Cancertope

In silico Platform for designing genome-based
Personalized immunotherapy or Vaccine against Cancer

Browse Results ...


The result page of search shows exclusive peptide/epitopes generated due to mutation [Neoepitope], the tissue of origin [Tissue], position of peptide in protein [Position], number of mismatches counted by aligning mutated and normal protein sequence [Num Mismatch, percentage of cell lines with this peptide over total number of cell lines [Promiscuity %]. The immune information include CTL epitopes (Yes/No), MHC I binders, MHC II binders (both given as number of alleles) and B cell epitopes (Yes/No). For more information, please click HERE


Result Reset Search:
ProteinNeoepitopesTissuePositionProt MutationcDNA MutationMutation TypeNum MismatchPromiscuity (%)Cell LineCTLMHC INHLApredMHC IIBcell
ABL1IGQQPGKVLCENTRAL_NERVOUS_SYSTEM1p.M1Ic.3G>TMissense_Mutation10.11SNU738N1100N
ABL1GYNHSGEWCCENTRAL_NERVOUS_SYSTEM111p.N115Sc.344A>GMissense_Mutation10.22KNS60N300N
ABL1HSGEWCEAQCENTRAL_NERVOUS_SYSTEM114p.N115Sc.344A>GMissense_Mutation10.22KNS60N000N
ABL1LGYNHSGEWCENTRAL_NERVOUS_SYSTEM110p.N115Sc.344A>GMissense_Mutation10.22KNS60N300N
ABL1LRVLGYNHSCENTRAL_NERVOUS_SYSTEM107p.N115Sc.344A>GMissense_Mutation10.22KNS60N2033N
ABL1NHSGEWCEACENTRAL_NERVOUS_SYSTEM113p.N115Sc.344A>GMissense_Mutation10.22KNS60N100N
ABL1RVLGYNHSGCENTRAL_NERVOUS_SYSTEM108p.N115Sc.344A>GMissense_Mutation10.22KNS60N000N
ABL1SGEWCEAQTCENTRAL_NERVOUS_SYSTEM115p.N115Sc.344A>GMissense_Mutation10.22KNS60N000Y
ABL1VLGYNHSGECENTRAL_NERVOUS_SYSTEM109p.N115Sc.344A>GMissense_Mutation10.22KNS60N002N
ABL1YNHSGEWCECENTRAL_NERVOUS_SYSTEM112p.N115Sc.344A>GMissense_Mutation10.22KNS60N300N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.8642MGBAN000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86A172N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86AM38N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86BECKERN000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAS1N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86D341MEDN000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86DAOYN000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86DBTRG05MGN000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86DKMGN000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86GAMGN000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86GI1N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86GMS10N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86GOS3N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86H4N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS683N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KNS42N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KNS60N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86LN18N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86LN229N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MOGGCCMN000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NMCG1N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86ONS76N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SF126N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SF295N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU1105N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU201N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU466N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU738N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SW1088N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SW1783N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86T98GN000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TM31N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86U138MGN000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86YH13N000N
AKAP12AIEEDLEPECENTRAL_NERVOUS_SYSTEM1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86YKG1N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.8642MGBAN000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86A172N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86AM38N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86BECKERN000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAS1N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86D341MEDN000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86DAOYN000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86DBTRG05MGN000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86DKMGN000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86GAMGN000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86GI1N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86GMS10N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86GOS3N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86H4N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS683N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KNS42N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KNS60N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86LN18N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86LN229N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MOGGCCMN000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NMCG1N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86ONS76N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SF126N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SF295N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU1105N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU201N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU466N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU738N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SW1088N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SW1783N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86T98GN000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TM31N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86U138MGN000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86YH13N000N
AKAP12EEDLEPENGCENTRAL_NERVOUS_SYSTEM1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86YKG1N000N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.8642MGBAN200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86A172N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86AM38N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86BECKERN200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAS1N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86D341MEDN200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86DAOYN200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86DBTRG05MGN200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86DKMGN200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86GAMGN200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86GI1N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86GMS10N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86GOS3N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86H4N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS683N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KNS42N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KNS60N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86LN18N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86LN229N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MOGGCCMN200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NMCG1N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86ONS76N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SF126N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SF295N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU1105N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU201N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU466N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU738N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SW1088N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SW1783N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86T98GN200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TM31N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86U138MGN200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86YH13N200N
AKAP12IEEDLEPENCENTRAL_NERVOUS_SYSTEM1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86YKG1N200N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.8642MGBAN000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86A172N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86AM38N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86BECKERN000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAS1N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86D341MEDN000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86DAOYN000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86DBTRG05MGN000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86DKMGN000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86GAMGN000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86GI1N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86GMS10N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86GOS3N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86H4N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS683N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KNS42N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KNS60N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86LN18N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86LN229N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MOGGCCMN000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NMCG1N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86ONS76N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SF126N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SF295N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU1105N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU201N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU466N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SNU738N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SW1088N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SW1783N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86T98GN000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TM31N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86U138MGN000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86YH13N000N
AKAP12KVSVAIEEDCENTRAL_NERVOUS_SYSTEM1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86YKG1N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.8642MGBAN000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86A172N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86AM38N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86BECKERN000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAS1N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86D341MEDN000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86DAOYN000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86DBTRG05MGN000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86DKMGN000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86GAMGN000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86GI1N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86GMS10N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86GOS3N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86H4N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS683N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KNS42N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KNS60N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86LN18N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86LN229N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MOGGCCMN000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NMCG1N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86ONS76N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SF126N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SF295N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU1105N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU201N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU466N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU738N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SW1088N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SW1783N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86T98GN000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TM31N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86U138MGN000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86YH13N000N
AKAP12SVAIEEDLECENTRAL_NERVOUS_SYSTEM1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86YKG1N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.8642MGBAN000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86A172N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86AM38N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86BECKERN000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAS1N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86D341MEDN000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86DAOYN000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86DBTRG05MGN000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86DKMGN000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86GAMGN000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86GI1N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86GMS10N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86GOS3N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86H4N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS683N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KNS42N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KNS60N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86LN18N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86LN229N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MOGGCCMN000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NMCG1N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86ONS76N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SF126N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SF295N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU1105N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU201N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU466N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SNU738N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SW1088N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SW1783N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86T98GN000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TM31N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86U138MGN000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86YH13N000N
AKAP12VAIEEDLEPCENTRAL_NERVOUS_SYSTEM1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86YKG1N000N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.8642MGBAN002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86A172N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86AM38N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86BECKERN002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAS1N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86D341MEDN002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86DAOYN002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86DBTRG05MGN002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86DKMGN002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86GAMGN002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86GI1N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86GMS10N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86GOS3N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86H4N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS683N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KNS42N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KNS60N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86LN18N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86LN229N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MOGGCCMN002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NMCG1N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86ONS76N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SF126N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SF295N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU1105N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU201N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU466N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SNU738N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SW1088N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SW1783N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86T98GN002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TM31N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86U138MGN002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86YH13N002N
AKAP12VKVSVAIEECENTRAL_NERVOUS_SYSTEM1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86YKG1N002N
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.8642MGBAN1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86A172N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86AM38N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86BECKERN1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAS1N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86D341MEDN1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86DAOYN1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86DBTRG05MGN1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86DKMGN1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86GAMGN1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86GI1N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86GMS10N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86GOS3N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86H4N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS683N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KNS42N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KNS60N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86LN18N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86LN229N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MOGGCCMN1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NMCG1N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86ONS76N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SF126N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SF295N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU1105N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU201N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU466N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SNU738N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SW1088N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SW1783N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86T98GN1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TM31N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86U138MGN1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86YH13N1500Y
AKAP12VSVAIEEDLCENTRAL_NERVOUS_SYSTEM1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86YKG1N1500Y
AKAP12AMVPLSEYDCENTRAL_NERVOUS_SYSTEM845p.V846Mc.2536G>AMissense_Mutation10.11LN18N100N
AKAP12DDSDVPAMVCENTRAL_NERVOUS_SYSTEM839p.V846Mc.2536G>AMissense_Mutation10.11LN18N400N
AKAP12DSDVPAMVPCENTRAL_NERVOUS_SYSTEM840p.V846Mc.2536G>AMissense_Mutation10.11LN18N000N
AKAP12DVPAMVPLSCENTRAL_NERVOUS_SYSTEM842p.V846Mc.2536G>AMissense_Mutation10.11LN18N200N
AKAP12EDDSDVPAMCENTRAL_NERVOUS_SYSTEM838p.V846Mc.2536G>AMissense_Mutation10.11LN18N200N
AKAP12MVPLSEYDACENTRAL_NERVOUS_SYSTEM846p.V846Mc.2536G>AMissense_Mutation10.11LN18N402N
AKAP12PAMVPLSEYCENTRAL_NERVOUS_SYSTEM844p.V846Mc.2536G>AMissense_Mutation10.11LN18N000N
AKAP12SDVPAMVPLCENTRAL_NERVOUS_SYSTEM841p.V846Mc.2536G>AMissense_Mutation10.11LN18N800N
AKAP12VPAMVPLSECENTRAL_NERVOUS_SYSTEM843p.V846Mc.2536G>AMissense_Mutation10.11LN18N204N
AKAP12CIPGRRKKRCENTRAL_NERVOUS_SYSTEM810p.F810Cc.2429T>GMissense_Mutation10.22GMS10N300N
AKAP12ESWVSIKKCCENTRAL_NERVOUS_SYSTEM802p.F810Cc.2429T>GMissense_Mutation10.22GMS10N100N
AKAP12IKKCIPGRRCENTRAL_NERVOUS_SYSTEM807p.F810Cc.2429T>GMissense_Mutation10.22GMS10N102N
AKAP12KCIPGRRKKCENTRAL_NERVOUS_SYSTEM809p.F810Cc.2429T>GMissense_Mutation10.22GMS10Y2130N
AKAP12KKCIPGRRKCENTRAL_NERVOUS_SYSTEM808p.F810Cc.2429T>GMissense_Mutation10.22GMS10N100N
AKAP12SIKKCIPGRCENTRAL_NERVOUS_SYSTEM806p.F810Cc.2429T>GMissense_Mutation10.22GMS10N500N
AKAP12SWVSIKKCICENTRAL_NERVOUS_SYSTEM803p.F810Cc.2429T>GMissense_Mutation10.22GMS10N700N
