238p.E243fsc.729_729delAFrame_Shift_Del417.59JHH1N200N
PDE4DIPDSHLADSRKLIVER238p.E243fsc.729_729delAFrame_Shift_Del417.59JHH4N200N
PDE4DIPDSHLADSRKLIVER238p.E243fsc.729_729delAFrame_Shift_Del417.59JHH5N200N
PDE4DIPDSHLADSRKLIVER238p.E243fsc.729_729delAFrame_Shift_Del417.59JHH7N200N
PDE4DIPDSHLADSRKLIVER238p.E243fsc.729_729delAFrame_Shift_Del417.59LI7N200N
PDE4DIPDSHLADSRKLIVER238p.E243fsc.729_729delAFrame_Shift_Del417.59SNU387N200N
PDE4DIPDSHLADSRKLIVER238p.E243fsc.729_729delAFrame_Shift_Del417.59SNU423N200N
PDE4DIPDSHLADSRKLIVER238p.E243fsc.729_729delAFrame_Shift_Del417.59SNU475N200N
PDE4DIPDSHLADSRKLIVER238p.E243fsc.729_729delAFrame_Shift_Del417.59SNU878N200N
PDE4DIPDSRKKSSKQLIVER243p.E243fsc.729_729delAFrame_Shift_Del417.59HUH6N200Y
PDE4DIPDSRKKSSKQLIVER243p.E243fsc.729_729delAFrame_Shift_Del417.59JHH1N200Y
PDE4DIPDSRKKSSKQLIVER243p.E243fsc.729_729delAFrame_Shift_Del417.59JHH4N200Y
PDE4DIPDSRKKSSKQLIVER243p.E243fsc.729_729delAFrame_Shift_Del417.59JHH5N200Y
PDE4DIPDSRKKSSKQLIVER243p.E243fsc.729_729delAFrame_Shift_Del417.59JHH7N200Y
PDE4DIPDSRKKSSKQLIVER243p.E243fsc.729_729delAFrame_Shift_Del417.59LI7N200Y
PDE4DIPDSRKKSSKQLIVER243p.E243fsc.729_729delAFrame_Shift_Del417.59SNU387N200Y
PDE4DIPDSRKKSSKQLIVER243p.E243fsc.729_729delAFrame_Shift_Del417.59SNU423N200Y
PDE4DIPDSRKKSSKQLIVER243p.E243fsc.729_729delAFrame_Shift_Del417.59SNU475N200Y
PDE4DIPDSRKKSSKQLIVER243p.E243fsc.729_729delAFrame_Shift_Del417.59SNU878N200Y
PDE4DIPHLADSRKKSLIVER240p.E243fsc.729_729delAFrame_Shift_Del517.59HUH6N000N
PDE4DIPHLADSRKKSLIVER240p.E243fsc.729_729delAFrame_Shift_Del517.59JHH1N000N
PDE4DIPHLADSRKKSLIVER240p.E243fsc.729_729delAFrame_Shift_Del517.59JHH4N000N
PDE4DIPHLADSRKKSLIVER240p.E243fsc.729_729delAFrame_Shift_Del517.59JHH5N000N
PDE4DIPHLADSRKKSLIVER240p.E243fsc.729_729delAFrame_Shift_Del517.59JHH7N000N
PDE4DIPHLADSRKKSLIVER240p.E243fsc.729_729delAFrame_Shift_Del517.59LI7N000N
PDE4DIPHLADSRKKSLIVER240p.E243fsc.729_729delAFrame_Shift_Del517.59SNU387N000N
PDE4DIPHLADSRKKSLIVER240p.E243fsc.729_729delAFrame_Shift_Del517.59SNU423N000N
PDE4DIPHLADSRKKSLIVER240p.E243fsc.729_729delAFrame_Shift_Del517.59SNU475N000N
PDE4DIPHLADSRKKSLIVER240p.E243fsc.729_729delAFrame_Shift_Del517.59SNU878N000N
PDE4DIPKKSSKQRPPLIVER246p.E243fsc.729_729delAFrame_Shift_Del517.59HUH6N100Y
PDE4DIPKKSSKQRPPLIVER246p.E243fsc.729_729delAFrame_Shift_Del517.59JHH1N100Y
PDE4DIPKKSSKQRPPLIVER246p.E243fsc.729_729delAFrame_Shift_Del517.59JHH4N100Y
PDE4DIPKKSSKQRPPLIVER246p.E243fsc.729_729delAFrame_Shift_Del517.59JHH5N100Y
PDE4DIPKKSSKQRPPLIVER246p.E243fsc.729_729delAFrame_Shift_Del517.59JHH7N100Y
PDE4DIPKKSSKQRPPLIVER246p.E243fsc.729_729delAFrame_Shift_Del517.59LI7N100Y
PDE4DIPKKSSKQRPPLIVER246p.E243fsc.729_729delAFrame_Shift_Del517.59SNU387N100Y
PDE4DIPKKSSKQRPPLIVER246p.E243fsc.729_729delAFrame_Shift_Del517.59SNU423N100Y
PDE4DIPKKSSKQRPPLIVER246p.E243fsc.729_729delAFrame_Shift_Del517.59SNU475N100Y
PDE4DIPKKSSKQRPPLIVER246p.E243fsc.729_729delAFrame_Shift_Del517.59SNU878N100Y
PDE4DIPKQRPPTRFFLIVER250p.E243fsc.729_729delAFrame_Shift_Del617.59HUH6Y7100Y
PDE4DIPKQRPPTRFFLIVER250p.E243fsc.729_729delAFrame_Shift_Del617.59JHH1Y7100Y
PDE4DIPKQRPPTRFFLIVER250p.E243fsc.729_729delAFrame_Shift_Del617.59JHH4Y7100Y
PDE4DIPKQRPPTRFFLIVER250p.E243fsc.729_729delAFrame_Shift_Del617.59JHH5Y7100Y
PDE4DIPKQRPPTRFFLIVER250p.E243fsc.729_729delAFrame_Shift_Del617.59JHH7Y7100Y
PDE4DIPKQRPPTRFFLIVER250p.E243fsc.729_729delAFrame_Shift_Del617.59LI7Y7100Y
PDE4DIPKQRPPTRFFLIVER250p.E243fsc.729_729delAFrame_Shift_Del617.59SNU387Y7100Y
PDE4DIPKQRPPTRFFLIVER250p.E243fsc.729_729delAFrame_Shift_Del617.59SNU423Y7100Y
PDE4DIPKQRPPTRFFLIVER250p.E243fsc.729_729delAFrame_Shift_Del617.59SNU475Y7100Y
PDE4DIPKQRPPTRFFLIVER250p.E243fsc.729_729delAFrame_Shift_Del617.59SNU878Y7100Y
PDE4DIPKSSKQRPPTLIVER247p.E243fsc.729_729delAFrame_Shift_Del517.59HUH6N200Y
PDE4DIPKSSKQRPPTLIVER247p.E243fsc.729_729delAFrame_Shift_Del517.59JHH1N200Y
PDE4DIPKSSKQRPPTLIVER247p.E243fsc.729_729delAFrame_Shift_Del517.59JHH4N200Y
PDE4DIPKSSKQRPPTLIVER247p.E243fsc.729_729delAFrame_Shift_Del517.59JHH5N200Y
PDE4DIPKSSKQRPPTLIVER247p.E243fsc.729_729delAFrame_Shift_Del517.59JHH7N200Y
PDE4DIPKSSKQRPPTLIVER247p.E243fsc.729_729delAFrame_Shift_Del517.59LI7N200Y
PDE4DIPKSSKQRPPTLIVER247p.E243fsc.729_729delAFrame_Shift_Del517.59SNU387N200Y
PDE4DIPKSSKQRPPTLIVER247p.E243fsc.729_729delAFrame_Shift_Del517.59SNU423N200Y
PDE4DIPKSSKQRPPTLIVER247p.E243fsc.729_729delAFrame_Shift_Del517.59SNU475N200Y
PDE4DIPKSSKQRPPTLIVER247p.E243fsc.729_729delAFrame_Shift_Del517.59SNU878N200Y
PDE4DIPLADSRKKSSLIVER241p.E243fsc.729_729delAFrame_Shift_Del517.59HUH6N100N
PDE4DIPLADSRKKSSLIVER241p.E243fsc.729_729delAFrame_Shift_Del517.59JHH1N100N
PDE4DIPLADSRKKSSLIVER241p.E243fsc.729_729delAFrame_Shift_Del517.59JHH4N100N
PDE4DIPLADSRKKSSLIVER241p.E243fsc.729_729delAFrame_Shift_Del517.59JHH5N100N
PDE4DIPLADSRKKSSLIVER241p.E243fsc.729_729delAFrame_Shift_Del517.59JHH7N100N
PDE4DIPLADSRKKSSLIVER241p.E243fsc.729_729delAFrame_Shift_Del517.59LI7N100N
PDE4DIPLADSRKKSSLIVER241p.E243fsc.729_729delAFrame_Shift_Del517.59SNU387N100N
PDE4DIPLADSRKKSSLIVER241p.E243fsc.729_729delAFrame_Shift_Del517.59SNU423N100N
PDE4DIPLADSRKKSSLIVER241p.E243fsc.729_729delAFrame_Shift_Del517.59SNU475N100N
PDE4DIPLADSRKKSSLIVER241p.E243fsc.729_729delAFrame_Shift_Del517.59SNU878N100N
PDE4DIPPPTRFFKRNLIVER253p.E243fsc.729_729delAFrame_Shift_Del517.59HUH6N000Y
PDE4DIPPPTRFFKRNLIVER253p.E243fsc.729_729delAFrame_Shift_Del517.59JHH1N000Y
PDE4DIPPPTRFFKRNLIVER253p.E243fsc.729_729delAFrame_Shift_Del517.59JHH4N000Y
PDE4DIPPPTRFFKRNLIVER253p.E243fsc.729_729delAFrame_Shift_Del517.59JHH5N000Y
PDE4DIPPPTRFFKRNLIVER253p.E243fsc.729_729delAFrame_Shift_Del517.59JHH7N000Y
PDE4DIPPPTRFFKRNLIVER253p.E243fsc.729_729delAFrame_Shift_Del517.59LI7N000Y
PDE4DIPPPTRFFKRNLIVER253p.E243fsc.729_729delAFrame_Shift_Del517.59SNU387N000Y
PDE4DIPPPTRFFKRNLIVER253p.E243fsc.729_729delAFrame_Shift_Del517.59SNU423N000Y
PDE4DIPPPTRFFKRNLIVER253p.E243fsc.729_729delAFrame_Shift_Del517.59SNU475N000Y
PDE4DIPPPTRFFKRNLIVER253p.E243fsc.729_729delAFrame_Shift_Del517.59SNU878N000Y
PDE4DIPPTRFFKRNLLIVER254p.E243fsc.729_729delAFrame_Shift_Del617.59HUH6Y2110Y
PDE4DIPPTRFFKRNLLIVER254p.E243fsc.729_729delAFrame_Shift_Del617.59JHH1Y2110Y
PDE4DIPPTRFFKRNLLIVER254p.E243fsc.729_729delAFrame_Shift_Del617.59JHH4Y2110Y
PDE4DIPPTRFFKRNLLIVER254p.E243fsc.729_729delAFrame_Shift_Del617.59JHH5Y2110Y
PDE4DIPPTRFFKRNLLIVER254p.E243fsc.729_729delAFrame_Shift_Del617.59JHH7Y2110Y
PDE4DIPPTRFFKRNLLIVER254p.E243fsc.729_729delAFrame_Shift_Del617.59LI7Y2110Y
PDE4DIPPTRFFKRNLLIVER254p.E243fsc.729_729delAFrame_Shift_Del617.59SNU387Y2110Y
PDE4DIPPTRFFKRNLLIVER254p.E243fsc.729_729delAFrame_Shift_Del617.59SNU423Y2110Y
PDE4DIPPTRFFKRNLLIVER254p.E243fsc.729_729delAFrame_Shift_Del617.59SNU475Y2110Y
PDE4DIPPTRFFKRNLLIVER254p.E243fsc.729_729delAFrame_Shift_Del617.59SNU878Y2110Y
PDE4DIPQRPPTRFFKLIVER251p.E243fsc.729_729delAFrame_Shift_Del617.59HUH6Y2100Y
PDE4DIPQRPPTRFFKLIVER251p.E243fsc.729_729delAFrame_Shift_Del617.59JHH1Y2100Y
PDE4DIPQRPPTRFFKLIVER251p.E243fsc.729_729delAFrame_Shift_Del617.59JHH4Y2100Y
PDE4DIPQRPPTRFFKLIVER251p.E243fsc.729_729delAFrame_Shift_Del617.59JHH5Y2100Y
PDE4DIPQRPPTRFFKLIVER251p.E243fsc.729_729delAFrame_Shift_Del617.59JHH7Y2100Y
PDE4DIPQRPPTRFFKLIVER251p.E243fsc.729_729delAFrame_Shift_Del617.59LI7Y2100Y
PDE4DIPQRPPTRFFKLIVER251p.E243fsc.729_729delAFrame_Shift_Del617.59SNU387Y2100Y
PDE4DIPQRPPTRFFKLIVER251p.E243fsc.729_729delAFrame_Shift_Del617.59SNU423Y2100Y
PDE4DIPQRPPTRFFKLIVER251p.E243fsc.729_729delAFrame_Shift_Del617.59SNU475Y2100Y
