Cancertope

In silico Platform for designing genome-based
Personalized immunotherapy or Vaccine against Cancer

Browse Results ...


The result page of search shows exclusive peptide/epitopes generated due to mutation [Neoepitope], the tissue of origin [Tissue], position of peptide in protein [Position], number of mismatches counted by aligning mutated and normal protein sequence [Num Mismatch, percentage of cell lines with this peptide over total number of cell lines [Promiscuity %]. The immune information include CTL epitopes (Yes/No), MHC I binders, MHC II binders (both given as number of alleles) and B cell epitopes (Yes/No). For more information, please click HERE


<
Result Reset Search:
ProteinNeoepitopesTissuePositionProt MutationcDNA MutationMutation TypeNum MismatchPromiscuity (%)Cell LineCTLMHC INHLApredMHC IIBcell
ABL1DQKRPSLPABREAST11p.R13Kc.38G>AMissense_Mutation10.11HCC2157N200N
ABL1EWGEAQTKNBREAST117p.C119Gc.355T>GMissense_Mutation10.11MDAMB436N000N
ABL1GDQKRPSLPBREAST10p.R13Kc.38G>AMissense_Mutation10.11HCC2157N100N
ABL1GEAQTKNGQBREAST119p.C119Gc.355T>GMissense_Mutation10.11MDAMB436N100N
ABL1GEWGEAQTKBREAST116p.C119Gc.355T>GMissense_Mutation10.11MDAMB436N400N
ABL1GKVLGDQKRBREAST6p.R13Kc.38G>AMissense_Mutation10.11HCC2157N100N
ABL1GQQPGRVLGBREAST2p.K7Rc.20A>GMissense_Mutation10.11HS578TN000N
ABL1GRVLGDQRRBREAST6p.K7Rc.20A>GMissense_Mutation10.11HS578TN300N
ABL1GYNHNGEWGBREAST111p.C119Gc.355T>GMissense_Mutation10.11MDAMB436N000N
ABL1HNGEWGEAQBREAST114p.C119Gc.355T>GMissense_Mutation10.11MDAMB436N000N
ABL1KRPSLPALHBREAST13p.R13Kc.38G>AMissense_Mutation10.11HCC2157N200N
ABL1KVLGDQKRPBREAST7p.R13Kc.38G>AMissense_Mutation10.11HCC2157N000N
ABL1LGDQKRPSLBREAST9p.R13Kc.38G>AMissense_Mutation10.11HCC2157N1000Y
ABL1MGQQPGRVLBREAST1p.K7Rc.20A>GMissense_Mutation10.11HS578TN1101N
ABL1NGEWGEAQTBREAST115p.C119Gc.355T>GMissense_Mutation10.11MDAMB436N000N
ABL1NHNGEWGEABREAST113p.C119Gc.355T>GMissense_Mutation10.11MDAMB436N100N
ABL1PGKVLGDQKBREAST5p.R13Kc.38G>AMissense_Mutation10.11HCC2157N000N
ABL1PGRVLGDQRBREAST5p.K7Rc.20A>GMissense_Mutation10.11HS578TN000N
ABL1QKRPSLPALBREAST12p.R13Kc.38G>AMissense_Mutation10.11HCC2157N400N
ABL1QPGRVLGDQBREAST4p.K7Rc.20A>GMissense_Mutation10.11HS578TN000N
ABL1QQPGRVLGDBREAST3p.K7Rc.20A>GMissense_Mutation10.11HS578TN000N
ABL1RVLGDQRRPBREAST7p.K7Rc.20A>GMissense_Mutation10.11HS578TN000N
ABL1VLGDQKRPSBREAST8p.R13Kc.38G>AMissense_Mutation10.11HCC2157N0020Y
ABL1WGEAQTKNGBREAST118p.C119Gc.355T>GMissense_Mutation10.11MDAMB436N100N
ABL1YNHNGEWGEBREAST112p.C119Gc.355T>GMissense_Mutation10.11MDAMB436N200N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86AU565N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86BT20N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86BT474N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86BT483N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86BT549N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAL120N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAL148N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAMA1N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86DU4475N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86EFM192AN000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86EFM19N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86EVSATN000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC1143N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC1187N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC1395N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC1419N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC1428N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC1500N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC1569N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC1599N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC202N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC2157N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC2218N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC70N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HMC18N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS281TN000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS343TN000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS578TN000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS739TN000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS742TN000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JIMT1N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KPL1N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MDAMB134VIN000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MDAMB231N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MDAMB361N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MDAMB415N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MDAMB436N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MDAMB453N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MDAMB468N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKBR3N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86T47DN000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86UACC812N000N
AKAP12AIEEDLEPEBREAST1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86UACC893N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86AU565N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86BT20N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86BT474N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86BT483N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86BT549N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAL120N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAL148N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAMA1N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86DU4475N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86EFM192AN000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86EFM19N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86EVSATN000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC1143N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC1187N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC1395N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC1419N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC1428N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC1500N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC1569N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC1599N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC202N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC2157N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC2218N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC70N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HMC18N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS281TN000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS343TN000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS578TN000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS739TN000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS742TN000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JIMT1N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KPL1N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MDAMB134VIN000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MDAMB231N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MDAMB361N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MDAMB415N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MDAMB436N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MDAMB453N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MDAMB468N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKBR3N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86T47DN000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86UACC812N000N
AKAP12EEDLEPENGBREAST1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86UACC893N000N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86AU565N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86BT20N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86BT474N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86BT483N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86BT549N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAL120N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAL148N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAMA1N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86DU4475N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86EFM192AN200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86EFM19N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86EVSATN200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC1143N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC1187N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC1395N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC1419N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC1428N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC1500N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC1569N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC1599N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC202N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC2157N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC2218N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC70N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HMC18N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS281TN200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS343TN200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS578TN200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS739TN200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS742TN200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JIMT1N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KPL1N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MDAMB134VIN200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MDAMB231N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MDAMB361N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MDAMB415N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MDAMB436N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MDAMB453N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MDAMB468N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKBR3N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86T47DN200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86UACC812N200N
AKAP12IEEDLEPENBREAST1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86UACC893N200N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86AU565N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86BT20N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86BT474N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86BT483N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86BT549N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAL120N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAL148N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAMA1N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86DU4475N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86EFM192AN000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86EFM19N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86EVSATN000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC1143N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC1187N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC1395N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC1419N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC1428N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC1500N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC1569N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC1599N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC202N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC2157N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC2218N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HCC70N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HMC18N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS281TN000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS343TN000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS578TN000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS739TN000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS742TN000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86JIMT1N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KPL1N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MDAMB134VIN000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MDAMB231N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MDAMB361N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MDAMB415N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MDAMB436N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MDAMB453N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MDAMB468N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKBR3N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86T47DN000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86UACC812N000N