AKAP12VSIKKCIPGCENTRAL_NERVOUS_SYSTEM805p.F810Cc.2429T>GMissense_Mutation10.22GMS10N004Y
AKAP12WVSIKKCIPCENTRAL_NERVOUS_SYSTEM804p.F810Cc.2429T>GMissense_Mutation10.22GMS10N2019N
AKAP9DLEKTKQLECENTRAL_NERVOUS_SYSTEM1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.278MGBAN000N
AKAP9DLEKTKQLECENTRAL_NERVOUS_SYSTEM1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27A172N000N
AKAP9DLEKTKQLECENTRAL_NERVOUS_SYSTEM1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27AM38N000N
AKAP9DLEKTKQLECENTRAL_NERVOUS_SYSTEM1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27BECKERN000N
AKAP9DLEKTKQLECENTRAL_NERVOUS_SYSTEM1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CAS1N000N
AKAP9DLEKTKQLECENTRAL_NERVOUS_SYSTEM1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27DAOYN000N
AKAP9DLEKTKQLECENTRAL_NERVOUS_SYSTEM1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27GMS10N000N
AKAP9DLEKTKQLECENTRAL_NERVOUS_SYSTEM1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27GOS3N000N
AKAP9DLEKTKQLECENTRAL_NERVOUS_SYSTEM1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SF295N000N
AKAP9DLEKTKQLECENTRAL_NERVOUS_SYSTEM1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU1105N000N
AKAP9DLEKTKQLECENTRAL_NERVOUS_SYSTEM1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27T98GN000N
AKAP9DLEKTKQLECENTRAL_NERVOUS_SYSTEM1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27U138MGN000N
AKAP9DLEKTKQLECENTRAL_NERVOUS_SYSTEM1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27U87MGN000N
AKAP9EKTKQLEEQCENTRAL_NERVOUS_SYSTEM1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.278MGBAN000N
AKAP9EKTKQLEEQCENTRAL_NERVOUS_SYSTEM1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27A172N000N
AKAP9EKTKQLEEQCENTRAL_NERVOUS_SYSTEM1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27AM38N000N
AKAP9EKTKQLEEQCENTRAL_NERVOUS_SYSTEM1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27BECKERN000N
AKAP9EKTKQLEEQCENTRAL_NERVOUS_SYSTEM1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CAS1N000N
AKAP9EKTKQLEEQCENTRAL_NERVOUS_SYSTEM1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27DAOYN000N
AKAP9EKTKQLEEQCENTRAL_NERVOUS_SYSTEM1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27GMS10N000N
AKAP9EKTKQLEEQCENTRAL_NERVOUS_SYSTEM1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27GOS3N000N
AKAP9EKTKQLEEQCENTRAL_NERVOUS_SYSTEM1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SF295N000N
AKAP9EKTKQLEEQCENTRAL_NERVOUS_SYSTEM1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU1105N000N
AKAP9EKTKQLEEQCENTRAL_NERVOUS_SYSTEM1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27T98GN000N
AKAP9EKTKQLEEQCENTRAL_NERVOUS_SYSTEM1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27U138MGN000N
AKAP9EKTKQLEEQCENTRAL_NERVOUS_SYSTEM1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27U87MGN000N
AKAP9KQLEEQVQECENTRAL_NERVOUS_SYSTEM1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.278MGBAN000N
AKAP9KQLEEQVQECENTRAL_NERVOUS_SYSTEM1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27A172N000N
AKAP9KQLEEQVQECENTRAL_NERVOUS_SYSTEM1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27AM38N000N
AKAP9KQLEEQVQECENTRAL_NERVOUS_SYSTEM1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27BECKERN000N
AKAP9KQLEEQVQECENTRAL_NERVOUS_SYSTEM1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CAS1N000N
AKAP9KQLEEQVQECENTRAL_NERVOUS_SYSTEM1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27DAOYN000N
AKAP9KQLEEQVQECENTRAL_NERVOUS_SYSTEM1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27GMS10N000N
AKAP9KQLEEQVQECENTRAL_NERVOUS_SYSTEM1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27GOS3N000N
AKAP9KQLEEQVQECENTRAL_NERVOUS_SYSTEM1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SF295N000N
AKAP9KQLEEQVQECENTRAL_NERVOUS_SYSTEM1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU1105N000N
AKAP9KQLEEQVQECENTRAL_NERVOUS_SYSTEM1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27T98GN000N
AKAP9KQLEEQVQECENTRAL_NERVOUS_SYSTEM1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27U138MGN000N
AKAP9KQLEEQVQECENTRAL_NERVOUS_SYSTEM1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27U87MGN000N
AKAP9KTKQLEEQVCENTRAL_NERVOUS_SYSTEM1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.278MGBAN200N
AKAP9KTKQLEEQVCENTRAL_NERVOUS_SYSTEM1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27A172N200N
AKAP9KTKQLEEQVCENTRAL_NERVOUS_SYSTEM1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27AM38N200N
AKAP9KTKQLEEQVCENTRAL_NERVOUS_SYSTEM1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27BECKERN200N
AKAP9KTKQLEEQVCENTRAL_NERVOUS_SYSTEM1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27CAS1N200N
AKAP9KTKQLEEQVCENTRAL_NERVOUS_SYSTEM1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27DAOYN200N
AKAP9KTKQLEEQVCENTRAL_NERVOUS_SYSTEM1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27GMS10N200N
AKAP9KTKQLEEQVCENTRAL_NERVOUS_SYSTEM1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27GOS3N200N
AKAP9KTKQLEEQVCENTRAL_NERVOUS_SYSTEM1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SF295N200N
AKAP9KTKQLEEQVCENTRAL_NERVOUS_SYSTEM1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SNU1105N200N
AKAP9KTKQLEEQVCENTRAL_NERVOUS_SYSTEM1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27T98GN200N
AKAP9KTKQLEEQVCENTRAL_NERVOUS_SYSTEM1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27U138MGN200N
AKAP9KTKQLEEQVCENTRAL_NERVOUS_SYSTEM1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27U87MGN200N
AKAP9LEKTKQLEECENTRAL_NERVOUS_SYSTEM1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.278MGBAN000N
AKAP9LEKTKQLEECENTRAL_NERVOUS_SYSTEM1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27A172N000N
AKAP9LEKTKQLEECENTRAL_NERVOUS_SYSTEM1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27AM38N000N
AKAP9LEKTKQLEECENTRAL_NERVOUS_SYSTEM1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27BECKERN000N
AKAP9LEKTKQLEECENTRAL_NERVOUS_SYSTEM1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CAS1N000N
AKAP9LEKTKQLEECENTRAL_NERVOUS_SYSTEM1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27DAOYN000N
AKAP9LEKTKQLEECENTRAL_NERVOUS_SYSTEM1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27GMS10N000N
AKAP9LEKTKQLEECENTRAL_NERVOUS_SYSTEM1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27GOS3N000N
AKAP9LEKTKQLEECENTRAL_NERVOUS_SYSTEM1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SF295N000N
AKAP9LEKTKQLEECENTRAL_NERVOUS_SYSTEM1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU1105N000N
AKAP9LEKTKQLEECENTRAL_NERVOUS_SYSTEM1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27T98GN000N
AKAP9LEKTKQLEECENTRAL_NERVOUS_SYSTEM1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27U138MGN000N
AKAP9LEKTKQLEECENTRAL_NERVOUS_SYSTEM1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27U87MGN000N
AKAP9LQDLEKTKQCENTRAL_NERVOUS_SYSTEM1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.278MGBAN000N
AKAP9LQDLEKTKQCENTRAL_NERVOUS_SYSTEM1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27A172N000N
AKAP9LQDLEKTKQCENTRAL_NERVOUS_SYSTEM1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27AM38N000N
AKAP9LQDLEKTKQCENTRAL_NERVOUS_SYSTEM1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27BECKERN000N
AKAP9LQDLEKTKQCENTRAL_NERVOUS_SYSTEM1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27CAS1N000N
AKAP9LQDLEKTKQCENTRAL_NERVOUS_SYSTEM1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27DAOYN000N
AKAP9LQDLEKTKQCENTRAL_NERVOUS_SYSTEM1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27GMS10N000N
AKAP9LQDLEKTKQCENTRAL_NERVOUS_SYSTEM1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27GOS3N000N
AKAP9LQDLEKTKQCENTRAL_NERVOUS_SYSTEM1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SF295N000N
AKAP9LQDLEKTKQCENTRAL_NERVOUS_SYSTEM1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SNU1105N000N
AKAP9LQDLEKTKQCENTRAL_NERVOUS_SYSTEM1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27T98GN000N
AKAP9LQDLEKTKQCENTRAL_NERVOUS_SYSTEM1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27U138MGN000N
AKAP9LQDLEKTKQCENTRAL_NERVOUS_SYSTEM1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27U87MGN000N
AKAP9QDLEKTKQLCENTRAL_NERVOUS_SYSTEM1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.278MGBAN900N
AKAP9QDLEKTKQLCENTRAL_NERVOUS_SYSTEM1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27A172N900N
AKAP9QDLEKTKQLCENTRAL_NERVOUS_SYSTEM1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27AM38N900N
AKAP9QDLEKTKQLCENTRAL_NERVOUS_SYSTEM1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27BECKERN900N
AKAP9QDLEKTKQLCENTRAL_NERVOUS_SYSTEM1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CAS1N900N
AKAP9QDLEKTKQLCENTRAL_NERVOUS_SYSTEM1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27DAOYN900N
AKAP9QDLEKTKQLCENTRAL_NERVOUS_SYSTEM1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27GMS10N900N
AKAP9QDLEKTKQLCENTRAL_NERVOUS_SYSTEM1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27GOS3N900N
AKAP9QDLEKTKQLCENTRAL_NERVOUS_SYSTEM1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SF295N900N
AKAP9QDLEKTKQLCENTRAL_NERVOUS_SYSTEM1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SNU1105N900N
AKAP9QDLEKTKQLCENTRAL_NERVOUS_SYSTEM1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27T98GN900N
AKAP9QDLEKTKQLCENTRAL_NERVOUS_SYSTEM1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27U138MGN900N
AKAP9QDLEKTKQLCENTRAL_NERVOUS_SYSTEM1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27U87MGN900N
AKAP9QLEEQVQELCENTRAL_NERVOUS_SYSTEM1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.278MGBAN1200N
AKAP9QLEEQVQELCENTRAL_NERVOUS_SYSTEM1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27A172N1200N
AKAP9QLEEQVQELCENTRAL_NERVOUS_SYSTEM1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27AM38N1200N
AKAP9QLEEQVQELCENTRAL_NERVOUS_SYSTEM1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27BECKERN1200N
AKAP9QLEEQVQELCENTRAL_NERVOUS_SYSTEM1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27CAS1N1200N
AKAP9QLEEQVQELCENTRAL_NERVOUS_SYSTEM1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27DAOYN1200N
AKAP9QLEEQVQELCENTRAL_NERVOUS_SYSTEM1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27GMS10N1200N
AKAP9QLEEQVQELCENTRAL_NERVOUS_SYSTEM1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27GOS3N1200N
AKAP9QLEEQVQELCENTRAL_NERVOUS_SYSTEM1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SF295N1200N
AKAP9QLEEQVQELCENTRAL_NERVOUS_SYSTEM1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SNU1105N1200N
AKAP9QLEEQVQELCENTRAL_NERVOUS_SYSTEM1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27T98GN1200N
AKAP9QLEEQVQELCENTRAL_NERVOUS_SYSTEM1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27U138MGN1200N
AKAP9QLEEQVQELCENTRAL_NERVOUS_SYSTEM1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27U87MGN1200N
AKAP9TKQLEEQVQCENTRAL_NERVOUS_SYSTEM1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.278MGBAN000N
AKAP9TKQLEEQVQCENTRAL_NERVOUS_SYSTEM1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27A172N000N
AKAP9TKQLEEQVQCENTRAL_NERVOUS_SYSTEM1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27AM38N000N
AKAP9TKQLEEQVQCENTRAL_NERVOUS_SYSTEM1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27BECKERN000N
AKAP9TKQLEEQVQCENTRAL_NERVOUS_SYSTEM1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CAS1N000N
AKAP9TKQLEEQVQCENTRAL_NERVOUS_SYSTEM1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27DAOYN000N
AKAP9TKQLEEQVQCENTRAL_NERVOUS_SYSTEM1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27GMS10N000N
AKAP9TKQLEEQVQCENTRAL_NERVOUS_SYSTEM1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27GOS3N000N
AKAP9TKQLEEQVQCENTRAL_NERVOUS_SYSTEM1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SF295N000N
AKAP9TKQLEEQVQCENTRAL_NERVOUS_SYSTEM1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SNU1105N000N
AKAP9TKQLEEQVQCENTRAL_NERVOUS_SYSTEM1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27T98GN000N
AKAP9TKQLEEQVQCENTRAL_NERVOUS_SYSTEM1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27U138MGN000N
AKAP9TKQLEEQVQCENTRAL_NERVOUS_SYSTEM1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27U87MGN000N
ALKATDTYSILGCENTRAL_NERVOUS_SYSTEM730p.S737Lc.2210C>TMissense_Mutation10.11AM38N100N
ALKDTYSILGYGCENTRAL_NERVOUS_SYSTEM732p.S737Lc.2210C>TMissense_Mutation10.11AM38N000N
ALKILGYGAAGGCENTRAL_NERVOUS_SYSTEM736p.S737Lc.2210C>TMissense_Mutation10.11AM38N004N
ALKLGYGAAGGKCENTRAL_NERVOUS_SYSTEM737p.S737Lc.2210C>TMissense_Mutation10.11AM38N100N
ALKPATDTYSILCENTRAL_NERVOUS_SYSTEM729p.S737Lc.2210C>TMissense_Mutation10.11AM38N200N
ALKSILGYGAAGCENTRAL_NERVOUS_SYSTEM735p.S737Lc.2210C>TMissense_Mutation10.11AM38N000N
ALKTDTYSILGYCENTRAL_NERVOUS_SYSTEM731p.S737Lc.2210C>TMissense_Mutation10.11AM38N300N
ALKTYSILGYGACENTRAL_NERVOUS_SYSTEM733p.S737Lc.2210C>TMissense_Mutation10.11AM38Y190N
ALKYSILGYGAACENTRAL_NERVOUS_SYSTEM734p.S737Lc.2210C>TMissense_Mutation10.11AM38N600N
ALKAVEGGHVNTCENTRAL_NERVOUS_SYSTEM1470p.M1478Tc.4433T>CMissense_Mutation10.55KNS60N100N
ALKEGGHVNTAFCENTRAL_NERVOUS_SYSTEM1472p.M1478Tc.4433T>CMissense_Mutation10.55KNS60N600N
ALKGGHVNTAFSCENTRAL_NERVOUS_SYSTEM1473p.M1478Tc.4433T>CMissense_Mutation10.55KNS60N100N
ALKGHVNTAFSQCENTRAL_NERVOUS_SYSTEM1474p.M1478Tc.4433T>CMissense_Mutation10.55KNS60N000N
ALKHVNTAFSQSCENTRAL_NERVOUS_SYSTEM1475p.M1478Tc.4433T>CMissense_Mutation10.55KNS60N000N
ALKNTAFSQSNPCENTRAL_NERVOUS_SYSTEM1477p.M1478Tc.4433T>CMissense_Mutation10.55KNS60N000N
ALKTAFSQSNPPCENTRAL_NERVOUS_SYSTEM1478p.M1478Tc.4433T>CMissense_Mutation10.55KNS60N000N
ALKVEGGHVNTACENTRAL_NERVOUS_SYSTEM1471p.M1478Tc.4433T>CMissense_Mutation10.55KNS60Y694N
ALKVNTAFSQSNCENTRAL_NERVOUS_SYSTEM1476p.M1478Tc.4433T>CMissense_Mutation10.55KNS60N000N
ALPK2AFKKFLTCPCENTRAL_NERVOUS_SYSTEM1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27A172N000N
ALPK2AFKKFLTCPCENTRAL_NERVOUS_SYSTEM1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27DKMGN000N
ALPK2AFKKFLTCPCENTRAL_NERVOUS_SYSTEM1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27GOS3N000N
ALPK2AFKKFLTCPCENTRAL_NERVOUS_SYSTEM1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HS683N000N
ALPK2AFKKFLTCPCENTRAL_NERVOUS_SYSTEM1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27LN18N000N
ALPK2AFKKFLTCPCENTRAL_NERVOUS_SYSTEM1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27M059KN000N
ALPK2AFKKFLTCPCENTRAL_NERVOUS_SYSTEM1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27MOGGUVWN000N
ALPK2AFKKFLTCPCENTRAL_NERVOUS_SYSTEM1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27SW1783N000N
ALPK2AFKKFLTCPCENTRAL_NERVOUS_SYSTEM1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27YH13N000N
ALPK2DHTAFKKFLCENTRAL_NERVOUS_SYSTEM1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27A172N600N
ALPK2DHTAFKKFLCENTRAL_NERVOUS_SYSTEM1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27DKMGN600N
ALPK2DHTAFKKFLCENTRAL_NERVOUS_SYSTEM1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27GOS3N600N
ALPK2DHTAFKKFLCENTRAL_NERVOUS_SYSTEM1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HS683N600N
ALPK2DHTAFKKFLCENTRAL_NERVOUS_SYSTEM1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27LN18N600N
ALPK2DHTAFKKFLCENTRAL_NERVOUS_SYSTEM1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27M059KN600N
ALPK2DHTAFKKFLCENTRAL_NERVOUS_SYSTEM1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27MOGGUVWN600N
ALPK2DHTAFKKFLCENTRAL_NERVOUS_SYSTEM1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27SW1783N600N
ALPK2DHTAFKKFLCENTRAL_NERVOUS_SYSTEM1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27YH13N600N
ALPK2HTAFKKFLTCENTRAL_NERVOUS_SYSTEM1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27A172N100N
ALPK2HTAFKKFLTCENTRAL_NERVOUS_SYSTEM1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27DKMGN100N
ALPK2HTAFKKFLTCENTRAL_NERVOUS_SYSTEM1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27GOS3N100N
ALPK2HTAFKKFLTCENTRAL_NERVOUS_SYSTEM1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HS683N100N
ALPK2HTAFKKFLTCENTRAL_NERVOUS_SYSTEM1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27LN18N100N
ALPK2HTAFKKFLTCENTRAL_NERVOUS_SYSTEM1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27M059KN100N
ALPK2HTAFKKFLTCENTRAL_NERVOUS_SYSTEM1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27MOGGUVWN100N
ALPK2HTAFKKFLTCENTRAL_NERVOUS_SYSTEM1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27SW1783N100N
ALPK2HTAFKKFLTCENTRAL_NERVOUS_SYSTEM1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27YH13N100N
ALPK2KMDHTAFKKCENTRAL_NERVOUS_SYSTEM1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27A172N600N
ALPK2KMDHTAFKKCENTRAL_NERVOUS_SYSTEM1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27DKMGN600N
ALPK2KMDHTAFKKCENTRAL_NERVOUS_SYSTEM1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27GOS3N600N
ALPK2KMDHTAFKKCENTRAL_NERVOUS_SYSTEM1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HS683N600N
ALPK2KMDHTAFKKCENTRAL_NERVOUS_SYSTEM1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27LN18N600N
ALPK2KMDHTAFKKCENTRAL_NERVOUS_SYSTEM1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27M059KN600N
ALPK2KMDHTAFKKCENTRAL_NERVOUS_SYSTEM1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27MOGGUVWN600N
ALPK2KMDHTAFKKCENTRAL_NERVOUS_SYSTEM1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27SW1783N600N
ALPK2KMDHTAFKKCENTRAL_NERVOUS_SYSTEM1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27YH13N600N
ALPK2LKMDHTAFKCENTRAL_NERVOUS_SYSTEM1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27A172N1017N
ALPK2LKMDHTAFKCENTRAL_NERVOUS_SYSTEM1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27DKMGN1017N
ALPK2LKMDHTAFKCENTRAL_NERVOUS_SYSTEM1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27GOS3N1017N
ALPK2LKMDHTAFKCENTRAL_NERVOUS_SYSTEM1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HS683N1017N
ALPK2LKMDHTAFKCENTRAL_NERVOUS_SYSTEM1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27LN18N1017N
ALPK2LKMDHTAFKCENTRAL_NERVOUS_SYSTEM1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27M059KN1017N
ALPK2LKMDHTAFKCENTRAL_NERVOUS_SYSTEM1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27MOGGUVWN1017N
ALPK2LKMDHTAFKCENTRAL_NERVOUS_SYSTEM1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27SW1783N1017N
ALPK2LKMDHTAFKCENTRAL_NERVOUS_SYSTEM1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27YH13N1017N
ALPK2MDHTAFKKFCENTRAL_NERVOUS_SYSTEM1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27A172N600N
ALPK2MDHTAFKKFCENTRAL_NERVOUS_SYSTEM1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27DKMGN600N
ALPK2MDHTAFKKFCENTRAL_NERVOUS_SYSTEM1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27GOS3N600N
ALPK2MDHTAFKKFCENTRAL_NERVOUS_SYSTEM1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HS683N600N
ALPK2MDHTAFKKFCENTRAL_NERVOUS_SYSTEM1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27LN18N600N
ALPK2MDHTAFKKFCENTRAL_NERVOUS_SYSTEM1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27M059KN600N
ALPK2MDHTAFKKFCENTRAL_NERVOUS_SYSTEM1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27MOGGUVWN600N
ALPK2MDHTAFKKFCENTRAL_NERVOUS_SYSTEM1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27SW1783N600N
ALPK2MDHTAFKKFCENTRAL_NERVOUS_SYSTEM1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27YH13N600N
ALPK2TAFKKFLTCCENTRAL_NERVOUS_SYSTEM1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27A172N600N
ALPK2TAFKKFLTCCENTRAL_NERVOUS_SYSTEM1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27DKMGN600N
ALPK2TAFKKFLTCCENTRAL_NERVOUS_SYSTEM1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27GOS3N600N
ALPK2TAFKKFLTCCENTRAL_NERVOUS_SYSTEM1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HS683N600N
ALPK2TAFKKFLTCCENTRAL_NERVOUS_SYSTEM1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27LN18N600N
ALPK2TAFKKFLTCCENTRAL_NERVOUS_SYSTEM1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27M059KN600N
ALPK2TAFKKFLTCCENTRAL_NERVOUS_SYSTEM1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27MOGGUVWN600N
ALPK2TAFKKFLTCCENTRAL_NERVOUS_SYSTEM1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27SW1783N600N