PDE4DIPQRPPTRFFKLIVER251p.E243fsc.729_729delAFrame_Shift_Del617.59SNU878Y2100Y
PDE4DIPRFFKRNLMKLIVER256p.E243fsc.729_729delAFrame_Shift_Del617.59HUH6Y2130N
PDE4DIPRFFKRNLMKLIVER256p.E243fsc.729_729delAFrame_Shift_Del617.59JHH1Y2130N
PDE4DIPRFFKRNLMKLIVER256p.E243fsc.729_729delAFrame_Shift_Del617.59JHH4Y2130N
PDE4DIPRFFKRNLMKLIVER256p.E243fsc.729_729delAFrame_Shift_Del617.59JHH5Y2130N
PDE4DIPRFFKRNLMKLIVER256p.E243fsc.729_729delAFrame_Shift_Del617.59JHH7Y2130N
PDE4DIPRFFKRNLMKLIVER256p.E243fsc.729_729delAFrame_Shift_Del617.59LI7Y2130N
PDE4DIPRFFKRNLMKLIVER256p.E243fsc.729_729delAFrame_Shift_Del617.59SNU387Y2130N
PDE4DIPRFFKRNLMKLIVER256p.E243fsc.729_729delAFrame_Shift_Del617.59SNU423Y2130N
PDE4DIPRFFKRNLMKLIVER256p.E243fsc.729_729delAFrame_Shift_Del617.59SNU475Y2130N
PDE4DIPRFFKRNLMKLIVER256p.E243fsc.729_729delAFrame_Shift_Del617.59SNU878Y2130N
PDE4DIPRKKSSKQRPLIVER245p.E243fsc.729_729delAFrame_Shift_Del417.59HUH6N100Y
PDE4DIPRKKSSKQRPLIVER245p.E243fsc.729_729delAFrame_Shift_Del417.59JHH1N100Y
PDE4DIPRKKSSKQRPLIVER245p.E243fsc.729_729delAFrame_Shift_Del417.59JHH4N100Y
PDE4DIPRKKSSKQRPLIVER245p.E243fsc.729_729delAFrame_Shift_Del417.59JHH5N100Y
PDE4DIPRKKSSKQRPLIVER245p.E243fsc.729_729delAFrame_Shift_Del417.59JHH7N100Y
PDE4DIPRKKSSKQRPLIVER245p.E243fsc.729_729delAFrame_Shift_Del417.59LI7N100Y
PDE4DIPRKKSSKQRPLIVER245p.E243fsc.729_729delAFrame_Shift_Del417.59SNU387N100Y
PDE4DIPRKKSSKQRPLIVER245p.E243fsc.729_729delAFrame_Shift_Del417.59SNU423N100Y
PDE4DIPRKKSSKQRPLIVER245p.E243fsc.729_729delAFrame_Shift_Del417.59SNU475N100Y
PDE4DIPRKKSSKQRPLIVER245p.E243fsc.729_729delAFrame_Shift_Del417.59SNU878N100Y
PDE4DIPRPPTRFFKRLIVER252p.E243fsc.729_729delAFrame_Shift_Del617.59HUH6Y590Y
PDE4DIPRPPTRFFKRLIVER252p.E243fsc.729_729delAFrame_Shift_Del617.59JHH1Y590Y
PDE4DIPRPPTRFFKRLIVER252p.E243fsc.729_729delAFrame_Shift_Del617.59JHH4Y590Y
PDE4DIPRPPTRFFKRLIVER252p.E243fsc.729_729delAFrame_Shift_Del617.59JHH5Y590Y
PDE4DIPRPPTRFFKRLIVER252p.E243fsc.729_729delAFrame_Shift_Del617.59JHH7Y590Y
PDE4DIPRPPTRFFKRLIVER252p.E243fsc.729_729delAFrame_Shift_Del617.59LI7Y590Y
PDE4DIPRPPTRFFKRLIVER252p.E243fsc.729_729delAFrame_Shift_Del617.59SNU387Y590Y
PDE4DIPRPPTRFFKRLIVER252p.E243fsc.729_729delAFrame_Shift_Del617.59SNU423Y590Y
PDE4DIPRPPTRFFKRLIVER252p.E243fsc.729_729delAFrame_Shift_Del617.59SNU475Y590Y
PDE4DIPRPPTRFFKRLIVER252p.E243fsc.729_729delAFrame_Shift_Del617.59SNU878Y590Y
PDE4DIPSDSHLADSRLIVER237p.E243fsc.729_729delAFrame_Shift_Del317.59HUH6N000N
PDE4DIPSDSHLADSRLIVER237p.E243fsc.729_729delAFrame_Shift_Del317.59JHH1N000N
PDE4DIPSDSHLADSRLIVER237p.E243fsc.729_729delAFrame_Shift_Del317.59JHH4N000N
PDE4DIPSDSHLADSRLIVER237p.E243fsc.729_729delAFrame_Shift_Del317.59JHH5N000N
PDE4DIPSDSHLADSRLIVER237p.E243fsc.729_729delAFrame_Shift_Del317.59JHH7N000N
PDE4DIPSDSHLADSRLIVER237p.E243fsc.729_729delAFrame_Shift_Del317.59LI7N000N
PDE4DIPSDSHLADSRLIVER237p.E243fsc.729_729delAFrame_Shift_Del317.59SNU387N000N
PDE4DIPSDSHLADSRLIVER237p.E243fsc.729_729delAFrame_Shift_Del317.59SNU423N000N
PDE4DIPSDSHLADSRLIVER237p.E243fsc.729_729delAFrame_Shift_Del317.59SNU475N000N
PDE4DIPSDSHLADSRLIVER237p.E243fsc.729_729delAFrame_Shift_Del317.59SNU878N000N
PDE4DIPSHLADSRKKLIVER239p.E243fsc.729_729delAFrame_Shift_Del417.59HUH6N000N
PDE4DIPSHLADSRKKLIVER239p.E243fsc.729_729delAFrame_Shift_Del417.59JHH1N000N
PDE4DIPSHLADSRKKLIVER239p.E243fsc.729_729delAFrame_Shift_Del417.59JHH4N000N
PDE4DIPSHLADSRKKLIVER239p.E243fsc.729_729delAFrame_Shift_Del417.59JHH5N000N
PDE4DIPSHLADSRKKLIVER239p.E243fsc.729_729delAFrame_Shift_Del417.59JHH7N000N
PDE4DIPSHLADSRKKLIVER239p.E243fsc.729_729delAFrame_Shift_Del417.59LI7N000N
PDE4DIPSHLADSRKKLIVER239p.E243fsc.729_729delAFrame_Shift_Del417.59SNU387N000N
PDE4DIPSHLADSRKKLIVER239p.E243fsc.729_729delAFrame_Shift_Del417.59SNU423N000N
PDE4DIPSHLADSRKKLIVER239p.E243fsc.729_729delAFrame_Shift_Del417.59SNU475N000N
PDE4DIPSHLADSRKKLIVER239p.E243fsc.729_729delAFrame_Shift_Del417.59SNU878N000N
PDE4DIPSKQRPPTRFLIVER249p.E243fsc.729_729delAFrame_Shift_Del517.59HUH6N200Y
PDE4DIPSKQRPPTRFLIVER249p.E243fsc.729_729delAFrame_Shift_Del517.59JHH1N200Y
PDE4DIPSKQRPPTRFLIVER249p.E243fsc.729_729delAFrame_Shift_Del517.59JHH4N200Y
PDE4DIPSKQRPPTRFLIVER249p.E243fsc.729_729delAFrame_Shift_Del517.59JHH5N200Y
PDE4DIPSKQRPPTRFLIVER249p.E243fsc.729_729delAFrame_Shift_Del517.59JHH7N200Y
PDE4DIPSKQRPPTRFLIVER249p.E243fsc.729_729delAFrame_Shift_Del517.59LI7N200Y
PDE4DIPSKQRPPTRFLIVER249p.E243fsc.729_729delAFrame_Shift_Del517.59SNU387N200Y
PDE4DIPSKQRPPTRFLIVER249p.E243fsc.729_729delAFrame_Shift_Del517.59SNU423N200Y
PDE4DIPSKQRPPTRFLIVER249p.E243fsc.729_729delAFrame_Shift_Del517.59SNU475N200Y
PDE4DIPSKQRPPTRFLIVER249p.E243fsc.729_729delAFrame_Shift_Del517.59SNU878N200Y
PDE4DIPSRKKSSKQRLIVER244p.E243fsc.729_729delAFrame_Shift_Del417.59HUH6Y390Y
PDE4DIPSRKKSSKQRLIVER244p.E243fsc.729_729delAFrame_Shift_Del417.59JHH1Y390Y
PDE4DIPSRKKSSKQRLIVER244p.E243fsc.729_729delAFrame_Shift_Del417.59JHH4Y390Y
PDE4DIPSRKKSSKQRLIVER244p.E243fsc.729_729delAFrame_Shift_Del417.59JHH5Y390Y
PDE4DIPSRKKSSKQRLIVER244p.E243fsc.729_729delAFrame_Shift_Del417.59JHH7Y390Y
PDE4DIPSRKKSSKQRLIVER244p.E243fsc.729_729delAFrame_Shift_Del417.59LI7Y390Y
PDE4DIPSRKKSSKQRLIVER244p.E243fsc.729_729delAFrame_Shift_Del417.59SNU387Y390Y
PDE4DIPSRKKSSKQRLIVER244p.E243fsc.729_729delAFrame_Shift_Del417.59SNU423Y390Y
PDE4DIPSRKKSSKQRLIVER244p.E243fsc.729_729delAFrame_Shift_Del417.59SNU475Y390Y
PDE4DIPSRKKSSKQRLIVER244p.E243fsc.729_729delAFrame_Shift_Del417.59SNU878Y390Y
PDE4DIPSSKQRPPTRLIVER248p.E243fsc.729_729delAFrame_Shift_Del517.59HUH6Y390Y
PDE4DIPSSKQRPPTRLIVER248p.E243fsc.729_729delAFrame_Shift_Del517.59JHH1Y390Y
PDE4DIPSSKQRPPTRLIVER248p.E243fsc.729_729delAFrame_Shift_Del517.59JHH4Y390Y
PDE4DIPSSKQRPPTRLIVER248p.E243fsc.729_729delAFrame_Shift_Del517.59JHH5Y390Y
PDE4DIPSSKQRPPTRLIVER248p.E243fsc.729_729delAFrame_Shift_Del517.59JHH7Y390Y
PDE4DIPSSKQRPPTRLIVER248p.E243fsc.729_729delAFrame_Shift_Del517.59LI7Y390Y
PDE4DIPSSKQRPPTRLIVER248p.E243fsc.729_729delAFrame_Shift_Del517.59SNU387Y390Y
PDE4DIPSSKQRPPTRLIVER248p.E243fsc.729_729delAFrame_Shift_Del517.59SNU423Y390Y
PDE4DIPSSKQRPPTRLIVER248p.E243fsc.729_729delAFrame_Shift_Del517.59SNU475Y390Y
PDE4DIPSSKQRPPTRLIVER248p.E243fsc.729_729delAFrame_Shift_Del517.59SNU878Y390Y
PDE4DIPSVSDSHLADLIVER235p.E243fsc.729_729delAFrame_Shift_Del117.59HUH6N000N
PDE4DIPSVSDSHLADLIVER235p.E243fsc.729_729delAFrame_Shift_Del117.59JHH1N000N
PDE4DIPSVSDSHLADLIVER235p.E243fsc.729_729delAFrame_Shift_Del117.59JHH4N000N
PDE4DIPSVSDSHLADLIVER235p.E243fsc.729_729delAFrame_Shift_Del117.59JHH5N000N
PDE4DIPSVSDSHLADLIVER235p.E243fsc.729_729delAFrame_Shift_Del117.59JHH7N000N
PDE4DIPSVSDSHLADLIVER235p.E243fsc.729_729delAFrame_Shift_Del117.59LI7N000N
PDE4DIPSVSDSHLADLIVER235p.E243fsc.729_729delAFrame_Shift_Del117.59SNU387N000N
PDE4DIPSVSDSHLADLIVER235p.E243fsc.729_729delAFrame_Shift_Del117.59SNU423N000N
PDE4DIPSVSDSHLADLIVER235p.E243fsc.729_729delAFrame_Shift_Del117.59SNU475N000N
PDE4DIPSVSDSHLADLIVER235p.E243fsc.729_729delAFrame_Shift_Del117.59SNU878N000N
PDE4DIPTRFFKRNLMLIVER255p.E243fsc.729_729delAFrame_Shift_Del617.59HUH6Y390Y
PDE4DIPTRFFKRNLMLIVER255p.E243fsc.729_729delAFrame_Shift_Del617.59JHH1Y390Y
PDE4DIPTRFFKRNLMLIVER255p.E243fsc.729_729delAFrame_Shift_Del617.59JHH4Y390Y
PDE4DIPTRFFKRNLMLIVER255p.E243fsc.729_729delAFrame_Shift_Del617.59JHH5Y390Y
PDE4DIPTRFFKRNLMLIVER255p.E243fsc.729_729delAFrame_Shift_Del617.59JHH7Y390Y
PDE4DIPTRFFKRNLMLIVER255p.E243fsc.729_729delAFrame_Shift_Del617.59LI7Y390Y
PDE4DIPTRFFKRNLMLIVER255p.E243fsc.729_729delAFrame_Shift_Del617.59SNU387Y390Y
PDE4DIPTRFFKRNLMLIVER255p.E243fsc.729_729delAFrame_Shift_Del617.59SNU423Y390Y
PDE4DIPTRFFKRNLMLIVER255p.E243fsc.729_729delAFrame_Shift_Del617.59SNU475Y390Y
PDE4DIPTRFFKRNLMLIVER255p.E243fsc.729_729delAFrame_Shift_Del617.59SNU878Y390Y
PDE4DIPVSDSHLADSLIVER236p.E243fsc.729_729delAFrame_Shift_Del217.59HUH6N100N
PDE4DIPVSDSHLADSLIVER236p.E243fsc.729_729delAFrame_Shift_Del217.59JHH1N100N
PDE4DIPVSDSHLADSLIVER236p.E243fsc.729_729delAFrame_Shift_Del217.59JHH4N100N
PDE4DIPVSDSHLADSLIVER236p.E243fsc.729_729delAFrame_Shift_Del217.59JHH5N100N
PDE4DIPVSDSHLADSLIVER236p.E243fsc.729_729delAFrame_Shift_Del217.59JHH7N100N
PDE4DIPVSDSHLADSLIVER236p.E243fsc.729_729delAFrame_Shift_Del217.59LI7N100N
PDE4DIPVSDSHLADSLIVER236p.E243fsc.729_729delAFrame_Shift_Del217.59SNU387N100N
PDE4DIPVSDSHLADSLIVER236p.E243fsc.729_729delAFrame_Shift_Del217.59SNU423N100N
PDE4DIPVSDSHLADSLIVER236p.E243fsc.729_729delAFrame_Shift_Del217.59SNU475N100N
PDE4DIPVSDSHLADSLIVER236p.E243fsc.729_729delAFrame_Shift_Del217.59SNU878N100N
PDE4DIPDKAVLWSGLLIVER483p.V486fsc.1458_1458delTFrame_Shift_Del518.58ALEXANDERCELLSN400N
PDE4DIPHDKAVLWSGLIVER482p.V486fsc.1458_1458delTFrame_Shift_Del418.58ALEXANDERCELLSN000N
PDE4DIPIHDKAVLWSLIVER481p.V486fsc.1458_1458delTFrame_Shift_Del318.58ALEXANDERCELLSN2020N
PDE4DIPQRIHDKAVLLIVER479p.V486fsc.1458_1458delTFrame_Shift_Del118.58ALEXANDERCELLSN600N
PDE4DIPRIHDKAVLWLIVER480p.V486fsc.1458_1458delTFrame_Shift_Del218.58ALEXANDERCELLSN400N
PDE4DIPAAVRHQWSPLIVER1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSN000N
PDE4DIPACQLPRIPPLIVER1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSN000N
PDE4DIPAFIFTPYPSLIVER1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPAFLRHHCPQLIVER1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPALFLLLPQLLIVER1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSY16110N
PDE4DIPALSSLAAVRLIVER1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSY6100N
PDE4DIPAPLALSSLALIVER1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN1000N
PDE4DIPASCLSAPLALIVER1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSN100N
PDE4DIPASRGLRPNPLIVER1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000Y
PDE4DIPATPSACQLPLIVER1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPAVRHQWSPWLIVER1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSN100N
PDE4DIPCCRSSWEKVLIVER1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN100N
PDE4DIPCLSAPLALSLIVER1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPCPQLHPASCLIVER1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN400N
PDE4DIPCQLPRIPPRLIVER1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN600Y
PDE4DIPCRSSWEKVPLIVER1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPEKVPALFLLLIVER1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSN800N
PDE4DIPFIFTPYPSWLIVER1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSN500N
PDE4DIPFLLLPQLHCLIVER1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN7023N
PDE4DIPFLRHHCPQLLIVER1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSY1399N
PDE4DIPFTPYPSWLALIVER1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSN602N
PDE4DIPGLRPNPTATLIVER1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN200N
PDE4DIPHCPQLHPASLIVER1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN100N
PDE4DIPHHCPQLHPALIVER1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSN200N
PDE4DIPHPASCLSAPLIVER1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN100N
PDE4DIPHQWSPWLRLLIVER1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSY14120Y
PDE4DIPIFTPYPSWLLIVER1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSN900N
PDE4DIPIPPRRPTRPLIVER1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN100N
PDE4DIPIQAFIFTPYLIVER1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSN900N
PDE4DIPKPSSTSASRLIVER1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35ALEXANDERCELLSY490N
PDE4DIPKVPALFLLLLIVER1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSY1890N
PDE4DIPLAAVRHQWSLIVER1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN100N
PDE4DIPLAFLRHHCPLIVER1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSN000N
PDE4DIPLALSSLAAVLIVER1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSN1000N
PDE4DIPLFLLLPQLHLIVER1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN0032N
PDE4DIPLHPASCLSALIVER1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSN307N
PDE4DIPLPRIPPRRPLIVER1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN100N
PDE4DIPLRHHCPQLHLIVER1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN2020N
PDE4DIPLRLSRSYRCLIVER1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSN3033N
PDE4DIPLRPNPTATPLIVER1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN1029N
PDE4DIPLSAPLALSSLIVER1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSN200N
PDE4DIPLSRSYRCCRLIVER1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN300N
PDE4DIPLSSLAAVRHLIVER1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPNPTATPSACLIVER1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSN400N
PDE4DIPPALFLLLPQLIVER1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPPASCLSAPLLIVER1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSN000N
PDE4DIPPIQAFIFTPLIVER1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSN000N
PDE4DIPPLALSSLAALIVER1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSN100N
PDE4DIPPNPTATPSALIVER1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPPPRRPTRPILIVER1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN900N
PDE4DIPPQLHPASCLLIVER1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN200N
PDE4DIPPRIPPRRPTLIVER1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPPRRPTRPIQLIVER1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPPSACQLPRILIVER1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPPSSTSASRGLIVER1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35ALEXANDERCELLSN000Y
PDE4DIPPSWLAFLRHLIVER1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPPTATPSACQLIVER1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPPTRPIQAFILIVER1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPPWLRLSRSYLIVER1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSN000N
PDE4DIPPYPSWLAFLLIVER1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSY4100N
PDE4DIPQAFIFTPYPLIVER1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSN000N
PDE4DIPQLHPASCLSLIVER1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPQLPRIPPRRLIVER1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN500Y
PDE4DIPQWSPWLRLSLIVER1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPRCCRSSWEKLIVER1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSY4100N
PDE4DIPRGLRPNPTALIVER1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSN400N
PDE4DIPRHHCPQLHPLIVER1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSN000N
PDE4DIPRHQWSPWLRLIVER1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN100Y
PDE4DIPRIPPRRPTRLIVER1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSY790N
PDE4DIPRLSRSYRCCLIVER1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSY290N
PDE4DIPRPIQAFIFTLIVER1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSN500N
PDE4DIPRPNPTATPSLIVER1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN300N
PDE4DIPRPTRPIQAFLIVER1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSY12100N
PDE4DIPRRPTRPIQALIVER1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN500N
PDE4DIPRSSWEKVPALIVER1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN200N
PDE4DIPRSYRCCRSSLIVER1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN100N
PDE4DIPSACQLPRIPLIVER1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPSAPLALSSLLIVER1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSY15100N