ALPK2TAFKKFLTCCENTRAL_NERVOUS_SYSTEM1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27YH13N600N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.7442MGBAY1140N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.748MGBAY1140N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74BECKERY1140N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74CAS1Y1140N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74D341MEDY1140N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74DAOYY1140N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74GMS10Y1140N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74H4Y1140N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74KNS42Y1140N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74MOGGCCMY1140N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74ONS76Y1140N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SF295Y1140N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SNU626Y1140N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SNU738Y1140N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74TM31Y1140N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74U138MGY1140N
ALPK2ATRETVTIACENTRAL_NERVOUS_SYSTEM1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74U87MGY1140N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.7442MGBAY2110N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.748MGBAY2110N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74BECKERY2110N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74CAS1Y2110N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74D341MEDY2110N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74DAOYY2110N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74GMS10Y2110N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74H4Y2110N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KNS42Y2110N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MOGGCCMY2110N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74ONS76Y2110N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SF295Y2110N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SNU626Y2110N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SNU738Y2110N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74TM31Y2110N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74U138MGY2110N
ALPK2CFQATRETVCENTRAL_NERVOUS_SYSTEM998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74U87MGY2110N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.7442MGBAN400N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.748MGBAN400N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74BECKERN400N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74CAS1N400N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74D341MEDN400N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74DAOYN400N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74GMS10N400N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74H4N400N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KNS42N400N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MOGGCCMN400N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74ONS76N400N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SF295N400N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SNU626N400N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SNU738N400N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74TM31N400N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74U138MGN400N
ALPK2ETVTIATEVCENTRAL_NERVOUS_SYSTEM1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74U87MGN400N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.7442MGBAN600N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.748MGBAN600N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74BECKERN600N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74CAS1N600N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74D341MEDN600N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74DAOYN600N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74GMS10N600N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74H4N600N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KNS42N600N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MOGGCCMN600N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74ONS76N600N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SF295N600N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SNU626N600N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SNU738N600N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74TM31N600N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74U138MGN600N
ALPK2FQATRETVTCENTRAL_NERVOUS_SYSTEM999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74U87MGN600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.7442MGBAN600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.748MGBAN600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74BECKERN600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74CAS1N600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74D341MEDN600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74DAOYN600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74GMS10N600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74H4N600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KNS42N600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MOGGCCMN600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74ONS76N600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SF295N600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SNU626N600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SNU738N600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74TM31N600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74U138MGN600N
ALPK2QATRETVTICENTRAL_NERVOUS_SYSTEM1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74U87MGN600N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.7442MGBAN100N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.748MGBAN100N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74BECKERN100N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74CAS1N100N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74D341MEDN100N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74DAOYN100N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74GMS10N100N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74H4N100N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KNS42N100N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MOGGCCMN100N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74ONS76N100N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SF295N100N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SNU626N100N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SNU738N100N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74TM31N100N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74U138MGN100N
ALPK2RETVTIATECENTRAL_NERVOUS_SYSTEM1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74U87MGN100N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.7442MGBAN200N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.748MGBAN200N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74BECKERN200N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74CAS1N200N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74D341MEDN200N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74DAOYN200N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74GMS10N200N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74H4N200N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KNS42N200N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MOGGCCMN200N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74ONS76N200N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SF295N200N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SNU626N200N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SNU738N200N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74TM31N200N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74U138MGN200N
ALPK2TRETVTIATCENTRAL_NERVOUS_SYSTEM1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74U87MGN200N
ATMETRKRILTICENTRAL_NERVOUS_SYSTEM2744p.K2749Ic.8246A>TMissense_Mutation10.22KNS60Y8160N
ATMILTICTYKVCENTRAL_NERVOUS_SYSTEM2749p.K2749Ic.8246A>TMissense_Mutation10.22KNS60Y8119N
ATMKRILTICTYCENTRAL_NERVOUS_SYSTEM2747p.K2749Ic.8246A>TMissense_Mutation10.22KNS60N600N
ATMNTETRKRILCENTRAL_NERVOUS_SYSTEM2742p.K2749Ic.8246A>TMissense_Mutation10.22KNS60N600N
ATMRILTICTYKCENTRAL_NERVOUS_SYSTEM2748p.K2749Ic.8246A>TMissense_Mutation10.22KNS60Y590N
ATMRKRILTICTCENTRAL_NERVOUS_SYSTEM2746p.K2749Ic.8246A>TMissense_Mutation10.22KNS60N100N
ATMRNTETRKRICENTRAL_NERVOUS_SYSTEM2741p.K2749Ic.8246A>TMissense_Mutation10.22KNS60N200N
ATMTETRKRILTCENTRAL_NERVOUS_SYSTEM2743p.K2749Ic.8246A>TMissense_Mutation10.22KNS60N600N
ATMTRKRILTICCENTRAL_NERVOUS_SYSTEM2745p.K2749Ic.8246A>TMissense_Mutation10.22KNS60N300N
BRAFAQSNPKSPQCENTRAL_NERVOUS_SYSTEM145p.R146Qc.437G>AMissense_Mutation10.11CCFSTTG1N000N
BRAFDVAQSNPKSCENTRAL_NERVOUS_SYSTEM143p.R146Qc.437G>AMissense_Mutation10.11CCFSTTG1N100N
BRAFFQNPTDVAQCENTRAL_NERVOUS_SYSTEM138p.R146Qc.437G>AMissense_Mutation10.11CCFSTTG1N200N
BRAFNPTDVAQSNCENTRAL_NERVOUS_SYSTEM140p.R146Qc.437G>AMissense_Mutation10.11CCFSTTG1N300N
BRAFPTDVAQSNPCENTRAL_NERVOUS_SYSTEM141p.R146Qc.437G>AMissense_Mutation10.11CCFSTTG1N000N
BRAFQNPTDVAQSCENTRAL_NERVOUS_SYSTEM139p.R146Qc.437G>AMissense_Mutation10.11CCFSTTG1N000N
BRAFQSNPKSPQKCENTRAL_NERVOUS_SYSTEM146p.R146Qc.437G>AMissense_Mutation10.11CCFSTTG1N200N
BRAFTDVAQSNPKCENTRAL_NERVOUS_SYSTEM142p.R146Qc.437G>AMissense_Mutation10.11CCFSTTG1N000N
BRAFVAQSNPKSPCENTRAL_NERVOUS_SYSTEM144p.R146Qc.437G>AMissense_Mutation10.11CCFSTTG1N000N
BRAFATEKSRWSGCENTRAL_NERVOUS_SYSTEM598p.V600Ec.1799T>AMissense_Mutation16.08AM38N000N
BRAFATEKSRWSGCENTRAL_NERVOUS_SYSTEM598p.V600Ec.1799T>AMissense_Mutation16.08DBTRG05MGN000N
BRAFATEKSRWSGCENTRAL_NERVOUS_SYSTEM598p.V600Ec.1799T>AMissense_Mutation16.08NMCG1N000N
BRAFDFGLATEKSCENTRAL_NERVOUS_SYSTEM594p.V600Ec.1799T>AMissense_Mutation16.08AM38N000N
BRAFDFGLATEKSCENTRAL_NERVOUS_SYSTEM594p.V600Ec.1799T>AMissense_Mutation16.08DBTRG05MGN000N
BRAFDFGLATEKSCENTRAL_NERVOUS_SYSTEM594p.V600Ec.1799T>AMissense_Mutation16.08NMCG1N000N
BRAFEKSRWSGSHCENTRAL_NERVOUS_SYSTEM600p.V600Ec.1799T>AMissense_Mutation16.08AM38N100N
BRAFEKSRWSGSHCENTRAL_NERVOUS_SYSTEM600p.V600Ec.1799T>AMissense_Mutation16.08DBTRG05MGN100N
BRAFEKSRWSGSHCENTRAL_NERVOUS_SYSTEM600p.V600Ec.1799T>AMissense_Mutation16.08NMCG1N100N
BRAFFGLATEKSRCENTRAL_NERVOUS_SYSTEM595p.V600Ec.1799T>AMissense_Mutation16.08AM38N302N
BRAFFGLATEKSRCENTRAL_NERVOUS_SYSTEM595p.V600Ec.1799T>AMissense_Mutation16.08DBTRG05MGN302N
BRAFFGLATEKSRCENTRAL_NERVOUS_SYSTEM595p.V600Ec.1799T>AMissense_Mutation16.08NMCG1N302N
BRAFGDFGLATEKCENTRAL_NERVOUS_SYSTEM593p.V600Ec.1799T>AMissense_Mutation16.08AM38N100N
BRAFGDFGLATEKCENTRAL_NERVOUS_SYSTEM593p.V600Ec.1799T>AMissense_Mutation16.08DBTRG05MGN100N
BRAFGDFGLATEKCENTRAL_NERVOUS_SYSTEM593p.V600Ec.1799T>AMissense_Mutation16.08NMCG1N100N
BRAFGLATEKSRWCENTRAL_NERVOUS_SYSTEM596p.V600Ec.1799T>AMissense_Mutation16.08AM38N400N
BRAFGLATEKSRWCENTRAL_NERVOUS_SYSTEM596p.V600Ec.1799T>AMissense_Mutation16.08DBTRG05MGN400N
BRAFGLATEKSRWCENTRAL_NERVOUS_SYSTEM596p.V600Ec.1799T>AMissense_Mutation16.08NMCG1N400N
BRAFIGDFGLATECENTRAL_NERVOUS_SYSTEM592p.V600Ec.1799T>AMissense_Mutation16.08AM38N000N
BRAFIGDFGLATECENTRAL_NERVOUS_SYSTEM592p.V600Ec.1799T>AMissense_Mutation16.08DBTRG05MGN000N
BRAFIGDFGLATECENTRAL_NERVOUS_SYSTEM592p.V600Ec.1799T>AMissense_Mutation16.08NMCG1N000N
BRAFLATEKSRWSCENTRAL_NERVOUS_SYSTEM597p.V600Ec.1799T>AMissense_Mutation16.08AM38N200N
BRAFLATEKSRWSCENTRAL_NERVOUS_SYSTEM597p.V600Ec.1799T>AMissense_Mutation16.08DBTRG05MGN200N
BRAFLATEKSRWSCENTRAL_NERVOUS_SYSTEM597p.V600Ec.1799T>AMissense_Mutation16.08NMCG1N200N
BRAFTEKSRWSGSCENTRAL_NERVOUS_SYSTEM599p.V600Ec.1799T>AMissense_Mutation16.08AM38N300N
BRAFTEKSRWSGSCENTRAL_NERVOUS_SYSTEM599p.V600Ec.1799T>AMissense_Mutation16.08DBTRG05MGN300N
BRAFTEKSRWSGSCENTRAL_NERVOUS_SYSTEM599p.V600Ec.1799T>AMissense_Mutation16.08NMCG1N300N
CARD10DIFRCRGKRCENTRAL_NERVOUS_SYSTEM83p.L85Fc.255G>TMissense_Mutation10.11SNU738N400N
CARD10FRCRGKRGYCENTRAL_NERVOUS_SYSTEM85p.L85Fc.255G>TMissense_Mutation10.11SNU738N6022N
CARD10GRLMDIFRCCENTRAL_NERVOUS_SYSTEM79p.L85Fc.255G>TMissense_Mutation10.11SNU738N300N
CARD10IFRCRGKRGCENTRAL_NERVOUS_SYSTEM84p.L85Fc.255G>TMissense_Mutation10.11SNU738N000N
CARD10LMDIFRCRGCENTRAL_NERVOUS_SYSTEM81p.L85Fc.255G>TMissense_Mutation10.11SNU738N100N
CARD10MDIFRCRGKCENTRAL_NERVOUS_SYSTEM82p.L85Fc.255G>TMissense_Mutation10.11SNU738Y0116N
CARD10RLMDIFRCRCENTRAL_NERVOUS_SYSTEM80p.L85Fc.255G>TMissense_Mutation10.11SNU738Y590N
CARD10RTGRLMDIFCENTRAL_NERVOUS_SYSTEM77p.L85Fc.255G>TMissense_Mutation10.11SNU738N800N
CARD10TGRLMDIFRCENTRAL_NERVOUS_SYSTEM78p.L85Fc.255G>TMissense_Mutation10.11SNU738N100N
CBLHHHHHHHHLCENTRAL_NERVOUS_SYSTEM36p.42_43insHc.105_106insCACIn_Frame_Ins10.11GOS3N500Y
CBLPHHHHHHHHCENTRAL_NERVOUS_SYSTEM35p.42_43insHc.105_106insCACIn_Frame_Ins10.11GOS3N000Y
CBLCGLEAMALKCENTRAL_NERVOUS_SYSTEM217p.S217Cc.650C>GMissense_Mutation10.11KS1N000N
CBLEVHPISCGLCENTRAL_NERVOUS_SYSTEM211p.S217Cc.650C>GMissense_Mutation10.11KS1N1000N
CBLHEVHPISCGCENTRAL_NERVOUS_SYSTEM210p.S217Cc.650C>GMissense_Mutation10.11KS1N200N
CBLHPISCGLEACENTRAL_NERVOUS_SYSTEM213p.S217Cc.650C>GMissense_Mutation10.11KS1N900N
CBLISCGLEAMACENTRAL_NERVOUS_SYSTEM215p.S217Cc.650C>GMissense_Mutation10.11KS1N300N
CBLLHEVHPISCCENTRAL_NERVOUS_SYSTEM209p.S217Cc.650C>GMissense_Mutation10.11KS1N200N
CBLPISCGLEAMCENTRAL_NERVOUS_SYSTEM214p.S217Cc.650C>GMissense_Mutation10.11KS1N000N
CBLSCGLEAMALCENTRAL_NERVOUS_SYSTEM216p.S217Cc.650C>GMissense_Mutation10.11KS1N400N
CBLVHPISCGLECENTRAL_NERVOUS_SYSTEM212p.S217Cc.650C>GMissense_Mutation10.11KS1N000N
CHD1DQRSYGSRSCENTRAL_NERVOUS_SYSTEM1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86DBTRG05MGN100N
CHD1DQRSYGSRSCENTRAL_NERVOUS_SYSTEM1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86GOS3N100N
CHD1DQRSYGSRSCENTRAL_NERVOUS_SYSTEM1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86LN229N100N
CHD1DQRSYGSRSCENTRAL_NERVOUS_SYSTEM1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86M059KN100N
CHD1DQRSYGSRSCENTRAL_NERVOUS_SYSTEM1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86MOGGCCMN100N
CHD1LDQRSYGSRCENTRAL_NERVOUS_SYSTEM1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86DBTRG05MGN000N
CHD1LDQRSYGSRCENTRAL_NERVOUS_SYSTEM1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86GOS3N000N
CHD1LDQRSYGSRCENTRAL_NERVOUS_SYSTEM1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86LN229N000N
CHD1LDQRSYGSRCENTRAL_NERVOUS_SYSTEM1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86M059KN000N
CHD1LDQRSYGSRCENTRAL_NERVOUS_SYSTEM1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86MOGGCCMN000N
CHD1PLDQRSYGSCENTRAL_NERVOUS_SYSTEM1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86DBTRG05MGN000N
CHD1PLDQRSYGSCENTRAL_NERVOUS_SYSTEM1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86GOS3N000N
CHD1PLDQRSYGSCENTRAL_NERVOUS_SYSTEM1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86LN229N000N
CHD1PLDQRSYGSCENTRAL_NERVOUS_SYSTEM1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86M059KN000N
CHD1PLDQRSYGSCENTRAL_NERVOUS_SYSTEM1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86MOGGCCMN000N
CHD1QRSYGSRSPCENTRAL_NERVOUS_SYSTEM1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86DBTRG05MGN000N
CHD1QRSYGSRSPCENTRAL_NERVOUS_SYSTEM1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86GOS3N000N
CHD1QRSYGSRSPCENTRAL_NERVOUS_SYSTEM1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86LN229N000N
CHD1QRSYGSRSPCENTRAL_NERVOUS_SYSTEM1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86M059KN000N
CHD1QRSYGSRSPCENTRAL_NERVOUS_SYSTEM1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86MOGGCCMN000N
CHD1RSPLDQRSYCENTRAL_NERVOUS_SYSTEM1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86DBTRG05MGN600N
CHD1RSPLDQRSYCENTRAL_NERVOUS_SYSTEM1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86GOS3N600N
CHD1RSPLDQRSYCENTRAL_NERVOUS_SYSTEM1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86LN229N600N
CHD1RSPLDQRSYCENTRAL_NERVOUS_SYSTEM1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86M059KN600N
CHD1RSPLDQRSYCENTRAL_NERVOUS_SYSTEM1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86MOGGCCMN600N
CHD1RSYGSRSPFCENTRAL_NERVOUS_SYSTEM1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86DBTRG05MGN900N
CHD1RSYGSRSPFCENTRAL_NERVOUS_SYSTEM1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86GOS3N900N
CHD1RSYGSRSPFCENTRAL_NERVOUS_SYSTEM1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86LN229N900N
CHD1RSYGSRSPFCENTRAL_NERVOUS_SYSTEM1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86M059KN900N
CHD1RSYGSRSPFCENTRAL_NERVOUS_SYSTEM1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86MOGGCCMN900N
CHD1SPLDQRSYGCENTRAL_NERVOUS_SYSTEM1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86DBTRG05MGN000N
CHD1SPLDQRSYGCENTRAL_NERVOUS_SYSTEM1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86GOS3N000N
CHD1SPLDQRSYGCENTRAL_NERVOUS_SYSTEM1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86LN229N000N
CHD1SPLDQRSYGCENTRAL_NERVOUS_SYSTEM1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86M059KN000N
CHD1SPLDQRSYGCENTRAL_NERVOUS_SYSTEM1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86MOGGCCMN000N
CHD1SYGSRSPFECENTRAL_NERVOUS_SYSTEM1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86DBTRG05MGN000N
CHD1SYGSRSPFECENTRAL_NERVOUS_SYSTEM1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86GOS3N000N
CHD1SYGSRSPFECENTRAL_NERVOUS_SYSTEM1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86LN229N000N
CHD1SYGSRSPFECENTRAL_NERVOUS_SYSTEM1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86M059KN000N
CHD1SYGSRSPFECENTRAL_NERVOUS_SYSTEM1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86MOGGCCMN000N
CHD1AEIRRFIKICENTRAL_NERVOUS_SYSTEM1129p.S1137Ic.3410G>TMissense_Mutation10.11DBTRG05MGY9130N
CHD1EIRRFIKIYCENTRAL_NERVOUS_SYSTEM1130p.S1137Ic.3410G>TMissense_Mutation10.11DBTRG05MGY490N
CHD1FIKIYKKFGCENTRAL_NERVOUS_SYSTEM1134p.S1137Ic.3410G>TMissense_Mutation10.11DBTRG05MGN2010N
CHD1IKIYKKFGGCENTRAL_NERVOUS_SYSTEM1135p.S1137Ic.3410G>TMissense_Mutation10.11DBTRG05MGN0025N
CHD1IRRFIKIYKCENTRAL_NERVOUS_SYSTEM1131p.S1137Ic.3410G>TMissense_Mutation10.11DBTRG05MGY21238N
CHD1IYKKFGGPLCENTRAL_NERVOUS_SYSTEM1137p.S1137Ic.3410G>TMissense_Mutation10.11DBTRG05MGY890N
CHD1KIYKKFGGPCENTRAL_NERVOUS_SYSTEM1136p.S1137Ic.3410G>TMissense_Mutation10.11DBTRG05MGN000N
CHD1RFIKIYKKFCENTRAL_NERVOUS_SYSTEM1133p.S1137Ic.3410G>TMissense_Mutation10.11DBTRG05MGY8100N
CHD1RRFIKIYKKCENTRAL_NERVOUS_SYSTEM1132p.S1137Ic.3410G>TMissense_Mutation10.11DBTRG05MGY4100N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.4742MGBAN801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47AM38N801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47GAMGN801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47GI1N801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47H4N801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47HS683N801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47KNS42N801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47KNS60N801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47KS1N801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47M059KN801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47MOGGCCMN801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47NMCG1N801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47ONS76N801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47SF126N801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47SNU1105N801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47SNU466N801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47SNU489N801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47SNU626N801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47SW1088N801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47U138MGN801N
CREB3L2FTHITSDSFCENTRAL_NERVOUS_SYSTEM95p.T100delc.299_301delCCAIn_Frame_Del444.47YH13N801N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.4742MGBAN000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47AM38N000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47GAMGN000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47GI1N000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47H4N000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47HS683N000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47KNS42N000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47KNS60N000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47KS1N000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47M059KN000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47MOGGCCMN000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47NMCG1N000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47ONS76N000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47SF126N000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47SNU1105N000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47SNU466N000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47SNU489N000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47SNU626N000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47SW1088N000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47U138MGN000N