PDE4DIPSASRGLRPNLIVER1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN100Y
PDE4DIPSCLSAPLALLIVER1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN1000N
PDE4DIPSLAAVRHQWLIVER1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSN300N
PDE4DIPSPWLRLSRSLIVER1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSN500Y
PDE4DIPSRGLRPNPTLIVER1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN300Y
PDE4DIPSRSYRCCRSLIVER1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN300N
PDE4DIPSSLAAVRHQLIVER1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSN000Y
PDE4DIPSSTSASRGLLIVER1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35ALEXANDERCELLSN700N
PDE4DIPSSWEKVPALLIVER1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSY1990N
PDE4DIPSTSASRGLRLIVER1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35ALEXANDERCELLSN400N
PDE4DIPSWEKVPALFLIVER1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN300N
PDE4DIPSWLAFLRHHLIVER1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN000N
PDE4DIPSYRCCRSSWLIVER1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSY2100N
PDE4DIPTATPSACQLLIVER1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSN1100N
PDE4DIPTPSACQLPRLIVER1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN500N
PDE4DIPTPYPSWLAFLIVER1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSY19100N
PDE4DIPTRPIQAFIFLIVER1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN400N
PDE4DIPTSASRGLRPLIVER1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSN000N
PDE4DIPVPALFLLLPLIVER1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN200N
PDE4DIPVRHQWSPWLLIVER1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSN905Y
PDE4DIPWEKVPALFLLIVER1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSY12125N
PDE4DIPWLAFLRHHCLIVER1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35ALEXANDERCELLSY41017N
PDE4DIPWLRLSRSYRLIVER1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSY71012N
PDE4DIPWSPWLRLSRLIVER1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35ALEXANDERCELLSN605Y
PDE4DIPYPSWLAFLRLIVER1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN702N
PDE4DIPYRCCRSSWELIVER1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35ALEXANDERCELLSN305N
PDE4DIPACHRIPLSSLIVER2034p.Q2037Rc.6110A>GMissense_Mutation10.11JHH7N000N
PDE4DIPAYSLDACHRLIVER2029p.Q2037Rc.6110A>GMissense_Mutation10.11JHH7Y290N
PDE4DIPCHRIPLSSDLIVER2035p.Q2037Rc.6110A>GMissense_Mutation10.11JHH7N000N
PDE4DIPDACHRIPLSLIVER2033p.Q2037Rc.6110A>GMissense_Mutation10.11JHH7N400N
PDE4DIPHRIPLSSDLLIVER2036p.Q2037Rc.6110A>GMissense_Mutation10.11JHH7Y990N
PDE4DIPLDACHRIPLLIVER2032p.Q2037Rc.6110A>GMissense_Mutation10.11JHH7N700N
PDE4DIPRIPLSSDLSLIVER2037p.Q2037Rc.6110A>GMissense_Mutation10.11JHH7N100N
PDE4DIPSLDACHRIPLIVER2031p.Q2037Rc.6110A>GMissense_Mutation10.11JHH7N000N
PDE4DIPYSLDACHRILIVER2030p.Q2037Rc.6110A>GMissense_Mutation10.11JHH7Y13115N
PDE4DIPCWQKEQESILIVER571p.R571Cc.1711C>TMissense_Mutation10.22SNU387N400N
PDE4DIPEEMETKFSCLIVER563p.R571Cc.1711C>TMissense_Mutation10.22SNU387N500N
PDE4DIPEMETKFSCWLIVER564p.R571Cc.1711C>TMissense_Mutation10.22SNU387N000N
PDE4DIPETKFSCWQKLIVER566p.R571Cc.1711C>TMissense_Mutation10.22SNU387Y3170N
PDE4DIPFSCWQKEQELIVER569p.R571Cc.1711C>TMissense_Mutation10.22SNU387N100N
PDE4DIPKFSCWQKEQLIVER568p.R571Cc.1711C>TMissense_Mutation10.22SNU387N000N
PDE4DIPMETKFSCWQLIVER565p.R571Cc.1711C>TMissense_Mutation10.22SNU387N004N
PDE4DIPSCWQKEQESLIVER570p.R571Cc.1711C>TMissense_Mutation10.22SNU387N000N
PDE4DIPTKFSCWQKELIVER567p.R571Cc.1711C>TMissense_Mutation10.22SNU387N000N
PIK3C2GCSWGSIGKHLIVER124p.P129delc.384_386delCCCIn_Frame_Del447.23ALEXANDERCELLSN000N
PIK3C2GCSWGSIGKHLIVER124p.P129delc.384_386delCCCIn_Frame_Del447.23HUH6N000N
PIK3C2GCSWGSIGKHLIVER124p.P129delc.384_386delCCCIn_Frame_Del447.23JHH6N000N
PIK3C2GCSWGSIGKHLIVER124p.P129delc.384_386delCCCIn_Frame_Del447.23JHH7N000N
PIK3C2GCSWGSIGKHLIVER124p.P129delc.384_386delCCCIn_Frame_Del447.23LI7N000N
PIK3C2GCSWGSIGKHLIVER124p.P129delc.384_386delCCCIn_Frame_Del447.23SKHEP1N000N
PIK3C2GCSWGSIGKHLIVER124p.P129delc.384_386delCCCIn_Frame_Del447.23SNU387N000N
PIK3C2GCSWGSIGKHLIVER124p.P129delc.384_386delCCCIn_Frame_Del447.23SNU398N000N
PIK3C2GCSWGSIGKHLIVER124p.P129delc.384_386delCCCIn_Frame_Del447.23SNU761N000N
PIK3C2GCSWGSIGKHLIVER124p.P129delc.384_386delCCCIn_Frame_Del447.23SNU878N000N
PIK3C2GECSWGSIGKLIVER123p.P129delc.384_386delCCCIn_Frame_Del347.23ALEXANDERCELLSN100N
PIK3C2GECSWGSIGKLIVER123p.P129delc.384_386delCCCIn_Frame_Del347.23HUH6N100N
PIK3C2GECSWGSIGKLIVER123p.P129delc.384_386delCCCIn_Frame_Del347.23JHH6N100N
PIK3C2GECSWGSIGKLIVER123p.P129delc.384_386delCCCIn_Frame_Del347.23JHH7N100N
PIK3C2GECSWGSIGKLIVER123p.P129delc.384_386delCCCIn_Frame_Del347.23LI7N100N
PIK3C2GECSWGSIGKLIVER123p.P129delc.384_386delCCCIn_Frame_Del347.23SKHEP1N100N
PIK3C2GECSWGSIGKLIVER123p.P129delc.384_386delCCCIn_Frame_Del347.23SNU387N100N
PIK3C2GECSWGSIGKLIVER123p.P129delc.384_386delCCCIn_Frame_Del347.23SNU398N100N
PIK3C2GECSWGSIGKLIVER123p.P129delc.384_386delCCCIn_Frame_Del347.23SNU761N100N
PIK3C2GECSWGSIGKLIVER123p.P129delc.384_386delCCCIn_Frame_Del347.23SNU878N100N
PIK3C2GGSIGKHHGALIVER127p.P129delc.384_386delCCCIn_Frame_Del247.23ALEXANDERCELLSN300N
PIK3C2GGSIGKHHGALIVER127p.P129delc.384_386delCCCIn_Frame_Del247.23HUH6N300N
PIK3C2GGSIGKHHGALIVER127p.P129delc.384_386delCCCIn_Frame_Del247.23JHH6N300N
PIK3C2GGSIGKHHGALIVER127p.P129delc.384_386delCCCIn_Frame_Del247.23JHH7N300N
PIK3C2GGSIGKHHGALIVER127p.P129delc.384_386delCCCIn_Frame_Del247.23LI7N300N
PIK3C2GGSIGKHHGALIVER127p.P129delc.384_386delCCCIn_Frame_Del247.23SKHEP1N300N
PIK3C2GGSIGKHHGALIVER127p.P129delc.384_386delCCCIn_Frame_Del247.23SNU387N300N
PIK3C2GGSIGKHHGALIVER127p.P129delc.384_386delCCCIn_Frame_Del247.23SNU398N300N
PIK3C2GGSIGKHHGALIVER127p.P129delc.384_386delCCCIn_Frame_Del247.23SNU761N300N
PIK3C2GGSIGKHHGALIVER127p.P129delc.384_386delCCCIn_Frame_Del247.23SNU878N300N
PIK3C2GKECSWGSIGLIVER122p.P129delc.384_386delCCCIn_Frame_Del247.23ALEXANDERCELLSN000N
PIK3C2GKECSWGSIGLIVER122p.P129delc.384_386delCCCIn_Frame_Del247.23HUH6N000N
PIK3C2GKECSWGSIGLIVER122p.P129delc.384_386delCCCIn_Frame_Del247.23JHH6N000N
PIK3C2GKECSWGSIGLIVER122p.P129delc.384_386delCCCIn_Frame_Del247.23JHH7N000N
PIK3C2GKECSWGSIGLIVER122p.P129delc.384_386delCCCIn_Frame_Del247.23LI7N000N
PIK3C2GKECSWGSIGLIVER122p.P129delc.384_386delCCCIn_Frame_Del247.23SKHEP1N000N
PIK3C2GKECSWGSIGLIVER122p.P129delc.384_386delCCCIn_Frame_Del247.23SNU387N000N
PIK3C2GKECSWGSIGLIVER122p.P129delc.384_386delCCCIn_Frame_Del247.23SNU398N000N
PIK3C2GKECSWGSIGLIVER122p.P129delc.384_386delCCCIn_Frame_Del247.23SNU761N000N
PIK3C2GKECSWGSIGLIVER122p.P129delc.384_386delCCCIn_Frame_Del247.23SNU878N000N
PIK3C2GNKECSWGSILIVER121p.P129delc.384_386delCCCIn_Frame_Del147.23ALEXANDERCELLSN100N
PIK3C2GNKECSWGSILIVER121p.P129delc.384_386delCCCIn_Frame_Del147.23HUH6N100N
PIK3C2GNKECSWGSILIVER121p.P129delc.384_386delCCCIn_Frame_Del147.23JHH6N100N
PIK3C2GNKECSWGSILIVER121p.P129delc.384_386delCCCIn_Frame_Del147.23JHH7N100N
PIK3C2GNKECSWGSILIVER121p.P129delc.384_386delCCCIn_Frame_Del147.23LI7N100N
PIK3C2GNKECSWGSILIVER121p.P129delc.384_386delCCCIn_Frame_Del147.23SKHEP1N100N
PIK3C2GNKECSWGSILIVER121p.P129delc.384_386delCCCIn_Frame_Del147.23SNU387N100N
PIK3C2GNKECSWGSILIVER121p.P129delc.384_386delCCCIn_Frame_Del147.23SNU398N100N
PIK3C2GNKECSWGSILIVER121p.P129delc.384_386delCCCIn_Frame_Del147.23SNU761N100N
PIK3C2GNKECSWGSILIVER121p.P129delc.384_386delCCCIn_Frame_Del147.23SNU878N100N
PIK3C2GSIGKHHGADLIVER128p.P129delc.384_386delCCCIn_Frame_Del147.23ALEXANDERCELLSN000N
PIK3C2GSIGKHHGADLIVER128p.P129delc.384_386delCCCIn_Frame_Del147.23HUH6N000N
PIK3C2GSIGKHHGADLIVER128p.P129delc.384_386delCCCIn_Frame_Del147.23JHH6N000N
PIK3C2GSIGKHHGADLIVER128p.P129delc.384_386delCCCIn_Frame_Del147.23JHH7N000N
PIK3C2GSIGKHHGADLIVER128p.P129delc.384_386delCCCIn_Frame_Del147.23LI7N000N
PIK3C2GSIGKHHGADLIVER128p.P129delc.384_386delCCCIn_Frame_Del147.23SKHEP1N000N
PIK3C2GSIGKHHGADLIVER128p.P129delc.384_386delCCCIn_Frame_Del147.23SNU387N000N
PIK3C2GSIGKHHGADLIVER128p.P129delc.384_386delCCCIn_Frame_Del147.23SNU398N000N
PIK3C2GSIGKHHGADLIVER128p.P129delc.384_386delCCCIn_Frame_Del147.23SNU761N000N
PIK3C2GSIGKHHGADLIVER128p.P129delc.384_386delCCCIn_Frame_Del147.23SNU878N000N
PIK3C2GSWGSIGKHHLIVER125p.P129delc.384_386delCCCIn_Frame_Del447.23ALEXANDERCELLSN000N
PIK3C2GSWGSIGKHHLIVER125p.P129delc.384_386delCCCIn_Frame_Del447.23HUH6N000N
PIK3C2GSWGSIGKHHLIVER125p.P129delc.384_386delCCCIn_Frame_Del447.23JHH6N000N
PIK3C2GSWGSIGKHHLIVER125p.P129delc.384_386delCCCIn_Frame_Del447.23JHH7N000N
PIK3C2GSWGSIGKHHLIVER125p.P129delc.384_386delCCCIn_Frame_Del447.23LI7N000N
PIK3C2GSWGSIGKHHLIVER125p.P129delc.384_386delCCCIn_Frame_Del447.23SKHEP1N000N
PIK3C2GSWGSIGKHHLIVER125p.P129delc.384_386delCCCIn_Frame_Del447.23SNU387N000N
PIK3C2GSWGSIGKHHLIVER125p.P129delc.384_386delCCCIn_Frame_Del447.23SNU398N000N
PIK3C2GSWGSIGKHHLIVER125p.P129delc.384_386delCCCIn_Frame_Del447.23SNU761N000N
PIK3C2GSWGSIGKHHLIVER125p.P129delc.384_386delCCCIn_Frame_Del447.23SNU878N000N
PIK3C2GWGSIGKHHGLIVER126p.P129delc.384_386delCCCIn_Frame_Del347.23ALEXANDERCELLSN107Y
PIK3C2GWGSIGKHHGLIVER126p.P129delc.384_386delCCCIn_Frame_Del347.23HUH6N107Y
PIK3C2GWGSIGKHHGLIVER126p.P129delc.384_386delCCCIn_Frame_Del347.23JHH6N107Y
PIK3C2GWGSIGKHHGLIVER126p.P129delc.384_386delCCCIn_Frame_Del347.23JHH7N107Y
PIK3C2GWGSIGKHHGLIVER126p.P129delc.384_386delCCCIn_Frame_Del347.23LI7N107Y
PIK3C2GWGSIGKHHGLIVER126p.P129delc.384_386delCCCIn_Frame_Del347.23SKHEP1N107Y
PIK3C2GWGSIGKHHGLIVER126p.P129delc.384_386delCCCIn_Frame_Del347.23SNU387N107Y
PIK3C2GWGSIGKHHGLIVER126p.P129delc.384_386delCCCIn_Frame_Del347.23SNU398N107Y
PIK3C2GWGSIGKHHGLIVER126p.P129delc.384_386delCCCIn_Frame_Del347.23SNU761N107Y
PIK3C2GWGSIGKHHGLIVER126p.P129delc.384_386delCCCIn_Frame_Del347.23SNU878N107Y
PIK3C2GCTDPTYNQILIVER1387p.I1394Lc.4180A>CMissense_Mutation10.22HUH7Y3110N
PIK3C2GDPTYNQIVVLIVER1389p.I1394Lc.4180A>CMissense_Mutation10.22HUH7N1400N
PIK3C2GKCTDPTYNQLIVER1386p.I1394Lc.4180A>CMissense_Mutation10.22HUH7N000N
PIK3C2GNQIVVYDEVLIVER1393p.I1394Lc.4180A>CMissense_Mutation10.22HUH7Y7120N
PIK3C2GPTYNQIVVYLIVER1390p.I1394Lc.4180A>CMissense_Mutation10.22HUH7N200N
PIK3C2GQIVVYDEVTLIVER1394p.I1394Lc.4180A>CMissense_Mutation10.22HUH7N000N
PIK3C2GTDPTYNQIVLIVER1388p.I1394Lc.4180A>CMissense_Mutation10.22HUH7N600N
PIK3C2GTYNQIVVYDLIVER1391p.I1394Lc.4180A>CMissense_Mutation10.22HUH7N000N
PIK3C2GYNQIVVYDELIVER1392p.I1394Lc.4180A>CMissense_Mutation10.22HUH7N207Y
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ALEXANDERCELLSN000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HEPG2N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HLFN000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH6N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH7N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH1N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH2N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH4N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH5N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH6N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH7N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LI7N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH684N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKHEP1N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU182N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU387N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU398N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU423N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU449N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU475N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU761N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU878N000N
PRKDCAGHAMLAGPLIVER1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU886N000N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ALEXANDERCELLSN100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HEPG2N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HLFN100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH6N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH7N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH1N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH2N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH4N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH5N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH6N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH7N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LI7N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH684N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKHEP1N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU182N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU387N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU398N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU423N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU449N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU475N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU761N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU878N100N
PRKDCAGPAPGRVGLIVER1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU886N100N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ALEXANDERCELLSY290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HEPG2Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HLFY290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH6Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH7Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH1Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH2Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH4Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH5Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH6Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH7Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LI7Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH684Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKHEP1Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU182Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU387Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU398Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU423Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU449Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU475Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU761Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU878Y290N