CREB3L2HITSDSFNDCENTRAL_NERVOUS_SYSTEM97p.T100delc.299_301delCCAIn_Frame_Del244.47YH13N000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.4742MGBAN000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47AM38N000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47GAMGN000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47GI1N000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47H4N000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47HS683N000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47KNS42N000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47KNS60N000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47KS1N000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47M059KN000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47MOGGCCMN000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47NMCG1N000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47ONS76N000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47SF126N000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47SNU1105N000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47SNU466N000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47SNU489N000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47SNU626N000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47SW1088N000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47U138MGN000N
CREB3L2ITSDSFNDDCENTRAL_NERVOUS_SYSTEM98p.T100delc.299_301delCCAIn_Frame_Del144.47YH13N000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.4742MGBAN000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47AM38N000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47GAMGN000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47GI1N000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47H4N000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47HS683N000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47KNS42N000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47KNS60N000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47KS1N000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47M059KN000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47MOGGCCMN000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47NMCG1N000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47ONS76N000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47SF126N000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47SNU1105N000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47SNU466N000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47SNU489N000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47SNU626N000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47SW1088N000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47U138MGN000N
CREB3L2PFTHITSDSCENTRAL_NERVOUS_SYSTEM94p.T100delc.299_301delCCAIn_Frame_Del344.47YH13N000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.4742MGBAN000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47AM38N000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47GAMGN000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47GI1N000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47H4N000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47HS683N000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47KNS42N000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47KNS60N000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47KS1N000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47M059KN000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47MOGGCCMN000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47NMCG1N000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47ONS76N000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47SF126N000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47SNU1105N000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47SNU466N000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47SNU489N000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47SNU626N000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47SW1088N000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47U138MGN000N
CREB3L2QSPFTHITSCENTRAL_NERVOUS_SYSTEM92p.T100delc.299_301delCCAIn_Frame_Del144.47YH13N000N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.4742MGBAN100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47AM38N100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47GAMGN100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47GI1N100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47H4N100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47HS683N100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47KNS42N100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47KNS60N100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47KS1N100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47M059KN100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47MOGGCCMN100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47NMCG1N100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47ONS76N100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47SF126N100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47SNU1105N100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47SNU466N100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47SNU489N100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47SNU626N100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47SW1088N100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47U138MGN100N
CREB3L2SPFTHITSDCENTRAL_NERVOUS_SYSTEM93p.T100delc.299_301delCCAIn_Frame_Del244.47YH13N100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.4742MGBAN100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47AM38N100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47GAMGN100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47GI1N100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47H4N100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47HS683N100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47KNS42N100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47KNS60N100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47KS1N100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47M059KN100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47MOGGCCMN100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47NMCG1N100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47ONS76N100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47SF126N100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47SNU1105N100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47SNU466N100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47SNU489N100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47SNU626N100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47SW1088N100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47U138MGN100N
CREB3L2THITSDSFNCENTRAL_NERVOUS_SYSTEM96p.T100delc.299_301delCCAIn_Frame_Del344.47YH13N100N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.348MGBAN300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34A172N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34AM38N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34CAS1N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34CCFSTTG1N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34DKMGN300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34GMS10N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34GOS3N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34HS683N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34KALS1N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34MOGGCCMN300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34MOGGUVWN300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SF295N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SNU1105N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SNU201N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SNU466N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SNU489N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SNU626N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SNU738N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SW1783N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34T98GN300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34TM31N300N
CTBP2APSPNQPTNCENTRAL_NERVOUS_SYSTEM966p.K974fsc.2922_2922delAFrame_Shift_Del124.34U138MGN300N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.348MGBAN100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34A172N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34AM38N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAS1N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34CCFSTTG1N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34DKMGN100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34GMS10N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34GOS3N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS683N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34KALS1N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34MOGGCCMN100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34MOGGUVWN100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SF295N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU1105N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU201N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU466N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU489N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU626N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU738N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW1783N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34T98GN100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34TM31N100N
CTBP2GTIESTPTSCENTRAL_NERVOUS_SYSTEM976p.K974fsc.2922_2922delAFrame_Shift_Del524.34U138MGN100N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.348MGBAN1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34A172N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34AM38N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34CAS1N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34CCFSTTG1N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34DKMGN1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34GMS10N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34GOS3N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34HS683N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34KALS1N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34MOGGCCMN1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34MOGGUVWN1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SF295N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SNU1105N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SNU201N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SNU466N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SNU489N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SNU626N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SNU738N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SW1783N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34T98GN1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34TM31N1000N
CTBP2NQPTNTGTICENTRAL_NERVOUS_SYSTEM970p.K974fsc.2922_2922delAFrame_Shift_Del424.34U138MGN1000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.348MGBAN000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34A172N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34AM38N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAS1N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34CCFSTTG1N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34DKMGN000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34GMS10N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34GOS3N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS683N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34KALS1N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34MOGGCCMN000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34MOGGUVWN000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SF295N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU1105N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU201N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU466N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU489N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU626N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU738N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW1783N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34T98GN000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34TM31N000N
CTBP2NTGTIESTPCENTRAL_NERVOUS_SYSTEM974p.K974fsc.2922_2922delAFrame_Shift_Del524.34U138MGN000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.348MGBAN000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34A172N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34AM38N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34CAS1N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34CCFSTTG1N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34DKMGN000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34GMS10N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34GOS3N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34HS683N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34KALS1N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34MOGGCCMN000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34MOGGUVWN000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SF295N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SNU1105N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SNU201N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SNU466N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SNU489N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SNU626N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SNU738N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SW1783N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34T98GN000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34TM31N000N
CTBP2PNQPTNTGTCENTRAL_NERVOUS_SYSTEM969p.K974fsc.2922_2922delAFrame_Shift_Del324.34U138MGN000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.348MGBAN000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34A172N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34AM38N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34CAS1N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34CCFSTTG1N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34DKMGN000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34GMS10N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34GOS3N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34HS683N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34KALS1N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34MOGGCCMN000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34MOGGUVWN000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SF295N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU1105N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU201N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU466N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU489N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU626N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU738N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SW1783N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34T98GN000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34TM31N000N
CTBP2PSPNQPTNTCENTRAL_NERVOUS_SYSTEM967p.K974fsc.2922_2922delAFrame_Shift_Del224.34U138MGN000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.348MGBAN000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34A172N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34AM38N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAS1N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34CCFSTTG1N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34DKMGN000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34GMS10N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34GOS3N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS683N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34KALS1N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34MOGGCCMN000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34MOGGUVWN000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SF295N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU1105N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU201N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU466N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU489N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU626N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU738N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW1783N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34T98GN000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34TM31N000N
CTBP2PTNTGTIESCENTRAL_NERVOUS_SYSTEM972p.K974fsc.2922_2922delAFrame_Shift_Del524.34U138MGN000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.348MGBAN000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34A172N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34AM38N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAS1N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34CCFSTTG1N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34DKMGN000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34GMS10N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34GOS3N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS683N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34KALS1N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34MOGGCCMN000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34MOGGUVWN000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SF295N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU1105N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU201N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU466N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU489N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU626N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU738N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW1783N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34T98GN000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34TM31N000N
CTBP2QPTNTGTIECENTRAL_NERVOUS_SYSTEM971p.K974fsc.2922_2922delAFrame_Shift_Del524.34U138MGN000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.348MGBAN000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34A172N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34AM38N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34CAS1N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34CCFSTTG1N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34DKMGN000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34GMS10N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34GOS3N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34HS683N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34KALS1N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34MOGGCCMN000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34MOGGUVWN000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SF295N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU1105N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU201N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU466N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU489N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU626N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SNU738N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SW1783N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34T98GN000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34TM31N000N
CTBP2SPNQPTNTGCENTRAL_NERVOUS_SYSTEM968p.K974fsc.2922_2922delAFrame_Shift_Del224.34U138MGN000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.348MGBAN000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34A172N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34AM38N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAS1N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34CCFSTTG1N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34DKMGN000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34GMS10N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34GOS3N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS683N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34KALS1N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34MOGGCCMN000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34MOGGUVWN000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SF295N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU1105N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU201N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU466N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU489N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU626N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU738N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW1783N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34T98GN000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34TM31N000N
CTBP2TGTIESTPTCENTRAL_NERVOUS_SYSTEM975p.K974fsc.2922_2922delAFrame_Shift_Del524.34U138MGN000N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.348MGBAN100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34A172N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34AM38N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAS1N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34CCFSTTG1N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34DKMGN100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34GMS10N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34GOS3N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS683N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34KALS1N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34MOGGCCMN100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34MOGGUVWN100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SF295N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU1105N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU201N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU466N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU489N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU626N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU738N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW1783N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34T98GN100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34TM31N100N
CTBP2TIESTPTSNCENTRAL_NERVOUS_SYSTEM977p.K974fsc.2922_2922delAFrame_Shift_Del524.34U138MGN100N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.348MGBAN000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34A172N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34AM38N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAS1N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34CCFSTTG1N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34DKMGN000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34GMS10N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34GOS3N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS683N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34KALS1N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34MOGGCCMN000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34MOGGUVWN000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SF295N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU1105N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU201N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU466N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU489N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU626N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SNU738N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW1783N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34T98GN000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34TM31N000N
CTBP2TNTGTIESTCENTRAL_NERVOUS_SYSTEM973p.K974fsc.2922_2922delAFrame_Shift_Del524.34U138MGN000N
CTBP2ATTYSAPGVCENTRAL_NERVOUS_SYSTEM418p.A419Tc.1255G>AMissense_Mutation10.22GI1N200N
CTBP2ETATTYSAPCENTRAL_NERVOUS_SYSTEM416p.A419Tc.1255G>AMissense_Mutation10.22GI1N000N
CTBP2HLLETATTYCENTRAL_NERVOUS_SYSTEM413p.A419Tc.1255G>AMissense_Mutation10.22GI1N600N
CTBP2LETATTYSACENTRAL_NERVOUS_SYSTEM415p.A419Tc.1255G>AMissense_Mutation10.22GI1N703N
CTBP2LLETATTYSCENTRAL_NERVOUS_SYSTEM414p.A419Tc.1255G>AMissense_Mutation10.22GI1N106N
CTBP2QHLLETATTCENTRAL_NERVOUS_SYSTEM412p.A419Tc.1255G>AMissense_Mutation10.22GI1N100N
CTBP2SQHLLETATCENTRAL_NERVOUS_SYSTEM411p.A419Tc.1255G>AMissense_Mutation10.22GI1N200N
CTBP2TATTYSAPGCENTRAL_NERVOUS_SYSTEM417p.A419Tc.1255G>AMissense_Mutation10.22GI1N000N
CTBP2TTYSAPGVGCENTRAL_NERVOUS_SYSTEM419p.A419Tc.1255G>AMissense_Mutation10.22GI1N000Y
EGFRATCLKKCPRCENTRAL_NERVOUS_SYSTEM289p.V292Lc.874G>CMissense_Mutation10.11KNS60N400N
EGFRCLKKCPRNYCENTRAL_NERVOUS_SYSTEM291p.V292Lc.874G>CMissense_Mutation10.11KNS60Y4140N
EGFRCLVCRKFRGCENTRAL_NERVOUS_SYSTEM248p.D256Gc.767A>GMissense_Mutation10.11GOS3N000N
EGFRCRKFRGEATCENTRAL_NERVOUS_SYSTEM251p.D256Gc.767A>GMissense_Mutation10.11GOS3N300N
EGFRDTCVKKCPRCENTRAL_NERVOUS_SYSTEM289p.A289Dc.866C>AMissense_Mutation10.11HS683N400N
EGFREGEKVKIPICENTRAL_NERVOUS_SYSTEM734p.V742Ic.2224G>AMissense_Mutation10.11SNU1105N800N
EGFREGKYSFGDTCENTRAL_NERVOUS_SYSTEM282p.A289Dc.866C>AMissense_Mutation10.11HS683N000N
EGFREKVKIPIAICENTRAL_NERVOUS_SYSTEM736p.V742Ic.2224G>AMissense_Mutation10.11SNU1105N500N
EGFRFGATCLKKCCENTRAL_NERVOUS_SYSTEM287p.V292Lc.874G>CMissense_Mutation10.11KNS60N400N
EGFRFGDTCVKKCCENTRAL_NERVOUS_SYSTEM287p.A289Dc.866C>AMissense_Mutation10.11HS683N400N
EGFRFRGEATCKDCENTRAL_NERVOUS_SYSTEM254p.D256Gc.767A>GMissense_Mutation10.11GOS3N209N
EGFRGATCLKKCPCENTRAL_NERVOUS_SYSTEM288p.V292Lc.874G>CMissense_Mutation10.11KNS60N000N
EGFRGDTCVKKCPCENTRAL_NERVOUS_SYSTEM288p.A289Dc.866C>AMissense_Mutation10.11HS683N000N
EGFRGEATCKDTCCENTRAL_NERVOUS_SYSTEM256p.D256Gc.767A>GMissense_Mutation10.11GOS3N500N
EGFRGEKVKIPIACENTRAL_NERVOUS_SYSTEM735p.V742Ic.2224G>AMissense_Mutation10.11SNU1105N600N
EGFRGKYSFGDTCCENTRAL_NERVOUS_SYSTEM283p.A289Dc.866C>AMissense_Mutation10.11HS683N100N
EGFRIAIKELREACENTRAL_NERVOUS_SYSTEM742p.V742Ic.2224G>AMissense_Mutation10.11SNU1105N6017N
EGFRIPIAIKELRCENTRAL_NERVOUS_SYSTEM740p.V742Ic.2224G>AMissense_Mutation10.11SNU1105N600N
EGFRKFRGEATCKCENTRAL_NERVOUS_SYSTEM253p.D256Gc.767A>GMissense_Mutation10.11GOS3N100N
EGFRKIPIAIKELCENTRAL_NERVOUS_SYSTEM739p.V742Ic.2224G>AMissense_Mutation10.11SNU1105Y1290N
EGFRKVKIPIAIKCENTRAL_NERVOUS_SYSTEM737p.V742Ic.2224G>AMissense_Mutation10.11SNU1105Y5120N
EGFRKYSFGATCLCENTRAL_NERVOUS_SYSTEM284p.V292Lc.874G>CMissense_Mutation10.11KNS60Y6100Y
EGFRKYSFGDTCVCENTRAL_NERVOUS_SYSTEM284p.A289Dc.866C>AMissense_Mutation10.11HS683Y4100N
EGFRLKKCPRNYVCENTRAL_NERVOUS_SYSTEM292p.V292Lc.874G>CMissense_Mutation10.11KNS60N501N
EGFRLVCRKFRGECENTRAL_NERVOUS_SYSTEM249p.D256Gc.767A>GMissense_Mutation10.11GOS3N005N
EGFRPEGKYSFGDCENTRAL_NERVOUS_SYSTEM281p.A289Dc.866C>AMissense_Mutation10.11HS683N000N
EGFRPIAIKELRECENTRAL_NERVOUS_SYSTEM741p.V742Ic.2224G>AMissense_Mutation10.11SNU1105N000N
EGFRRGEATCKDTCENTRAL_NERVOUS_SYSTEM255p.D256Gc.767A>GMissense_Mutation10.11GOS3N000N
EGFRRKFRGEATCCENTRAL_NERVOUS_SYSTEM252p.D256Gc.767A>GMissense_Mutation10.11GOS3N100N
EGFRSFGATCLKKCENTRAL_NERVOUS_SYSTEM286p.V292Lc.874G>CMissense_Mutation10.11KNS60N100N
EGFRSFGDTCVKKCENTRAL_NERVOUS_SYSTEM286p.A289Dc.866C>AMissense_Mutation10.11HS683Y190N
EGFRTCLKKCPRNCENTRAL_NERVOUS_SYSTEM290p.V292Lc.874G>CMissense_Mutation10.11KNS60N000N
EGFRVCRKFRGEACENTRAL_NERVOUS_SYSTEM250p.D256Gc.767A>GMissense_Mutation10.11GOS3N304N
EGFRVKIPIAIKECENTRAL_NERVOUS_SYSTEM738p.V742Ic.2224G>AMissense_Mutation10.11SNU1105N001N
EGFRYSFGATCLKCENTRAL_NERVOUS_SYSTEM285p.V292Lc.874G>CMissense_Mutation10.11KNS60N500N
EGFRYSFGDTCVKCENTRAL_NERVOUS_SYSTEM285p.A289Dc.866C>AMissense_Mutation10.11HS683N500N
ERBB2AIKVSRENTCENTRAL_NERVOUS_SYSTEM751p.L755Sc.2264T>CMissense_Mutation10.33LN229N000N
ERBB2IKVSRENTSCENTRAL_NERVOUS_SYSTEM752p.L755Sc.2264T>CMissense_Mutation10.33LN229N204N
ERBB2IPVAIKVSRCENTRAL_NERVOUS_SYSTEM748p.L755Sc.2264T>CMissense_Mutation10.33LN229N700N
ERBB2KIPVAIKVSCENTRAL_NERVOUS_SYSTEM747p.L755Sc.2264T>CMissense_Mutation10.33LN229N100N
ERBB2KVSRENTSPCENTRAL_NERVOUS_SYSTEM753p.L755Sc.2264T>CMissense_Mutation10.33LN229N000N
ERBB2PVAIKVSRECENTRAL_NERVOUS_SYSTEM749p.L755Sc.2264T>CMissense_Mutation10.33LN229N000N
ERBB2SRENTSPKACENTRAL_NERVOUS_SYSTEM755p.L755Sc.2264T>CMissense_Mutation10.33LN229N200N
ERBB2VAIKVSRENCENTRAL_NERVOUS_SYSTEM750p.L755Sc.2264T>CMissense_Mutation10.33LN229N2012N
ERBB2VSRENTSPKCENTRAL_NERVOUS_SYSTEM754p.L755Sc.2264T>CMissense_Mutation10.33LN229N103N
FBXW7GSKRRRTPGCENTRAL_NERVOUS_SYSTEM9p.15_16insPc.45_46insCCTIn_Frame_Ins10.11GAMGN100N
FBXW7KRRRTPGGSCENTRAL_NERVOUS_SYSTEM11p.15_16insPc.45_46insCCTIn_Frame_Ins30.11GAMGN200Y
FBXW7PGGSLRGNPCENTRAL_NERVOUS_SYSTEM16p.15_16insPc.45_46insCCTIn_Frame_Ins10.11GAMGN000N
FBXW7RRRTPGGSLCENTRAL_NERVOUS_SYSTEM12p.15_16insPc.45_46insCCTIn_Frame_Ins30.11GAMGN500N
FBXW7RRTPGGSLRCENTRAL_NERVOUS_SYSTEM13p.15_16insPc.45_46insCCTIn_Frame_Ins20.11GAMGY390Y
FBXW7RTPGGSLRGCENTRAL_NERVOUS_SYSTEM14p.15_16insPc.45_46insCCTIn_Frame_Ins20.11GAMGN000N
FBXW7SKRRRTPGGCENTRAL_NERVOUS_SYSTEM10p.15_16insPc.45_46insCCTIn_Frame_Ins20.11GAMGN000N
FBXW7TPGGSLRGNCENTRAL_NERVOUS_SYSTEM15p.15_16insPc.45_46insCCTIn_Frame_Ins20.11GAMGN300N
FBXW7VGSKRRRTPCENTRAL_NERVOUS_SYSTEM8p.15_16insPc.45_46insCCTIn_Frame_Ins10.11GAMGN0014N
FMN2LPPLPGAAICENTRAL_NERVOUS_SYSTEM934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.0342MGBAN1401N
FMN2LPPLPGAAICENTRAL_NERVOUS_SYSTEM934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03BECKERN1401N
FMN2LPPLPGAAICENTRAL_NERVOUS_SYSTEM934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03GMS10N1401N
FMN2LPPLPGAAICENTRAL_NERVOUS_SYSTEM934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03HS683N1401N
FMN2LPPLPGAAICENTRAL_NERVOUS_SYSTEM934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03KALS1N1401N
FMN2LPPLPGAAICENTRAL_NERVOUS_SYSTEM934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03LN229N1401N
FMN2LPPLPGAAICENTRAL_NERVOUS_SYSTEM934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03NMCG1N1401N
FMN2LPPLPGAAICENTRAL_NERVOUS_SYSTEM934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03SF295N1401N
FMN2LPPLPGAAICENTRAL_NERVOUS_SYSTEM934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03SNU466N1401N
FMN2LPPLPGAAICENTRAL_NERVOUS_SYSTEM934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03T98GN1401N
FMN2LPPLPGAAICENTRAL_NERVOUS_SYSTEM934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03U138MGN1401N
FMN2LPPLPGAAICENTRAL_NERVOUS_SYSTEM934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03U87MGN1401N
FMN2LPPLPGAAICENTRAL_NERVOUS_SYSTEM934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03YKG1N1401N
FMN2PLPPLPGAACENTRAL_NERVOUS_SYSTEM933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.0342MGBAN000N
FMN2PLPPLPGAACENTRAL_NERVOUS_SYSTEM933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03BECKERN000N
FMN2PLPPLPGAACENTRAL_NERVOUS_SYSTEM933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03GMS10N000N
FMN2PLPPLPGAACENTRAL_NERVOUS_SYSTEM933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03HS683N000N
FMN2PLPPLPGAACENTRAL_NERVOUS_SYSTEM933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03KALS1N000N
FMN2PLPPLPGAACENTRAL_NERVOUS_SYSTEM933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03LN229N000N
FMN2PLPPLPGAACENTRAL_NERVOUS_SYSTEM933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03NMCG1N000N
FMN2PLPPLPGAACENTRAL_NERVOUS_SYSTEM933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03SF295N000N
FMN2PLPPLPGAACENTRAL_NERVOUS_SYSTEM933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03SNU466N000N
FMN2PLPPLPGAACENTRAL_NERVOUS_SYSTEM933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03T98GN000N
FMN2PLPPLPGAACENTRAL_NERVOUS_SYSTEM933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03U138MGN000N
FMN2PLPPLPGAACENTRAL_NERVOUS_SYSTEM933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03U87MGN000N
FMN2PLPPLPGAACENTRAL_NERVOUS_SYSTEM933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03YKG1N000N
FMN2DTNIYSFHSCENTRAL_NERVOUS_SYSTEM180p.D182Nc.544G>AMissense_Mutation10.11LN229N000N
FMN2GSDTNIYSFCENTRAL_NERVOUS_SYSTEM178p.D182Nc.544G>AMissense_Mutation10.11LN229N500N
FMN2NIYSFHSATCENTRAL_NERVOUS_SYSTEM182p.D182Nc.544G>AMissense_Mutation10.11LN229N200N
FMN2RTSSGSDTNCENTRAL_NERVOUS_SYSTEM174p.D182Nc.544G>AMissense_Mutation10.11LN229N100Y
FMN2SDTNIYSFHCENTRAL_NERVOUS_SYSTEM179p.D182Nc.544G>AMissense_Mutation10.11LN229N100N
FMN2SGSDTNIYSCENTRAL_NERVOUS_SYSTEM177p.D182Nc.544G>AMissense_Mutation10.11LN229N100N
FMN2SSGSDTNIYCENTRAL_NERVOUS_SYSTEM176p.D182Nc.544G>AMissense_Mutation10.11LN229N600N
FMN2TNIYSFHSACENTRAL_NERVOUS_SYSTEM181p.D182Nc.544G>AMissense_Mutation10.11LN229N100N
FMN2TSSGSDTNICENTRAL_NERVOUS_SYSTEM175p.D182Nc.544G>AMissense_Mutation10.11LN229N400Y
GATA1ASGKGKKKWCENTRAL_NERVOUS_SYSTEM309p.R317Wc.949C>TMissense_Mutation10.11SW1783N300N
GATA1GKGKKKWGSCENTRAL_NERVOUS_SYSTEM311p.R317Wc.949C>TMissense_Mutation10.11SW1783N100N
GATA1GKKKWGSSLCENTRAL_NERVOUS_SYSTEM313p.R317Wc.949C>TMissense_Mutation10.11SW1783N300N
GATA1KGKKKWGSSCENTRAL_NERVOUS_SYSTEM312p.R317Wc.949C>TMissense_Mutation10.11SW1783N200N
GATA1KKKWGSSLGCENTRAL_NERVOUS_SYSTEM314p.R317Wc.949C>TMissense_Mutation10.11SW1783N000N
GATA1KKWGSSLGGCENTRAL_NERVOUS_SYSTEM315p.R317Wc.949C>TMissense_Mutation10.11SW1783N000N
GATA1KWGSSLGGTCENTRAL_NERVOUS_SYSTEM316p.R317Wc.949C>TMissense_Mutation10.11SW1783N000N
GATA1SGKGKKKWGCENTRAL_NERVOUS_SYSTEM310p.R317Wc.949C>TMissense_Mutation10.11SW1783N000N
GATA1WGSSLGGTGCENTRAL_NERVOUS_SYSTEM317p.R317Wc.949C>TMissense_Mutation10.11SW1783N200N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.78MGBAN000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7A172N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7AM38N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7BECKERN000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7CCFSTTG1N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7GMS10N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7H4N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HS683N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KALS1N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KNS42N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KNS60N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KS1N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7LN18N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7LN229N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7MOGGCCMN000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7MOGGUVWN000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7NMCG1N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SF126N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU1105N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU201N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU466N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU489N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU626N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SNU738N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SW1088N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SW1783N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7T98GN000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TM31N000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7U87MGN000N
GPR112ASISDMFIQCENTRAL_NERVOUS_SYSTEM2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7YKG1N000N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.78MGBAY11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7A172Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7AM38Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7BECKERY11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7CCFSTTG1Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7GMS10Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7H4Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS683Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KALS1Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KNS42Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KNS60Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KS1Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7LN18Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7LN229Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7MOGGCCMY11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7MOGGUVWY11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7NMCG1Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SF126Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU1105Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU201Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU466Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU489Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU626Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU738Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SW1088Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SW1783Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7T98GY11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TM31Y11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7U87MGY11100N
GPR112ISDMFIQNLCENTRAL_NERVOUS_SYSTEM2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7YKG1Y11100N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.78MGBAN700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7A172N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7AM38N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7BECKERN700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7CCFSTTG1N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7GMS10N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7H4N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS683N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KALS1N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KNS42N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KNS60N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KS1N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7LN18N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7LN229N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7MOGGCCMN700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7MOGGUVWN700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7NMCG1N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SF126N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU1105N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU201N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU466N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU489N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU626N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU738N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SW1088N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SW1783N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7T98GN700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TM31N700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7U87MGN700N
GPR112SASISDMFICENTRAL_NERVOUS_SYSTEM2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7YKG1N700N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.78MGBAN400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7A172N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7AM38N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7BECKERN400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7CCFSTTG1N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7GMS10N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7H4N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS683N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KALS1N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KNS42N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KNS60N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KS1N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7LN18N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7LN229N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7MOGGCCMN400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7MOGGUVWN400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7NMCG1N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SF126N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU1105N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU201N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU466N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU489N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU626N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU738N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SW1088N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SW1783N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7T98GN400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TM31N400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7U87MGN400N