PRKDCAIQPAGHAMLIVER1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU886Y290N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ALEXANDERCELLSN000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HEPG2N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HLFN000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH6N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH7N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH1N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH2N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH4N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH5N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH6N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH7N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LI7N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH684N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKHEP1N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU182N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU387N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU398N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU423N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU449N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU475N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU761N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU878N000N
PRKDCAMLAGPAPGLIVER1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU886N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ALEXANDERCELLSN000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HEPG2N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HLFN000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH6N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH7N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH1N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH2N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH4N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH5N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH6N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH7N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LI7N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH684N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKHEP1N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU182N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU387N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU398N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU423N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU449N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU475N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU761N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU878N000N
PRKDCAPGRVGVLQLIVER1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU886N000N
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48ALEXANDERCELLSN000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48HEPG2N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48HLFN000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48HUH6N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48HUH7N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48JHH1N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48JHH2N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48JHH4N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48JHH5N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48JHH6N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48JHH7N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48LI7N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48NCIH684N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SKHEP1N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SNU182N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SNU387N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SNU398N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SNU423N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SNU449N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SNU475N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SNU761N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SNU878N000Y
PRKDCAQPTLLYPSLIVER1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SNU886N000Y
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ALEXANDERCELLSN300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HEPG2N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HLFN300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH6N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH7N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH1N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH2N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH4N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH5N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH6N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH7N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LI7N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH684N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKHEP1N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU182N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU387N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU398N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU423N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU449N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU475N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU761N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU878N300N
PRKDCCRSAPGPRYLIVER1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU886N300N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48ALEXANDERCELLSN000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HEPG2N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HLFN000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HUH6N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HUH7N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48JHH1N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48JHH2N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48JHH4N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48JHH5N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48JHH6N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48JHH7N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48LI7N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48NCIH684N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKHEP1N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU182N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU387N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU398N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU423N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU449N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU475N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU761N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU878N000N
PRKDCENCRSAPGPLIVER1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU886N000N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ALEXANDERCELLSN400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HEPG2N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HLFN400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH6N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH7N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH1N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH2N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH4N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH5N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH6N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH7N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LI7N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH684N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKHEP1N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU182N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU387N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU398N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU423N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU449N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU475N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU761N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU878N400N