GPR112SDMFIQNLACENTRAL_NERVOUS_SYSTEM2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7YKG1N400N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.78MGBAN000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7A172N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7AM38N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7BECKERN000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7CCFSTTG1N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7GMS10N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7H4N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS683N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KALS1N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KNS42N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KNS60N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KS1N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7LN18N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7LN229N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7MOGGCCMN000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7MOGGUVWN000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7NMCG1N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SF126N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU1105N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU201N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU466N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU489N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU626N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SNU738N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SW1088N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SW1783N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7T98GN000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TM31N000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7U87MGN000N
GPR112SISDMFIQNCENTRAL_NERVOUS_SYSTEM2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7YKG1N000N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.78MGBAN900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7A172N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7AM38N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7BECKERN900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7CCFSTTG1N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7GMS10N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7H4N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS683N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KALS1N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KNS42N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KNS60N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KS1N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7LN18N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7LN229N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7MOGGCCMN900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7MOGGUVWN900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7NMCG1N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SF126N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU1105N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU201N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU466N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU489N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU626N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SNU738N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SW1088N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SW1783N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7T98GN900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TM31N900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7U87MGN900N
GPR112VSASISDMFCENTRAL_NERVOUS_SYSTEM2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7YKG1N900N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.78MGBAN5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7A172N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7AM38N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7BECKERN5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7CCFSTTG1N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7GMS10N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7H4N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS683N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KALS1N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KNS42N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KNS60N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KS1N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7LN18N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7LN229N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7MOGGCCMN5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7MOGGUVWN5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7NMCG1N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SF126N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU1105N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU201N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU466N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU489N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU626N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SNU738N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SW1088N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SW1783N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7T98GN5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TM31N5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7U87MGN5020N
GPR112VVSASISDMCENTRAL_NERVOUS_SYSTEM2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7YKG1N5020N
GPR112EHIIYHKLYCENTRAL_NERVOUS_SYSTEM3p.Q8Hc.24G>TMissense_Mutation10.118MGBAN300N
GPR112HIIYHKLYGCENTRAL_NERVOUS_SYSTEM4p.Q8Hc.24G>TMissense_Mutation10.118MGBAN000N
GPR112HKLYGLILMCENTRAL_NERVOUS_SYSTEM8p.Q8Hc.24G>TMissense_Mutation10.118MGBAN500N
GPR112IIYHKLYGLCENTRAL_NERVOUS_SYSTEM5p.Q8Hc.24G>TMissense_Mutation10.118MGBAY21917N
GPR112IYHKLYGLICENTRAL_NERVOUS_SYSTEM6p.Q8Hc.24G>TMissense_Mutation10.118MGBAY9120N
GPR112KEHIIYHKLCENTRAL_NERVOUS_SYSTEM2p.Q8Hc.24G>TMissense_Mutation10.118MGBAY1490N
GPR112MKEHIIYHKCENTRAL_NERVOUS_SYSTEM1p.Q8Hc.24G>TMissense_Mutation10.118MGBAN200N
GPR112YHKLYGLILCENTRAL_NERVOUS_SYSTEM7p.Q8Hc.24G>TMissense_Mutation10.118MGBAN7012N
GPR112EFTENLLNSCENTRAL_NERVOUS_SYSTEM2269p.S2274Lc.6821C>TMissense_Mutation10.33SW1088N000N
GPR112ENLLNSIFQCENTRAL_NERVOUS_SYSTEM2272p.S2274Lc.6821C>TMissense_Mutation10.33SW1088N000N
GPR112FTENLLNSICENTRAL_NERVOUS_SYSTEM2270p.S2274Lc.6821C>TMissense_Mutation10.33SW1088N800N
GPR112INEFTENLLCENTRAL_NERVOUS_SYSTEM2267p.S2274Lc.6821C>TMissense_Mutation10.33SW1088N600N
GPR112LLNSIFQNSCENTRAL_NERVOUS_SYSTEM2274p.S2274Lc.6821C>TMissense_Mutation10.33SW1088N000N
GPR112NEFTENLLNCENTRAL_NERVOUS_SYSTEM2268p.S2274Lc.6821C>TMissense_Mutation10.33SW1088N400N
GPR112NLLNSIFQNCENTRAL_NERVOUS_SYSTEM2273p.S2274Lc.6821C>TMissense_Mutation10.33SW1088N100N
GPR112TENLLNSIFCENTRAL_NERVOUS_SYSTEM2271p.S2274Lc.6821C>TMissense_Mutation10.33SW1088Y790N
GPR112VINEFTENLCENTRAL_NERVOUS_SYSTEM2266p.S2274Lc.6821C>TMissense_Mutation10.33SW1088Y13123N
GPR112IYQMSSLSVCENTRAL_NERVOUS_SYSTEM1510p.P1517Sc.4549C>TMissense_Mutation10.55SNU489N5022N
GPR112LSVNVTAFTCENTRAL_NERVOUS_SYSTEM1516p.P1517Sc.4549C>TMissense_Mutation10.55SNU489N100N
GPR112MSSLSVNVTCENTRAL_NERVOUS_SYSTEM1513p.P1517Sc.4549C>TMissense_Mutation10.55SNU489N100N
GPR112PIYQMSSLSCENTRAL_NERVOUS_SYSTEM1509p.P1517Sc.4549C>TMissense_Mutation10.55SNU489N000N
GPR112QMSSLSVNVCENTRAL_NERVOUS_SYSTEM1512p.P1517Sc.4549C>TMissense_Mutation10.55SNU489Y4130N
GPR112SLSVNVTAFCENTRAL_NERVOUS_SYSTEM1515p.P1517Sc.4549C>TMissense_Mutation10.55SNU489Y4100N
GPR112SSLSVNVTACENTRAL_NERVOUS_SYSTEM1514p.P1517Sc.4549C>TMissense_Mutation10.55SNU489N400N
GPR112SVNVTAFTSCENTRAL_NERVOUS_SYSTEM1517p.P1517Sc.4549C>TMissense_Mutation10.55SNU489N000N
GPR112YQMSSLSVNCENTRAL_NERVOUS_SYSTEM1511p.P1517Sc.4549C>TMissense_Mutation10.55SNU489N202N
HSP90B1DEEETAKESCENTRAL_NERVOUS_SYSTEM787p.E791delc.2362_2364delGAAIn_Frame_Del121.79BECKERN300N
HSP90B1DEEETAKESCENTRAL_NERVOUS_SYSTEM787p.E791delc.2362_2364delGAAIn_Frame_Del121.79D341MEDN300N
HSP90B1DEEETAKESCENTRAL_NERVOUS_SYSTEM787p.E791delc.2362_2364delGAAIn_Frame_Del121.79GMS10N300N
HSP90B1DEEETAKESCENTRAL_NERVOUS_SYSTEM787p.E791delc.2362_2364delGAAIn_Frame_Del121.79HS683N300N
HSP90B1DEEETAKESCENTRAL_NERVOUS_SYSTEM787p.E791delc.2362_2364delGAAIn_Frame_Del121.79KS1N300N
HSP90B1DEEETAKESCENTRAL_NERVOUS_SYSTEM787p.E791delc.2362_2364delGAAIn_Frame_Del121.79ONS76N300N
HSP90B1DEEETAKESCENTRAL_NERVOUS_SYSTEM787p.E791delc.2362_2364delGAAIn_Frame_Del121.79SNU201N300N
HSP90B1DEEETAKESCENTRAL_NERVOUS_SYSTEM787p.E791delc.2362_2364delGAAIn_Frame_Del121.79SNU738N300N
HSP90B1DEEETAKESCENTRAL_NERVOUS_SYSTEM787p.E791delc.2362_2364delGAAIn_Frame_Del121.79T98GN300N
HSP90B1DVGTDEEETCENTRAL_NERVOUS_SYSTEM783p.E791delc.2362_2364delGAAIn_Frame_Del121.79BECKERN200N
HSP90B1DVGTDEEETCENTRAL_NERVOUS_SYSTEM783p.E791delc.2362_2364delGAAIn_Frame_Del121.79D341MEDN200N
HSP90B1DVGTDEEETCENTRAL_NERVOUS_SYSTEM783p.E791delc.2362_2364delGAAIn_Frame_Del121.79GMS10N200N
HSP90B1DVGTDEEETCENTRAL_NERVOUS_SYSTEM783p.E791delc.2362_2364delGAAIn_Frame_Del121.79HS683N200N
HSP90B1DVGTDEEETCENTRAL_NERVOUS_SYSTEM783p.E791delc.2362_2364delGAAIn_Frame_Del121.79KS1N200N
HSP90B1DVGTDEEETCENTRAL_NERVOUS_SYSTEM783p.E791delc.2362_2364delGAAIn_Frame_Del121.79ONS76N200N
HSP90B1DVGTDEEETCENTRAL_NERVOUS_SYSTEM783p.E791delc.2362_2364delGAAIn_Frame_Del121.79SNU201N200N
HSP90B1DVGTDEEETCENTRAL_NERVOUS_SYSTEM783p.E791delc.2362_2364delGAAIn_Frame_Del121.79SNU738N200N
HSP90B1DVGTDEEETCENTRAL_NERVOUS_SYSTEM783p.E791delc.2362_2364delGAAIn_Frame_Del121.79T98GN200N
HSP90B1GTDEEETAKCENTRAL_NERVOUS_SYSTEM785p.E791delc.2362_2364delGAAIn_Frame_Del321.79BECKERN400N
HSP90B1GTDEEETAKCENTRAL_NERVOUS_SYSTEM785p.E791delc.2362_2364delGAAIn_Frame_Del321.79D341MEDN400N
HSP90B1GTDEEETAKCENTRAL_NERVOUS_SYSTEM785p.E791delc.2362_2364delGAAIn_Frame_Del321.79GMS10N400N
HSP90B1GTDEEETAKCENTRAL_NERVOUS_SYSTEM785p.E791delc.2362_2364delGAAIn_Frame_Del321.79HS683N400N
HSP90B1GTDEEETAKCENTRAL_NERVOUS_SYSTEM785p.E791delc.2362_2364delGAAIn_Frame_Del321.79KS1N400N
HSP90B1GTDEEETAKCENTRAL_NERVOUS_SYSTEM785p.E791delc.2362_2364delGAAIn_Frame_Del321.79ONS76N400N
HSP90B1GTDEEETAKCENTRAL_NERVOUS_SYSTEM785p.E791delc.2362_2364delGAAIn_Frame_Del321.79SNU201N400N
HSP90B1GTDEEETAKCENTRAL_NERVOUS_SYSTEM785p.E791delc.2362_2364delGAAIn_Frame_Del321.79SNU738N400N
HSP90B1GTDEEETAKCENTRAL_NERVOUS_SYSTEM785p.E791delc.2362_2364delGAAIn_Frame_Del321.79T98GN400N
HSP90B1TDEEETAKECENTRAL_NERVOUS_SYSTEM786p.E791delc.2362_2364delGAAIn_Frame_Del221.79BECKERN000N
HSP90B1TDEEETAKECENTRAL_NERVOUS_SYSTEM786p.E791delc.2362_2364delGAAIn_Frame_Del221.79D341MEDN000N
HSP90B1TDEEETAKECENTRAL_NERVOUS_SYSTEM786p.E791delc.2362_2364delGAAIn_Frame_Del221.79GMS10N000N
HSP90B1TDEEETAKECENTRAL_NERVOUS_SYSTEM786p.E791delc.2362_2364delGAAIn_Frame_Del221.79HS683N000N
HSP90B1TDEEETAKECENTRAL_NERVOUS_SYSTEM786p.E791delc.2362_2364delGAAIn_Frame_Del221.79KS1N000N
HSP90B1TDEEETAKECENTRAL_NERVOUS_SYSTEM786p.E791delc.2362_2364delGAAIn_Frame_Del221.79ONS76N000N
HSP90B1TDEEETAKECENTRAL_NERVOUS_SYSTEM786p.E791delc.2362_2364delGAAIn_Frame_Del221.79SNU201N000N
HSP90B1TDEEETAKECENTRAL_NERVOUS_SYSTEM786p.E791delc.2362_2364delGAAIn_Frame_Del221.79SNU738N000N
HSP90B1TDEEETAKECENTRAL_NERVOUS_SYSTEM786p.E791delc.2362_2364delGAAIn_Frame_Del221.79T98GN000N
HSP90B1VGTDEEETACENTRAL_NERVOUS_SYSTEM784p.E791delc.2362_2364delGAAIn_Frame_Del221.79BECKERN100N
HSP90B1VGTDEEETACENTRAL_NERVOUS_SYSTEM784p.E791delc.2362_2364delGAAIn_Frame_Del221.79D341MEDN100N
HSP90B1VGTDEEETACENTRAL_NERVOUS_SYSTEM784p.E791delc.2362_2364delGAAIn_Frame_Del221.79GMS10N100N
HSP90B1VGTDEEETACENTRAL_NERVOUS_SYSTEM784p.E791delc.2362_2364delGAAIn_Frame_Del221.79HS683N100N
HSP90B1VGTDEEETACENTRAL_NERVOUS_SYSTEM784p.E791delc.2362_2364delGAAIn_Frame_Del221.79KS1N100N
HSP90B1VGTDEEETACENTRAL_NERVOUS_SYSTEM784p.E791delc.2362_2364delGAAIn_Frame_Del221.79ONS76N100N
HSP90B1VGTDEEETACENTRAL_NERVOUS_SYSTEM784p.E791delc.2362_2364delGAAIn_Frame_Del221.79SNU201N100N
HSP90B1VGTDEEETACENTRAL_NERVOUS_SYSTEM784p.E791delc.2362_2364delGAAIn_Frame_Del221.79SNU738N100N
HSP90B1VGTDEEETACENTRAL_NERVOUS_SYSTEM784p.E791delc.2362_2364delGAAIn_Frame_Del221.79T98GN100N
HSP90B1AYQTGKDNSCENTRAL_NERVOUS_SYSTEM666p.I673Nc.2018T>AMissense_Mutation10.11A172N200N
HSP90B1DNSTNYYASCENTRAL_NERVOUS_SYSTEM672p.I673Nc.2018T>AMissense_Mutation10.11A172N100N
HSP90B1GKDNSTNYYCENTRAL_NERVOUS_SYSTEM670p.I673Nc.2018T>AMissense_Mutation10.11A172N300N
HSP90B1KDNSTNYYACENTRAL_NERVOUS_SYSTEM671p.I673Nc.2018T>AMissense_Mutation10.11A172Y5100N
HSP90B1NSTNYYASQCENTRAL_NERVOUS_SYSTEM673p.I673Nc.2018T>AMissense_Mutation10.11A172N000Y
HSP90B1QAYQTGKDNCENTRAL_NERVOUS_SYSTEM665p.I673Nc.2018T>AMissense_Mutation10.11A172N300N
HSP90B1QTGKDNSTNCENTRAL_NERVOUS_SYSTEM668p.I673Nc.2018T>AMissense_Mutation10.11A172N100N
HSP90B1TGKDNSTNYCENTRAL_NERVOUS_SYSTEM669p.I673Nc.2018T>AMissense_Mutation10.11A172Y5120N
HSP90B1YQTGKDNSTCENTRAL_NERVOUS_SYSTEM667p.I673Nc.2018T>AMissense_Mutation10.11A172N500N
MAML2AQLQQQQQSCENTRAL_NERVOUS_SYSTEM626p.Q628Lc.1883A>TMissense_Mutation10.11GI1N000N
MAML2ISAQLQQQQCENTRAL_NERVOUS_SYSTEM624p.Q628Lc.1883A>TMissense_Mutation10.11GI1N000N
MAML2LQQQQQSSICENTRAL_NERVOUS_SYSTEM628p.Q628Lc.1883A>TMissense_Mutation10.11GI1N800N
MAML2QLQQQQQSSCENTRAL_NERVOUS_SYSTEM627p.Q628Lc.1883A>TMissense_Mutation10.11GI1N000N
MAML2QQSSISAQLCENTRAL_NERVOUS_SYSTEM620p.Q628Lc.1883A>TMissense_Mutation10.11GI1N1000N
MAML2QSSISAQLQCENTRAL_NERVOUS_SYSTEM621p.Q628Lc.1883A>TMissense_Mutation10.11GI1N000N
MAML2SAQLQQQQQCENTRAL_NERVOUS_SYSTEM625p.Q628Lc.1883A>TMissense_Mutation10.11GI1N000N
MAML2SISAQLQQQCENTRAL_NERVOUS_SYSTEM623p.Q628Lc.1883A>TMissense_Mutation10.11GI1N000N
MAML2SSISAQLQQCENTRAL_NERVOUS_SYSTEM622p.Q628Lc.1883A>TMissense_Mutation10.11GI1N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.4442MGBAN000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44AM38N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44BECKERN000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44CAS1N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44CCFSTTG1N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44D341MEDN000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44DAOYN000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44DBTRG05MGN000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44DKMGN000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44GAMGN000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44GI1N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44GMS10N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44GOS3N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44H4N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HS683N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KALS1N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KNS42N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KNS60N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44LN18N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44LN229N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44MOGGCCMN000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44MOGGUVWN000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44NMCG1N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SF126N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SF295N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SNU1105N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SNU201N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SNU738N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SW1783N000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44U138MGN000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44U87MGN000N
MAP3K1STTTTTTTECENTRAL_NERVOUS_SYSTEM941p.T949delc.2822_2824delCAAIn_Frame_Del176.44YKG1N000N
MAP3K1DDTYKDYVNCENTRAL_NERVOUS_SYSTEM1164p.D1170Yc.3508G>TMissense_Mutation10.11T98GN100N
MAP3K1DTYKDYVNHCENTRAL_NERVOUS_SYSTEM1165p.D1170Yc.3508G>TMissense_Mutation10.11T98GN000N
MAP3K1DYVNHNQKCCENTRAL_NERVOUS_SYSTEM1169p.D1170Yc.3508G>TMissense_Mutation10.11T98GN400N
MAP3K1ENDDTYKDYCENTRAL_NERVOUS_SYSTEM1162p.D1170Yc.3508G>TMissense_Mutation10.11T98GN300N
MAP3K1KDYVNHNQKCENTRAL_NERVOUS_SYSTEM1168p.D1170Yc.3508G>TMissense_Mutation10.11T98GN000N
MAP3K1NDDTYKDYVCENTRAL_NERVOUS_SYSTEM1163p.D1170Yc.3508G>TMissense_Mutation10.11T98GN400N
MAP3K1TYKDYVNHNCENTRAL_NERVOUS_SYSTEM1166p.D1170Yc.3508G>TMissense_Mutation10.11T98GN200N
MAP3K1YKDYVNHNQCENTRAL_NERVOUS_SYSTEM1167p.D1170Yc.3508G>TMissense_Mutation10.11T98GN202N
MAP3K1YVNHNQKCKCENTRAL_NERVOUS_SYSTEM1170p.D1170Yc.3508G>TMissense_Mutation10.11T98GY41316Y
MEN1ALDKDLGTGCENTRAL_NERVOUS_SYSTEM504p.G508Dc.1523G>AMissense_Mutation10.11ONS76N000N
MEN1DKDLGTGQGCENTRAL_NERVOUS_SYSTEM506p.G508Dc.1523G>AMissense_Mutation10.11ONS76N000N
MEN1DLGTGQGAVCENTRAL_NERVOUS_SYSTEM508p.G508Dc.1523G>AMissense_Mutation10.11ONS76N300N
MEN1KDLGTGQGACENTRAL_NERVOUS_SYSTEM507p.G508Dc.1523G>AMissense_Mutation10.11ONS76N500N
MEN1KKPALDKDLCENTRAL_NERVOUS_SYSTEM501p.G508Dc.1523G>AMissense_Mutation10.11ONS76N700N
MEN1KPALDKDLGCENTRAL_NERVOUS_SYSTEM502p.G508Dc.1523G>AMissense_Mutation10.11ONS76N100N
MEN1LDKDLGTGQCENTRAL_NERVOUS_SYSTEM505p.G508Dc.1523G>AMissense_Mutation10.11ONS76N000N
MEN1PALDKDLGTCENTRAL_NERVOUS_SYSTEM503p.G508Dc.1523G>AMissense_Mutation10.11ONS76N000N
MEN1PKKPALDKDCENTRAL_NERVOUS_SYSTEM500p.G508Dc.1523G>AMissense_Mutation10.11ONS76N000N
METDLKKTRVVLCENTRAL_NERVOUS_SYSTEM597p.L604Vc.1810C>GMissense_Mutation10.11BECKERY7100N
METFDLKKTRVVCENTRAL_NERVOUS_SYSTEM596p.L604Vc.1810C>GMissense_Mutation10.11BECKERN806N
METKKTRVVLGNCENTRAL_NERVOUS_SYSTEM599p.L604Vc.1810C>GMissense_Mutation10.11BECKERN100N
METKTRVVLGNECENTRAL_NERVOUS_SYSTEM600p.L604Vc.1810C>GMissense_Mutation10.11BECKERY1120N
METLKKTRVVLGCENTRAL_NERVOUS_SYSTEM598p.L604Vc.1810C>GMissense_Mutation10.11BECKERN000N
METRVVLGNESCCENTRAL_NERVOUS_SYSTEM602p.L604Vc.1810C>GMissense_Mutation10.11BECKERN000N
METTRVVLGNESCENTRAL_NERVOUS_SYSTEM601p.L604Vc.1810C>GMissense_Mutation10.11BECKERN200N
METVLGNESCTLCENTRAL_NERVOUS_SYSTEM604p.L604Vc.1810C>GMissense_Mutation10.11BECKERN902N
METVVLGNESCTCENTRAL_NERVOUS_SYSTEM603p.L604Vc.1810C>GMissense_Mutation10.11BECKERN500N
METDHPWHSISVCENTRAL_NERVOUS_SYSTEM208p.L211Wc.632T>GMissense_Mutation10.33SNU466N400N
METFPDHPWHSICENTRAL_NERVOUS_SYSTEM206p.L211Wc.632T>GMissense_Mutation10.33SNU466Y13110N
METHPWHSISVRCENTRAL_NERVOUS_SYSTEM209p.L211Wc.632T>GMissense_Mutation10.33SNU466N700N
METPDHPWHSISCENTRAL_NERVOUS_SYSTEM207p.L211Wc.632T>GMissense_Mutation10.33SNU466N000N
METPWHSISVRRCENTRAL_NERVOUS_SYSTEM210p.L211Wc.632T>GMissense_Mutation10.33SNU466N000N
METSSYFPDHPWCENTRAL_NERVOUS_SYSTEM203p.L211Wc.632T>GMissense_Mutation10.33SNU466N700N
METSYFPDHPWHCENTRAL_NERVOUS_SYSTEM204p.L211Wc.632T>GMissense_Mutation10.33SNU466N000N
METWHSISVRRLCENTRAL_NERVOUS_SYSTEM211p.L211Wc.632T>GMissense_Mutation10.33SNU466Y61016N
METYFPDHPWHSCENTRAL_NERVOUS_SYSTEM205p.L211Wc.632T>GMissense_Mutation10.33SNU466N2012N
MLH1DETVLNRIACENTRAL_NERVOUS_SYSTEM12p.V16Lc.46G>CMissense_Mutation10.11YKG1N500N
MLH1ETVLNRIAACENTRAL_NERVOUS_SYSTEM13p.V16Lc.46G>CMissense_Mutation10.11YKG1Y3120N
MLH1IRRLDETVLCENTRAL_NERVOUS_SYSTEM8p.V16Lc.46G>CMissense_Mutation10.11YKG1N503N
MLH1LDETVLNRICENTRAL_NERVOUS_SYSTEM11p.V16Lc.46G>CMissense_Mutation10.11YKG1N400N
MLH1LNRIAAGEVCENTRAL_NERVOUS_SYSTEM16p.V16Lc.46G>CMissense_Mutation10.11YKG1N202N
MLH1RLDETVLNRCENTRAL_NERVOUS_SYSTEM10p.V16Lc.46G>CMissense_Mutation10.11YKG1Y8100N
MLH1RRLDETVLNCENTRAL_NERVOUS_SYSTEM9p.V16Lc.46G>CMissense_Mutation10.11YKG1N200N
MLH1TVLNRIAAGCENTRAL_NERVOUS_SYSTEM14p.V16Lc.46G>CMissense_Mutation10.11YKG1N000N
MLH1VLNRIAAGECENTRAL_NERVOUS_SYSTEM15p.V16Lc.46G>CMissense_Mutation10.11YKG1N006N
MLL3DISGREIFKCENTRAL_NERVOUS_SYSTEM861p.E864delc.2591_2593delAAGIn_Frame_Del30.11LN18Y4110N
MLL3ISGREIFKPCENTRAL_NERVOUS_SYSTEM862p.E864delc.2591_2593delAAGIn_Frame_Del20.11LN18N000N
MLL3PDISGREIFCENTRAL_NERVOUS_SYSTEM860p.E864delc.2591_2593delAAGIn_Frame_Del40.11LN18N100N
MLL3PSWSPDISGCENTRAL_NERVOUS_SYSTEM856p.E864delc.2591_2593delAAGIn_Frame_Del10.11LN18N000N
MLL3SGREIFKPRCENTRAL_NERVOUS_SYSTEM863p.E864delc.2591_2593delAAGIn_Frame_Del10.11LN18N100N
MLL3SPDISGREICENTRAL_NERVOUS_SYSTEM859p.E864delc.2591_2593delAAGIn_Frame_Del40.11LN18N1300N
MLL3SWSPDISGRCENTRAL_NERVOUS_SYSTEM857p.E864delc.2591_2593delAAGIn_Frame_Del20.11LN18N200N
MLL3WSPDISGRECENTRAL_NERVOUS_SYSTEM858p.E864delc.2591_2593delAAGIn_Frame_Del30.11LN18N200N
MLL3EIVLQQQQQCENTRAL_NERVOUS_SYSTEM2389p.I2391Vc.7171A>GMissense_Mutation10.11SNU466N100N
MLL3EMEQHGMLGCENTRAL_NERVOUS_SYSTEM3430p.V3437Lc.10309G>TMissense_Mutation10.11YKG1N100N
MLL3EQERKERLRCENTRAL_NERVOUS_SYSTEM3397p.R3398Qc.10193G>AMissense_Mutation10.11GMS10N300N
MLL3EQHGMLGSECENTRAL_NERVOUS_SYSTEM3432p.V3437Lc.10309G>TMissense_Mutation10.11YKG1N000N
MLL3ESFQEQERKCENTRAL_NERVOUS_SYSTEM3393p.R3398Qc.10193G>AMissense_Mutation10.11GMS10N200N
MLL3FKTPMQPPRCENTRAL_NERVOUS_SYSTEM2043p.P2051Rc.6152_6153CA>GTMissense_Mutation10.11GOS3N200N
MLL3FQEQERKERCENTRAL_NERVOUS_SYSTEM3395p.R3398Qc.10193G>AMissense_Mutation10.11GMS10N602N
MLL3FSESFQEQECENTRAL_NERVOUS_SYSTEM3391p.R3398Qc.10193G>AMissense_Mutation10.11GMS10N200N
MLL3GMLGSEISSCENTRAL_NERVOUS_SYSTEM3435p.V3437Lc.10309G>TMissense_Mutation10.11YKG1N100N
MLL3HGMLGSEISCENTRAL_NERVOUS_SYSTEM3434p.V3437Lc.10309G>TMissense_Mutation10.11YKG1N100N
MLL3IVLQQQQQKCENTRAL_NERVOUS_SYSTEM2390p.I2391Vc.7171A>GMissense_Mutation10.11SNU466Y41116N
MLL3KLREIVLQQCENTRAL_NERVOUS_SYSTEM2386p.I2391Vc.7171A>GMissense_Mutation10.11SNU466N100N
MLL3KTPMQPPRSCENTRAL_NERVOUS_SYSTEM2044p.P2051Rc.6152_6153CA>GTMissense_Mutation10.11GOS3N200N
MLL3LGSEISSSRCENTRAL_NERVOUS_SYSTEM3437p.V3437Lc.10309G>TMissense_Mutation10.11YKG1N101N
MLL3LREIVLQQQCENTRAL_NERVOUS_SYSTEM2387p.I2391Vc.7171A>GMissense_Mutation10.11SNU466N105N
MLL3MEMEQHGMLCENTRAL_NERVOUS_SYSTEM3429p.V3437Lc.10309G>TMissense_Mutation10.11YKG1N1000N
MLL3MEQHGMLGSCENTRAL_NERVOUS_SYSTEM3431p.V3437Lc.10309G>TMissense_Mutation10.11YKG1N304N
MLL3MLGSEISSSCENTRAL_NERVOUS_SYSTEM3436p.V3437Lc.10309G>TMissense_Mutation10.11YKG1N008N
MLL3MQPPRSSQDCENTRAL_NERVOUS_SYSTEM2047p.P2051Rc.6152_6153CA>GTMissense_Mutation10.11GOS3N001Y
MLL3PFSESFQEQCENTRAL_NERVOUS_SYSTEM3390p.R3398Qc.10193G>AMissense_Mutation10.11GMS10N000N
MLL3PMQPPRSSQCENTRAL_NERVOUS_SYSTEM2046p.P2051Rc.6152_6153CA>GTMissense_Mutation10.11GOS3N000N
MLL3PPRSSQDPYCENTRAL_NERVOUS_SYSTEM2049p.P2051Rc.6152_6153CA>GTMissense_Mutation10.11GOS3N500Y
MLL3PRSSQDPYGCENTRAL_NERVOUS_SYSTEM2050p.P2051Rc.6152_6153CA>GTMissense_Mutation10.11GOS3N000Y
MLL3QEQERKERLCENTRAL_NERVOUS_SYSTEM3396p.R3398Qc.10193G>AMissense_Mutation10.11GMS10N900N
MLL3QERKERLRECENTRAL_NERVOUS_SYSTEM3398p.R3398Qc.10193G>AMissense_Mutation10.11GMS10N000N
MLL3QHGMLGSEICENTRAL_NERVOUS_SYSTEM3433p.V3437Lc.10309G>TMissense_Mutation10.11YKG1N300N
MLL3QKLREIVLQCENTRAL_NERVOUS_SYSTEM2385p.I2391Vc.7171A>GMissense_Mutation10.11SNU466N000Y
MLL3QPPRSSQDPCENTRAL_NERVOUS_SYSTEM2048p.P2051Rc.6152_6153CA>GTMissense_Mutation10.11GOS3N000Y
MLL3QRQKLREIVCENTRAL_NERVOUS_SYSTEM2383p.I2391Vc.7171A>GMissense_Mutation10.11SNU466N300Y
MLL3REIVLQQQQCENTRAL_NERVOUS_SYSTEM2388p.I2391Vc.7171A>GMissense_Mutation10.11SNU466N200N
MLL3RQKLREIVLCENTRAL_NERVOUS_SYSTEM2384p.I2391Vc.7171A>GMissense_Mutation10.11SNU466Y13110N
MLL3RSSQDPYGSCENTRAL_NERVOUS_SYSTEM2051p.P2051Rc.6152_6153CA>GTMissense_Mutation10.11GOS3N100Y
MLL3SESFQEQERCENTRAL_NERVOUS_SYSTEM3392p.R3398Qc.10193G>AMissense_Mutation10.11GMS10N000N
MLL3SFQEQERKECENTRAL_NERVOUS_SYSTEM3394p.R3398Qc.10193G>AMissense_Mutation10.11GMS10N000N
MLL3TPMQPPRSSCENTRAL_NERVOUS_SYSTEM2045p.P2051Rc.6152_6153CA>GTMissense_Mutation10.11GOS3N300Y
MLL3VLQQQQQKKCENTRAL_NERVOUS_SYSTEM2391p.I2391Vc.7171A>GMissense_Mutation10.11SNU466N400N
MLL3EKRRPRGAGCENTRAL_NERVOUS_SYSTEM892p.G892Ec.2675G>AMissense_Mutation10.33T98GN000N
MLL3FPEKRRPRGCENTRAL_NERVOUS_SYSTEM890p.G892Ec.2675G>AMissense_Mutation10.33T98GN300N
MLL3GFPEKRRPRCENTRAL_NERVOUS_SYSTEM889p.G892Ec.2675G>AMissense_Mutation10.33T98GY190N
MLL3GRGSGFPEKCENTRAL_NERVOUS_SYSTEM885p.G892Ec.2675G>AMissense_Mutation10.33T98GY2130Y
MLL3GSGFPEKRRCENTRAL_NERVOUS_SYSTEM887p.G892Ec.2675G>AMissense_Mutation10.33T98GN300N
MLL3PEKRRPRGACENTRAL_NERVOUS_SYSTEM891p.G892Ec.2675G>AMissense_Mutation10.33T98GY290N
MLL3RGSGFPEKRCENTRAL_NERVOUS_SYSTEM886p.G892Ec.2675G>AMissense_Mutation10.33T98GY090N
MLL3SGFPEKRRPCENTRAL_NERVOUS_SYSTEM888p.G892Ec.2675G>AMissense_Mutation10.33T98GN000N
MLL3VGRGSGFPECENTRAL_NERVOUS_SYSTEM884p.G892Ec.2675G>AMissense_Mutation10.33T98GN000N
MSH2GKHQKLLLVCENTRAL_NERVOUS_SYSTEM426p.A434Vc.1301C>TMissense_Mutation10.11SW1783N400N
MSH2HQKLLLVVFCENTRAL_NERVOUS_SYSTEM428p.A434Vc.1301C>TMissense_Mutation10.11SW1783N700N
MSH2KHQKLLLVVCENTRAL_NERVOUS_SYSTEM427p.A434Vc.1301C>TMissense_Mutation10.11SW1783N400N
MSH2KLLLVVFVTCENTRAL_NERVOUS_SYSTEM430p.A434Vc.1301C>TMissense_Mutation10.11SW1783N500N
MSH2LLLVVFVTPCENTRAL_NERVOUS_SYSTEM431p.A434Vc.1301C>TMissense_Mutation10.11SW1783N000N
MSH2LLVVFVTPLCENTRAL_NERVOUS_SYSTEM432p.A434Vc.1301C>TMissense_Mutation10.11SW1783N2008N
MSH2LVVFVTPLTCENTRAL_NERVOUS_SYSTEM433p.A434Vc.1301C>TMissense_Mutation10.11SW1783N2030N
MSH2QKLLLVVFVCENTRAL_NERVOUS_SYSTEM429p.A434Vc.1301C>TMissense_Mutation10.11SW1783N600N
MSH2VVFVTPLTDCENTRAL_NERVOUS_SYSTEM434p.A434Vc.1301C>TMissense_Mutation10.11SW1783N0025N
MSH2IKALEKHEGCENTRAL_NERVOUS_SYSTEM418p.Q419Kc.1255C>AMissense_Mutation10.66SNU738N0018N
MSH2INQLPNVIKCENTRAL_NERVOUS_SYSTEM411p.Q419Kc.1255C>AMissense_Mutation10.66SNU738N005Y
MSH2KALEKHEGKCENTRAL_NERVOUS_SYSTEM419p.Q419Kc.1255C>AMissense_Mutation10.66SNU738N400N
MSH2LPNVIKALECENTRAL_NERVOUS_SYSTEM414p.Q419Kc.1255C>AMissense_Mutation10.66SNU738N202N
MSH2NQLPNVIKACENTRAL_NERVOUS_SYSTEM412p.Q419Kc.1255C>AMissense_Mutation10.66SNU738Y790N
MSH2NVIKALEKHCENTRAL_NERVOUS_SYSTEM416p.Q419Kc.1255C>AMissense_Mutation10.66SNU738N100N
MSH2PNVIKALEKCENTRAL_NERVOUS_SYSTEM415p.Q419Kc.1255C>AMissense_Mutation10.66SNU738N000N
MSH2QLPNVIKALCENTRAL_NERVOUS_SYSTEM413p.Q419Kc.1255C>AMissense_Mutation10.66SNU738Y15120N
MSH2VIKALEKHECENTRAL_NERVOUS_SYSTEM417p.Q419Kc.1255C>AMissense_Mutation10.66SNU738N000N
MSH3GAAAAAAPPCENTRAL_NERVOUS_SYSTEM50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94BECKERN000N
MSH3GAAAAAAPPCENTRAL_NERVOUS_SYSTEM50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94KS1N000N
MSH3GAAAAAAPPCENTRAL_NERVOUS_SYSTEM50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94SW1783N000N
MSH3PGAAAAAAPCENTRAL_NERVOUS_SYSTEM49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94BECKERN000N
MSH3PGAAAAAAPCENTRAL_NERVOUS_SYSTEM49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94KS1N000N
MSH3PGAAAAAAPCENTRAL_NERVOUS_SYSTEM49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94SW1783N000N
MSH3AAAAPPAPACENTRAL_NERVOUS_SYSTEM53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23BECKERN200N
MSH3AAAAPPAPACENTRAL_NERVOUS_SYSTEM59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23H4N200N
MSH3AAAAPPAPACENTRAL_NERVOUS_SYSTEM53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23KS1N200N
MSH3AAAAPPAPACENTRAL_NERVOUS_SYSTEM53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23SW1783N200N
MSH3AAAAPPAPACENTRAL_NERVOUS_SYSTEM59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23T98GN200N
MSH3AAAAPPAPACENTRAL_NERVOUS_SYSTEM59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23U138MGN200N
MSH3AAAPPAPAFCENTRAL_NERVOUS_SYSTEM54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23BECKERY8100N
MSH3AAAPPAPAFCENTRAL_NERVOUS_SYSTEM60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23H4Y8100N
MSH3AAAPPAPAFCENTRAL_NERVOUS_SYSTEM54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23KS1Y8100N
MSH3AAAPPAPAFCENTRAL_NERVOUS_SYSTEM54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23SW1783Y8100N
MSH3AAAPPAPAFCENTRAL_NERVOUS_SYSTEM60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23T98GY8100N
MSH3AAAPPAPAFCENTRAL_NERVOUS_SYSTEM60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23U138MGY8100N
MSH3AAPPAPAFPCENTRAL_NERVOUS_SYSTEM55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23BECKERN000N
MSH3AAPPAPAFPCENTRAL_NERVOUS_SYSTEM61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23H4N000N
MSH3AAPPAPAFPCENTRAL_NERVOUS_SYSTEM55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23KS1N000N
MSH3AAPPAPAFPCENTRAL_NERVOUS_SYSTEM55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23SW1783N000N
MSH3AAPPAPAFPCENTRAL_NERVOUS_SYSTEM61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23T98GN000N
MSH3AAPPAPAFPCENTRAL_NERVOUS_SYSTEM61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23U138MGN000N
MSH3AAAAAAAPACENTRAL_NERVOUS_SYSTEM56p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77DBTRG05MGN300N
MSH3AAAAAAAPACENTRAL_NERVOUS_SYSTEM56p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77ONS76N300N
MSH3AAAAAAPAACENTRAL_NERVOUS_SYSTEM57p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77DBTRG05MGN300N
MSH3AAAAAAPAACENTRAL_NERVOUS_SYSTEM57p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77ONS76N300N
MSH3AAAAAPAAPCENTRAL_NERVOUS_SYSTEM58p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77DBTRG05MGN000N
MSH3AAAAAPAAPCENTRAL_NERVOUS_SYSTEM58p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77ONS76N000N
MSH3AAAAPAAPPCENTRAL_NERVOUS_SYSTEM59p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77DBTRG05MGN000N
MSH3AAAAPAAPPCENTRAL_NERVOUS_SYSTEM59p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77ONS76N000N
MSH3AAAPAAPPACENTRAL_NERVOUS_SYSTEM60p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77DBTRG05MGN500N
MSH3AAAPAAPPACENTRAL_NERVOUS_SYSTEM60p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77ONS76N500N
MSH3AAPAAPPAPCENTRAL_NERVOUS_SYSTEM61p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77DBTRG05MGN000N
MSH3AAPAAPPAPCENTRAL_NERVOUS_SYSTEM61p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77ONS76N000N
MSH3APAAPPAPPCENTRAL_NERVOUS_SYSTEM62p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77DBTRG05MGN000N
MSH3APAAPPAPPCENTRAL_NERVOUS_SYSTEM62p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77ONS76N000N
MSH3PAAPPAPPACENTRAL_NERVOUS_SYSTEM63p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77DBTRG05MGN000N
MSH3PAAPPAPPACENTRAL_NERVOUS_SYSTEM63p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77ONS76N000N
MSH3CISLNKENVCENTRAL_NERVOUS_SYSTEM370p.E373Lc.1116_1118TGA>CTTMissense_Mutation10.11AM38Y4100N
MSH3ISLNKENVRCENTRAL_NERVOUS_SYSTEM371p.E373Lc.1116_1118TGA>CTTMissense_Mutation10.11AM38N300N
MSH3LCISLNKENCENTRAL_NERVOUS_SYSTEM369p.E373Lc.1116_1118TGA>CTTMissense_Mutation10.11AM38N000N
MSH3LLCISLNKECENTRAL_NERVOUS_SYSTEM368p.E373Lc.1116_1118TGA>CTTMissense_Mutation10.11AM38N002N
MSH3LNKENVRDKCENTRAL_NERVOUS_SYSTEM373p.E373Lc.1116_1118TGA>CTTMissense_Mutation10.11AM38N003N
MSH3SLNKENVRDCENTRAL_NERVOUS_SYSTEM372p.E373Lc.1116_1118TGA>CTTMissense_Mutation10.11AM38N000N
MSH3SYLLCISLNCENTRAL_NERVOUS_SYSTEM366p.E373Lc.1116_1118TGA>CTTMissense_Mutation10.11AM38N200N
MSH3TSYLLCISLCENTRAL_NERVOUS_SYSTEM365p.E373Lc.1116_1118TGA>CTTMissense_Mutation10.11AM38Y1590N
MSH3YLLCISLNKCENTRAL_NERVOUS_SYSTEM367p.E373Lc.1116_1118TGA>CTTMissense_Mutation10.11AM38Y91625N
MYLKASKELKKDVCENTRAL_NERVOUS_SYSTEM1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02GI1N400N
MYLKASKELKKDVCENTRAL_NERVOUS_SYSTEM1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KNS42N400N
MYLKASKELKKDVCENTRAL_NERVOUS_SYSTEM1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KS1N400N
MYLKASKELKKDVCENTRAL_NERVOUS_SYSTEM1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02NMCG1N400N
MYLKASKELKKDVCENTRAL_NERVOUS_SYSTEM1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU1105N400N
MYLKASKELKKDVCENTRAL_NERVOUS_SYSTEM1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU466N400N
MYLKASKELKKDVCENTRAL_NERVOUS_SYSTEM1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU489N400N
MYLKASKELKKDVCENTRAL_NERVOUS_SYSTEM1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU626N400N
MYLKASKELKKDVCENTRAL_NERVOUS_SYSTEM1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU738N400N
MYLKASKELKKDVCENTRAL_NERVOUS_SYSTEM1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02TM31N400N
MYLKASKELKKDVCENTRAL_NERVOUS_SYSTEM1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02YH13N400N
MYLKKELKKDVKNCENTRAL_NERVOUS_SYSTEM1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02GI1N500N
MYLKKELKKDVKNCENTRAL_NERVOUS_SYSTEM1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KNS42N500N
MYLKKELKKDVKNCENTRAL_NERVOUS_SYSTEM1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KS1N500N
MYLKKELKKDVKNCENTRAL_NERVOUS_SYSTEM1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02NMCG1N500N
MYLKKELKKDVKNCENTRAL_NERVOUS_SYSTEM1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU1105N500N
MYLKKELKKDVKNCENTRAL_NERVOUS_SYSTEM1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU466N500N
MYLKKELKKDVKNCENTRAL_NERVOUS_SYSTEM1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU489N500N
MYLKKELKKDVKNCENTRAL_NERVOUS_SYSTEM1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU626N500N
MYLKKELKKDVKNCENTRAL_NERVOUS_SYSTEM1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU738N500N
MYLKKELKKDVKNCENTRAL_NERVOUS_SYSTEM1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02TM31N500N
MYLKKELKKDVKNCENTRAL_NERVOUS_SYSTEM1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02YH13N500N
MYLKKSASKELKKCENTRAL_NERVOUS_SYSTEM1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02GI1N400N
MYLKKSASKELKKCENTRAL_NERVOUS_SYSTEM1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KNS42N400N
MYLKKSASKELKKCENTRAL_NERVOUS_SYSTEM1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KS1N400N
MYLKKSASKELKKCENTRAL_NERVOUS_SYSTEM1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02NMCG1N400N
MYLKKSASKELKKCENTRAL_NERVOUS_SYSTEM1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU1105N400N
MYLKKSASKELKKCENTRAL_NERVOUS_SYSTEM1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU466N400N
MYLKKSASKELKKCENTRAL_NERVOUS_SYSTEM1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU489N400N
MYLKKSASKELKKCENTRAL_NERVOUS_SYSTEM1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU626N400N
MYLKKSASKELKKCENTRAL_NERVOUS_SYSTEM1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU738N400N
MYLKKSASKELKKCENTRAL_NERVOUS_SYSTEM1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TM31N400N
MYLKKSASKELKKCENTRAL_NERVOUS_SYSTEM1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02YH13N400N
MYLKLKSASKELKCENTRAL_NERVOUS_SYSTEM1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02GI1N105N
MYLKLKSASKELKCENTRAL_NERVOUS_SYSTEM1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KNS42N105N
MYLKLKSASKELKCENTRAL_NERVOUS_SYSTEM1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KS1N105N
MYLKLKSASKELKCENTRAL_NERVOUS_SYSTEM1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02NMCG1N105N
MYLKLKSASKELKCENTRAL_NERVOUS_SYSTEM1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU1105N105N
MYLKLKSASKELKCENTRAL_NERVOUS_SYSTEM1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU466N105N
MYLKLKSASKELKCENTRAL_NERVOUS_SYSTEM1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU489N105N
MYLKLKSASKELKCENTRAL_NERVOUS_SYSTEM1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU626N105N
MYLKLKSASKELKCENTRAL_NERVOUS_SYSTEM1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU738N105N
MYLKLKSASKELKCENTRAL_NERVOUS_SYSTEM1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TM31N105N
MYLKLKSASKELKCENTRAL_NERVOUS_SYSTEM1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02YH13N105N
MYLKNLKSASKELCENTRAL_NERVOUS_SYSTEM1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02GI1Y5100N
MYLKNLKSASKELCENTRAL_NERVOUS_SYSTEM1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KNS42Y5100N
MYLKNLKSASKELCENTRAL_NERVOUS_SYSTEM1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KS1Y5100N
MYLKNLKSASKELCENTRAL_NERVOUS_SYSTEM1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02NMCG1Y5100N
MYLKNLKSASKELCENTRAL_NERVOUS_SYSTEM1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU1105Y5100N
MYLKNLKSASKELCENTRAL_NERVOUS_SYSTEM1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU466Y5100N
MYLKNLKSASKELCENTRAL_NERVOUS_SYSTEM1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU489Y5100N
MYLKNLKSASKELCENTRAL_NERVOUS_SYSTEM1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU626Y5100N
MYLKNLKSASKELCENTRAL_NERVOUS_SYSTEM1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02SNU738Y5100N
MYLKNLKSASKELCENTRAL_NERVOUS_SYSTEM1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02TM31Y5100N
MYLKNLKSASKELCENTRAL_NERVOUS_SYSTEM1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02YH13Y5100N
MYLKSASKELKKDCENTRAL_NERVOUS_SYSTEM1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02GI1N000N
MYLKSASKELKKDCENTRAL_NERVOUS_SYSTEM1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KNS42N000N
MYLKSASKELKKDCENTRAL_NERVOUS_SYSTEM1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KS1N000N
MYLKSASKELKKDCENTRAL_NERVOUS_SYSTEM1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02NMCG1N000N
MYLKSASKELKKDCENTRAL_NERVOUS_SYSTEM1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU1105N000N
MYLKSASKELKKDCENTRAL_NERVOUS_SYSTEM1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU466N000N
MYLKSASKELKKDCENTRAL_NERVOUS_SYSTEM1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU489N000N
MYLKSASKELKKDCENTRAL_NERVOUS_SYSTEM1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU626N000N
MYLKSASKELKKDCENTRAL_NERVOUS_SYSTEM1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02SNU738N000N
MYLKSASKELKKDCENTRAL_NERVOUS_SYSTEM1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02TM31N000N
MYLKSASKELKKDCENTRAL_NERVOUS_SYSTEM1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02YH13N000N
MYLKSKELKKDVKCENTRAL_NERVOUS_SYSTEM1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02GI1N200N
MYLKSKELKKDVKCENTRAL_NERVOUS_SYSTEM1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KNS42N200N
MYLKSKELKKDVKCENTRAL_NERVOUS_SYSTEM1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KS1N200N
MYLKSKELKKDVKCENTRAL_NERVOUS_SYSTEM1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02NMCG1N200N
MYLKSKELKKDVKCENTRAL_NERVOUS_SYSTEM1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU1105N200N
MYLKSKELKKDVKCENTRAL_NERVOUS_SYSTEM1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU466N200N
MYLKSKELKKDVKCENTRAL_NERVOUS_SYSTEM1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU489N200N
MYLKSKELKKDVKCENTRAL_NERVOUS_SYSTEM1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU626N200N
MYLKSKELKKDVKCENTRAL_NERVOUS_SYSTEM1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02SNU738N200N
MYLKSKELKKDVKCENTRAL_NERVOUS_SYSTEM1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02TM31N200N
MYLKSKELKKDVKCENTRAL_NERVOUS_SYSTEM1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02YH13N200N
MYLKADSHYLCLLCENTRAL_NERVOUS_SYSTEM467p.G468Dc.1403G>AMissense_Mutation10.11CAS1N500N
MYLKAIGRLSSMVCENTRAL_NERVOUS_SYSTEM1754p.A1762Vc.5285C>TMissense_Mutation10.11U87MGN300N
MYLKASDIQSSSLCENTRAL_NERVOUS_SYSTEM1340p.R1344Qc.4031G>AMissense_Mutation10.11SNU201N700N
MYLKCASDIQSSSCENTRAL_NERVOUS_SYSTEM1339p.R1344Qc.4031G>AMissense_Mutation10.11SNU201N100N
MYLKDADSHYLCLCENTRAL_NERVOUS_SYSTEM466p.G468Dc.1403G>AMissense_Mutation10.11CAS1N1100N
MYLKDIQSSSLTLCENTRAL_NERVOUS_SYSTEM1342p.R1344Qc.4031G>AMissense_Mutation10.11SNU201N500N
MYLKDSHYLCLLKCENTRAL_NERVOUS_SYSTEM468p.G468Dc.1403G>AMissense_Mutation10.11CAS1N300N
MYLKEDADSHYLCCENTRAL_NERVOUS_SYSTEM465p.G468Dc.1403G>AMissense_Mutation10.11CAS1N200N
MYLKEVYEDADSHCENTRAL_NERVOUS_SYSTEM462p.G468Dc.1403G>AMissense_Mutation10.11CAS1N200N
MYLKGRLSSMVMICENTRAL_NERVOUS_SYSTEM1756p.A1762Vc.5285C>TMissense_Mutation10.11U87MGY7110N
MYLKGTPCASDIQCENTRAL_NERVOUS_SYSTEM1336p.R1344Qc.4031G>AMissense_Mutation10.11SNU201N000N
MYLKIEVYEDADSCENTRAL_NERVOUS_SYSTEM461p.G468Dc.1403G>AMissense_Mutation10.11CAS1N400N
MYLKIGRLSSMVMCENTRAL_NERVOUS_SYSTEM1755p.A1762Vc.5285C>TMissense_Mutation10.11U87MGN8025N