PRKDCGAIQPAGHALIVER1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU886N400N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ALEXANDERCELLSN100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HEPG2N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HLFN100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH6N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH7N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH1N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH2N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH4N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH5N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH6N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH7N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LI7N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH684N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKHEP1N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU182N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU387N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU398N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU423N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU449N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU475N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU761N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU878N100N
PRKDCGHAMLAGPALIVER1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU886N100N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ALEXANDERCELLSY13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HEPG2Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HLFY13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH6Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH7Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH1Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH2Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH4Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH5Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH6Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH7Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LI7Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH684Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKHEP1Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU182Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU387Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU398Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU423Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU449Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU475Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU761Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU878Y13150N
PRKDCGPAPGRVGVLIVER1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU886Y13150N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ALEXANDERCELLSY490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HEPG2Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HLFY490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH6Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH7Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH1Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH2Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH4Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH5Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH6Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH7Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LI7Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH684Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKHEP1Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU182Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU387Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU398Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU423Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU449Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU475Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU761Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU878Y490N
PRKDCGRVGVLQHVLIVER1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU886Y490N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ALEXANDERCELLSY690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HEPG2Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HLFY690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH6Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH7Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH1Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH2Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH4Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH5Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH6Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH7Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LI7Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH684Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKHEP1Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU182Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU387Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU398Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU423Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU449Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU475Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU761Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU878Y690N
PRKDCGVLQHVHWRLIVER1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU886Y690N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ALEXANDERCELLSN000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HEPG2N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HLFN000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH6N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH7N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH1N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH2N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH4N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH5N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH6N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH7N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LI7N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH684N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKHEP1N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU182N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU387N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU398N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU423N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU449N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU475N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU761N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU878N000N
PRKDCHAMLAGPAPLIVER1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU886N000N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48ALEXANDERCELLSY690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HEPG2Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HLFY690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HUH6Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HUH7Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48JHH1Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48JHH2Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48JHH4Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48JHH5Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48JHH6Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48JHH7Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48LI7Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48NCIH684Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKHEP1Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU182Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU387Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU398Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU423Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU449Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU475Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU761Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU878Y690N