MYLKIQSSSLTLSCENTRAL_NERVOUS_SYSTEM1343p.R1344Qc.4031G>AMissense_Mutation10.11SNU201N007N
MYLKLSSMVMISGCENTRAL_NERVOUS_SYSTEM1758p.A1762Vc.5285C>TMissense_Mutation10.11U87MGN000N
MYLKMVMISGLSGCENTRAL_NERVOUS_SYSTEM1761p.A1762Vc.5285C>TMissense_Mutation10.11U87MGN0040N
MYLKPCASDIQSSCENTRAL_NERVOUS_SYSTEM1338p.R1344Qc.4031G>AMissense_Mutation10.11SNU201N000N
MYLKQSSSLTLSWCENTRAL_NERVOUS_SYSTEM1344p.R1344Qc.4031G>AMissense_Mutation10.11SNU201N300N
MYLKRLSSMVMISCENTRAL_NERVOUS_SYSTEM1757p.A1762Vc.5285C>TMissense_Mutation10.11U87MGN100N
MYLKSDIQSSSLTCENTRAL_NERVOUS_SYSTEM1341p.R1344Qc.4031G>AMissense_Mutation10.11SNU201N300N
MYLKSIEVYEDADCENTRAL_NERVOUS_SYSTEM460p.G468Dc.1403G>AMissense_Mutation10.11CAS1N000N
MYLKSMVMISGLSCENTRAL_NERVOUS_SYSTEM1760p.A1762Vc.5285C>TMissense_Mutation10.11U87MGN000N
MYLKSSMVMISGLCENTRAL_NERVOUS_SYSTEM1759p.A1762Vc.5285C>TMissense_Mutation10.11U87MGN1400N
MYLKTPCASDIQSCENTRAL_NERVOUS_SYSTEM1337p.R1344Qc.4031G>AMissense_Mutation10.11SNU201N300N
MYLKVMISGLSGRCENTRAL_NERVOUS_SYSTEM1762p.A1762Vc.5285C>TMissense_Mutation10.11U87MGN609N
MYLKVYEDADSHYCENTRAL_NERVOUS_SYSTEM463p.G468Dc.1403G>AMissense_Mutation10.11CAS1N500N
MYLKYEDADSHYLCENTRAL_NERVOUS_SYSTEM464p.G468Dc.1403G>AMissense_Mutation10.11CAS1N1100N
MYST4AEKEAEWLMCENTRAL_NERVOUS_SYSTEM1004p.R1010Wc.3028C>TMissense_Mutation10.11TM31Y6100N
MYST4AEWLMEQASCENTRAL_NERVOUS_SYSTEM1008p.R1010Wc.3028C>TMissense_Mutation10.11TM31N400Y
MYST4DGRKPVLMKCENTRAL_NERVOUS_SYSTEM1183p.R1190Mc.3569_3570GA>TGMissense_Mutation10.118MGBAN000N
MYST4EAEKEAEWLCENTRAL_NERVOUS_SYSTEM1003p.R1010Wc.3028C>TMissense_Mutation10.11TM31N700N
MYST4EAEWLMEQACENTRAL_NERVOUS_SYSTEM1007p.R1010Wc.3028C>TMissense_Mutation10.11TM31N300N
MYST4EDGRKPVLMCENTRAL_NERVOUS_SYSTEM1182p.R1190Mc.3569_3570GA>TGMissense_Mutation10.118MGBAN300N
MYST4EKEAEWLMECENTRAL_NERVOUS_SYSTEM1005p.R1010Wc.3028C>TMissense_Mutation10.11TM31N000N
MYST4EWLMEQASCCENTRAL_NERVOUS_SYSTEM1009p.R1010Wc.3028C>TMissense_Mutation10.11TM31N000N
MYST4GRKPVLMKACENTRAL_NERVOUS_SYSTEM1184p.R1190Mc.3569_3570GA>TGMissense_Mutation10.118MGBAY2100N
MYST4KEAEWLMEQCENTRAL_NERVOUS_SYSTEM1006p.R1010Wc.3028C>TMissense_Mutation10.11TM31N000N
MYST4KPVLMKAFQCENTRAL_NERVOUS_SYSTEM1186p.R1190Mc.3569_3570GA>TGMissense_Mutation10.118MGBAN100N
MYST4LMKAFQHQPCENTRAL_NERVOUS_SYSTEM1189p.R1190Mc.3569_3570GA>TGMissense_Mutation10.118MGBAN100N
MYST4MKAFQHQPGCENTRAL_NERVOUS_SYSTEM1190p.R1190Mc.3569_3570GA>TGMissense_Mutation10.118MGBAN000N
MYST4PVLMKAFQHCENTRAL_NERVOUS_SYSTEM1187p.R1190Mc.3569_3570GA>TGMissense_Mutation10.118MGBAN000N
MYST4REAEKEAEWCENTRAL_NERVOUS_SYSTEM1002p.R1010Wc.3028C>TMissense_Mutation10.11TM31Y7120N
MYST4RKPVLMKAFCENTRAL_NERVOUS_SYSTEM1185p.R1190Mc.3569_3570GA>TGMissense_Mutation10.118MGBAN600N
MYST4VLMKAFQHQCENTRAL_NERVOUS_SYSTEM1188p.R1190Mc.3569_3570GA>TGMissense_Mutation10.118MGBAN0010N
MYST4WLMEQASCWCENTRAL_NERVOUS_SYSTEM1010p.R1010Wc.3028C>TMissense_Mutation10.11TM31N804N
MYST4DDSGNLKEGCENTRAL_NERVOUS_SYSTEM1226p.S1229Gc.3685A>GMissense_Mutation10.33KS1N000N
MYST4DSGNLKEGSCENTRAL_NERVOUS_SYSTEM1227p.S1229Gc.3685A>GMissense_Mutation10.33KS1N100N
MYST4GNLKEGSKDCENTRAL_NERVOUS_SYSTEM1229p.S1229Gc.3685A>GMissense_Mutation10.33KS1N000N
MYST4MNDDSGNLKCENTRAL_NERVOUS_SYSTEM1224p.S1229Gc.3685A>GMissense_Mutation10.33KS1N100N
MYST4NDDSGNLKECENTRAL_NERVOUS_SYSTEM1225p.S1229Gc.3685A>GMissense_Mutation10.33KS1N000N
MYST4NMNDDSGNLCENTRAL_NERVOUS_SYSTEM1223p.S1229Gc.3685A>GMissense_Mutation10.33KS1N1100N
MYST4NNMNDDSGNCENTRAL_NERVOUS_SYSTEM1222p.S1229Gc.3685A>GMissense_Mutation10.33KS1N000N
MYST4RNNMNDDSGCENTRAL_NERVOUS_SYSTEM1221p.S1229Gc.3685A>GMissense_Mutation10.33KS1N000N
MYST4SGNLKEGSKCENTRAL_NERVOUS_SYSTEM1228p.S1229Gc.3685A>GMissense_Mutation10.33KS1N000N
NF1DEFINEFFMCENTRAL_NERVOUS_SYSTEM2632p.D2635fsc.7903_7903delGFrame_Shift_Del50.11KALS1Y890N
NF1EFINEFFMNCENTRAL_NERVOUS_SYSTEM2633p.D2635fsc.7903_7903delGFrame_Shift_Del50.11KALS1N000N
NF1FINEFFMNTCENTRAL_NERVOUS_SYSTEM2634p.D2635fsc.7903_7903delGFrame_Shift_Del50.11KALS1Y4113N
NF1KYTTDEFINCENTRAL_NERVOUS_SYSTEM2628p.D2635fsc.7903_7903delGFrame_Shift_Del20.11KALS1N200N
NF1TDEFINEFFCENTRAL_NERVOUS_SYSTEM2631p.D2635fsc.7903_7903delGFrame_Shift_Del50.11KALS1N400N
NF1TTDEFINEFCENTRAL_NERVOUS_SYSTEM2630p.D2635fsc.7903_7903delGFrame_Shift_Del40.11KALS1Y690N
NF1VKYTTDEFICENTRAL_NERVOUS_SYSTEM2627p.D2635fsc.7903_7903delGFrame_Shift_Del10.11KALS1N802N
NF1YTTDEFINECENTRAL_NERVOUS_SYSTEM2629p.D2635fsc.7903_7903delGFrame_Shift_Del30.11KALS1N200N
NF1ARVLVTLILCENTRAL_NERVOUS_SYSTEM1240p.L1246fsc.3737_3740delTGTTFrame_Shift_Del20.22TM31Y9100N
NF1ARVLVTLILCENTRAL_NERVOUS_SYSTEM1240p.L1246fsc.3737_3740delTGTTFrame_Shift_Del20.22U87MGY9100N
NF1CSGTCFLKKCENTRAL_NERVOUS_SYSTEM1255p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22TM31N300Y
NF1CSGTCFLKKCENTRAL_NERVOUS_SYSTEM1255p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22U87MGN300Y
NF1GIYSTNCSGCENTRAL_NERVOUS_SYSTEM1249p.L1246fsc.3737_3740delTGTTFrame_Shift_Del60.22TM31N000N
NF1GIYSTNCSGCENTRAL_NERVOUS_SYSTEM1249p.L1246fsc.3737_3740delTGTTFrame_Shift_Del60.22U87MGN000N
NF1ILGIYSTNCCENTRAL_NERVOUS_SYSTEM1247p.L1246fsc.3737_3740delTGTTFrame_Shift_Del60.22TM31N4010N
NF1ILGIYSTNCCENTRAL_NERVOUS_SYSTEM1247p.L1246fsc.3737_3740delTGTTFrame_Shift_Del60.22U87MGN4010N
NF1IYSTNCSGTCENTRAL_NERVOUS_SYSTEM1250p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22TM31N200N
NF1IYSTNCSGTCENTRAL_NERVOUS_SYSTEM1250p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22U87MGN200N
NF1LARVLVTLICENTRAL_NERVOUS_SYSTEM1239p.L1246fsc.3737_3740delTGTTFrame_Shift_Del10.22TM31N1205N
NF1LARVLVTLICENTRAL_NERVOUS_SYSTEM1239p.L1246fsc.3737_3740delTGTTFrame_Shift_Del10.22U87MGN1205N
NF1LGIYSTNCSCENTRAL_NERVOUS_SYSTEM1248p.L1246fsc.3737_3740delTGTTFrame_Shift_Del60.22TM31N0034N
NF1LGIYSTNCSCENTRAL_NERVOUS_SYSTEM1248p.L1246fsc.3737_3740delTGTTFrame_Shift_Del60.22U87MGN0034N
NF1LILGIYSTNCENTRAL_NERVOUS_SYSTEM1246p.L1246fsc.3737_3740delTGTTFrame_Shift_Del60.22TM31N000Y
NF1LILGIYSTNCENTRAL_NERVOUS_SYSTEM1246p.L1246fsc.3737_3740delTGTTFrame_Shift_Del60.22U87MGN000Y
NF1LVTLILGIYCENTRAL_NERVOUS_SYSTEM1243p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22TM31N609N
NF1LVTLILGIYCENTRAL_NERVOUS_SYSTEM1243p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22U87MGN609N
NF1NCSGTCFLKCENTRAL_NERVOUS_SYSTEM1254p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22TM31N200N
NF1NCSGTCFLKCENTRAL_NERVOUS_SYSTEM1254p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22U87MGN200N
NF1RVLVTLILGCENTRAL_NERVOUS_SYSTEM1241p.L1246fsc.3737_3740delTGTTFrame_Shift_Del30.22TM31N000N
NF1RVLVTLILGCENTRAL_NERVOUS_SYSTEM1241p.L1246fsc.3737_3740delTGTTFrame_Shift_Del30.22U87MGN000N
NF1STNCSGTCFCENTRAL_NERVOUS_SYSTEM1252p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22TM31Y490Y
NF1STNCSGTCFCENTRAL_NERVOUS_SYSTEM1252p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22U87MGY490Y
NF1TLILGIYSTCENTRAL_NERVOUS_SYSTEM1245p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22TM31N400N
NF1TLILGIYSTCENTRAL_NERVOUS_SYSTEM1245p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22U87MGN400N
NF1TNCSGTCFLCENTRAL_NERVOUS_SYSTEM1253p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22TM31Y5110N
NF1TNCSGTCFLCENTRAL_NERVOUS_SYSTEM1253p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22U87MGY5110N
NF1VLVTLILGICENTRAL_NERVOUS_SYSTEM1242p.L1246fsc.3737_3740delTGTTFrame_Shift_Del40.22TM31N16012N
NF1VLVTLILGICENTRAL_NERVOUS_SYSTEM1242p.L1246fsc.3737_3740delTGTTFrame_Shift_Del40.22U87MGN16012N
NF1VTLILGIYSCENTRAL_NERVOUS_SYSTEM1244p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22TM31N0010N
NF1VTLILGIYSCENTRAL_NERVOUS_SYSTEM1244p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22U87MGN0010N
NF1YSTNCSGTCCENTRAL_NERVOUS_SYSTEM1251p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22TM31N300Y
NF1YSTNCSGTCCENTRAL_NERVOUS_SYSTEM1251p.L1246fsc.3737_3740delTGTTFrame_Shift_Del50.22U87MGN300Y
NF1AGLSLQPEECENTRAL_NERVOUS_SYSTEM1081p.P1084Sc.3250C>TMissense_Mutation10.118MGBAN000N
NF1ALKMLSIFYCENTRAL_NERVOUS_SYSTEM1586p.T1589Mc.4766C>TMissense_Mutation10.11SW1783Y5110N
NF1EEFKALKMLCENTRAL_NERVOUS_SYSTEM1582p.T1589Mc.4766C>TMissense_Mutation10.11SW1783N900N
NF1EFKALKMLSCENTRAL_NERVOUS_SYSTEM1583p.T1589Mc.4766C>TMissense_Mutation10.11SW1783N000N
NF1ERGLKLMSMCENTRAL_NERVOUS_SYSTEM1436p.K1444Mc.4331A>TMissense_Mutation10.11U87MGY490N
NF1FKALKMLSICENTRAL_NERVOUS_SYSTEM1584p.T1589Mc.4766C>TMissense_Mutation10.11SW1783N5012N
NF1GLKLMSMILCENTRAL_NERVOUS_SYSTEM1438p.K1444Mc.4331A>TMissense_Mutation10.11U87MGY8100N
NF1GLSLQPEEGCENTRAL_NERVOUS_SYSTEM1082p.P1084Sc.3250C>TMissense_Mutation10.118MGBAN000N
NF1KALKMLSIFCENTRAL_NERVOUS_SYSTEM1585p.T1589Mc.4766C>TMissense_Mutation10.11SW1783N1000N
NF1KEEFKALKMCENTRAL_NERVOUS_SYSTEM1581p.T1589Mc.4766C>TMissense_Mutation10.11SW1783N800N
NF1KLMSMILQSCENTRAL_NERVOUS_SYSTEM1440p.K1444Mc.4331A>TMissense_Mutation10.11U87MGN100N
NF1KMLSIFYQACENTRAL_NERVOUS_SYSTEM1588p.T1589Mc.4766C>TMissense_Mutation10.11SW1783Y990N
NF1LAGLSLQPECENTRAL_NERVOUS_SYSTEM1080p.P1084Sc.3250C>TMissense_Mutation10.118MGBAN000N
NF1LKLMSMILQCENTRAL_NERVOUS_SYSTEM1439p.K1444Mc.4331A>TMissense_Mutation10.11U87MGN0027N
NF1LKMLSIFYQCENTRAL_NERVOUS_SYSTEM1587p.T1589Mc.4766C>TMissense_Mutation10.11SW1783N0043N
NF1LLAGLSLQPCENTRAL_NERVOUS_SYSTEM1079p.P1084Sc.3250C>TMissense_Mutation10.118MGBAN000N
NF1LMSMILQSICENTRAL_NERVOUS_SYSTEM1441p.K1444Mc.4331A>TMissense_Mutation10.11U87MGN1203N
NF1LSLQPEEGDCENTRAL_NERVOUS_SYSTEM1083p.P1084Sc.3250C>TMissense_Mutation10.118MGBAN000N
NF1MILQSIANHCENTRAL_NERVOUS_SYSTEM1444p.K1444Mc.4331A>TMissense_Mutation10.11U87MGN0030N
NF1MLSIFYQAGCENTRAL_NERVOUS_SYSTEM1589p.T1589Mc.4766C>TMissense_Mutation10.11SW1783N100N
NF1MSMILQSIACENTRAL_NERVOUS_SYSTEM1442p.K1444Mc.4331A>TMissense_Mutation10.11U87MGN300N
NF1RGLKLMSMICENTRAL_NERVOUS_SYSTEM1437p.K1444Mc.4331A>TMissense_Mutation10.11U87MGY1390N
NF1SLLAGLSLQCENTRAL_NERVOUS_SYSTEM1078p.P1084Sc.3250C>TMissense_Mutation10.118MGBAN000N
NF1SLQPEEGDGCENTRAL_NERVOUS_SYSTEM1084p.P1084Sc.3250C>TMissense_Mutation10.118MGBAN000N
NF1SMILQSIANCENTRAL_NERVOUS_SYSTEM1443p.K1444Mc.4331A>TMissense_Mutation10.11U87MGN000N
NF1VSLLAGLSLCENTRAL_NERVOUS_SYSTEM1077p.P1084Sc.3250C>TMissense_Mutation10.118MGBAN1404N
NF1VVSLLAGLSCENTRAL_NERVOUS_SYSTEM1076p.P1084Sc.3250C>TMissense_Mutation10.118MGBAN0028N
NF1CQEMKCRNKCENTRAL_NERVOUS_SYSTEM1032p.F1037Cc.3110T>GMissense_Mutation10.55M059KN200N
NF1CRNKMVEYLCENTRAL_NERVOUS_SYSTEM1037p.F1037Cc.3110T>GMissense_Mutation10.55M059KY790N
NF1EMKCRNKMVCENTRAL_NERVOUS_SYSTEM1034p.F1037Cc.3110T>GMissense_Mutation10.55M059KN500N
NF1FCQEMKCRNCENTRAL_NERVOUS_SYSTEM1031p.F1037Cc.3110T>GMissense_Mutation10.55M059KN100Y
NF1KCRNKMVEYCENTRAL_NERVOUS_SYSTEM1036p.F1037Cc.3110T>GMissense_Mutation10.55M059KY7120N
NF1LSFCQEMKCCENTRAL_NERVOUS_SYSTEM1029p.F1037Cc.3110T>GMissense_Mutation10.55M059KN100Y
NF1MKCRNKMVECENTRAL_NERVOUS_SYSTEM1035p.F1037Cc.3110T>GMissense_Mutation10.55M059KN008N
NF1QEMKCRNKMCENTRAL_NERVOUS_SYSTEM1033p.F1037Cc.3110T>GMissense_Mutation10.55M059KN600N
NF1SFCQEMKCRCENTRAL_NERVOUS_SYSTEM1030p.F1037Cc.3110T>GMissense_Mutation10.55M059KN200N
NF1CREMKFRNKCENTRAL_NERVOUS_SYSTEM1032p.Q1033Rc.3098A>GMissense_Mutation10.66M059KN300N
NF1DDLSFCREMCENTRAL_NERVOUS_SYSTEM1027p.Q1033Rc.3098A>GMissense_Mutation10.66M059KY590N
NF1DLSFCREMKCENTRAL_NERVOUS_SYSTEM1028p.Q1033Rc.3098A>GMissense_Mutation10.66M059KY3120N
NF1FCREMKFRNCENTRAL_NERVOUS_SYSTEM1031p.Q1033Rc.3098A>GMissense_Mutation10.66M059KN300N
NF1LSFCREMKFCENTRAL_NERVOUS_SYSTEM1029p.Q1033Rc.3098A>GMissense_Mutation10.66M059KY1090N
NF1RDDLSFCRECENTRAL_NERVOUS_SYSTEM1026p.Q1033Rc.3098A>GMissense_Mutation10.66M059KN000N
NF1REMKFRNKMCENTRAL_NERVOUS_SYSTEM1033p.Q1033Rc.3098A>GMissense_Mutation10.66M059KY890N
NF1RRDDLSFCRCENTRAL_NERVOUS_SYSTEM1025p.Q1033Rc.3098A>GMissense_Mutation10.66M059KN400N
NF1SFCREMKFRCENTRAL_NERVOUS_SYSTEM1030p.Q1033Rc.3098A>GMissense_Mutation10.66M059KN200N
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.1342MGBAN101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.516_517insCAGIn_Frame_Ins296.138MGBAN101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13A172N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13AM38N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13BECKERN101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13CAS1N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13CCFSTTG1N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13D341MEDN101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13D341MEDN101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13DAOYN101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13DKMGN101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13DKMGN101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13GAMGN101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13GI1N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13GMS10N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13GOS3N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13H4N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13HS683N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KALS1N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KNS42N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KNS60N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KS1N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13LN18N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13LN229N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13M059KN101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13MOGGCCMN101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13MOGGUVWN101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13NMCG1N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13ONS76N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SF126N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SF295N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU1105N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU201N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU466N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SNU489N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU626N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU738N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SW1088N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SW1783N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13T98GN101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13TM31N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13U138MGN101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13U87MGN101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13U87MGN101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13YH13N101Y
NR1H2IRKQQQQQECENTRAL_NERVOUS_SYSTEM170p.176_177insQc.514_515insAACIn_Frame_Ins296.13YKG1N101Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.1342MGBAN000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.516_517insCAGIn_Frame_Ins196.138MGBAN000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13A172N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13AM38N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13BECKERN000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13CAS1N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13CCFSTTG1N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13D341MEDN000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13D341MEDN000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13DAOYN000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13DKMGN000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13DKMGN000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13GAMGN000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13GI1N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13GMS10N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13GOS3N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13H4N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13HS683N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KALS1N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KNS42N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KNS60N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KS1N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13LN18N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13LN229N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13M059KN000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13MOGGCCMN000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13MOGGUVWN000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13NMCG1N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13ONS76N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SF126N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SF295N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU1105N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU201N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU466N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SNU489N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU626N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SNU738N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SW1088N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SW1783N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13T98GN000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13TM31N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13U138MGN000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13U87MGN000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13U87MGN000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13YH13N000Y
NR1H2KIRKQQQQQCENTRAL_NERVOUS_SYSTEM169p.176_177insQc.514_515insAACIn_Frame_Ins196.13YKG1N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.1342MGBAN000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.516_517insCAGIn_Frame_Ins296.138MGBAN000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13A172N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13AM38N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13BECKERN000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13CAS1N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13CCFSTTG1N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13D341MEDN000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13D341MEDN000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13DAOYN000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13DKMGN000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13DKMGN000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13GAMGN000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13GI1N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13GMS10N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13GOS3N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13H4N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13HS683N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KALS1N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KNS42N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KNS60N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KS1N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13LN18N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13LN229N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13M059KN000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13MOGGCCMN000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13MOGGUVWN000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13NMCG1N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13ONS76N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SF126N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SF295N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU1105N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU201N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU466N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SNU489N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU626N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SNU738N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SW1088N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SW1783N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13T98GN000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13TM31N000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13U138MGN000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13U87MGN000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13U87MGN000Y
NR1H2KQQQQQESQCENTRAL_NERVOUS_SYSTEM172p.176_177insQc.514_515insAACIn_Frame_Ins296.13YH13N000Y