PRKDCHVHWRENCRLIVER1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU886Y690N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48ALEXANDERCELLSN100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HEPG2N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HLFN100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HUH6N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HUH7N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48JHH1N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48JHH2N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48JHH4N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48JHH5N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48JHH6N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48JHH7N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48LI7N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48NCIH684N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKHEP1N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU182N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU387N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU398N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU423N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU449N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU475N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU761N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU878N100N
PRKDCHWRENCRSALIVER1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SNU886N100N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ALEXANDERCELLSN1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HEPG2N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HLFN1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH6N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH7N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH1N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH2N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH4N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH5N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH6N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH7N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LI7N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH684N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKHEP1N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU182N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU387N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU398N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU423N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU449N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU475N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU761N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU878N1400N
PRKDCIQPAGHAMLLIVER1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU886N1400N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48ALEXANDERCELLSN500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HEPG2N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HLFN500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HUH6N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HUH7N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48JHH1N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48JHH2N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48JHH4N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48JHH5N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48JHH6N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48JHH7N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48LI7N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48NCIH684N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKHEP1N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU182N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU387N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU398N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU423N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU449N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU475N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU761N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU878N500N
PRKDCLAGPAPGRVLIVER1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SNU886N500N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48ALEXANDERCELLSN000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48HEPG2N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48HLFN000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48HUH6N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48HUH7N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48JHH1N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48JHH2N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48JHH4N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48JHH5N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48JHH6N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48JHH7N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48LI7N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48NCIH684N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SKHEP1N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SNU182N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SNU387N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SNU398N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SNU423N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SNU449N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SNU475N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SNU761N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SNU878N000N
PRKDCLAQPTLLYPLIVER1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SNU886N000N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48ALEXANDERCELLSN100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HEPG2N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HLFN100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH6N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HUH7N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH1N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH2N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH4N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH5N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH6N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48JHH7N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48LI7N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NCIH684N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKHEP1N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU182N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU387N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU398N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU423N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU449N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SNU475N100N
PRKDCLLYPSGAIQLIVER1241p.L1244fs