AKAP12KVSVAIEEDBREAST1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86UACC893N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86AU565N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86BT20N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86BT474N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86BT483N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86BT549N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAL120N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAL148N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAMA1N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86DU4475N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86EFM192AN000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86EFM19N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86EVSATN000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC1143N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC1187N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC1395N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC1419N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC1428N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC1500N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC1569N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC1599N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC202N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC2157N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC2218N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC70N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HMC18N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS281TN000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS343TN000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS578TN000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS739TN000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS742TN000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JIMT1N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KPL1N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MDAMB134VIN000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MDAMB231N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MDAMB361N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MDAMB415N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MDAMB436N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MDAMB453N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MDAMB468N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKBR3N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86T47DN000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86UACC812N000N
AKAP12SVAIEEDLEBREAST1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86UACC893N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86AU565N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86BT20N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86BT474N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86BT483N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86BT549N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAL120N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAL148N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAMA1N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86DU4475N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86EFM192AN000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86EFM19N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86EVSATN000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC1143N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC1187N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC1395N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC1419N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC1428N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC1500N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC1569N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC1599N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC202N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC2157N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC2218N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HCC70N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HMC18N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS281TN000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS343TN000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS578TN000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS739TN000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS742TN000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86JIMT1N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KPL1N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MDAMB134VIN000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MDAMB231N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MDAMB361N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MDAMB415N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MDAMB436N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MDAMB453N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MDAMB468N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKBR3N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86T47DN000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86UACC812N000N
AKAP12VAIEEDLEPBREAST1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86UACC893N000N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86AU565N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86BT20N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86BT474N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86BT483N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86BT549N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAL120N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAL148N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAMA1N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86DU4475N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86EFM192AN002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86EFM19N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86EVSATN002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC1143N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC1187N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC1395N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC1419N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC1428N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC1500N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC1569N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC1599N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC202N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC2157N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC2218N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HCC70N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HMC18N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS281TN002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS343TN002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS578TN002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS739TN002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS742TN002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86JIMT1N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KPL1N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MDAMB134VIN002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MDAMB231N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MDAMB361N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MDAMB415N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MDAMB436N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MDAMB453N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MDAMB468N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKBR3N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86T47DN002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86UACC812N002N
AKAP12VKVSVAIEEBREAST1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86UACC893N002N
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86AU565N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86BT20N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86BT474N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86BT483N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86BT549N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAL120N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAL148N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAMA1N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86DU4475N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86EFM192AN1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86EFM19N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86EVSATN1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC1143N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC1187N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC1395N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC1419N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC1428N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC1500N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC1569N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC1599N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC202N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC2157N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC2218N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HCC70N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HMC18N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS281TN1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS343TN1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS578TN1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS739TN1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS742TN1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86JIMT1N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KPL1N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MDAMB134VIN1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MDAMB231N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MDAMB361N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MDAMB415N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MDAMB436N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MDAMB453N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MDAMB468N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKBR3N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86T47DN1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86UACC812N1500Y
AKAP12VSVAIEEDLBREAST1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86UACC893N1500Y
AKAP12KGVVSEVEMBREAST494p.E494Kc.1480G>AMissense_Mutation10.11CAL148N700N
AKAP12KPPKGVVSEBREAST491p.E494Kc.1480G>AMissense_Mutation10.11CAL148N100N
AKAP12KVLSKPPKGBREAST487p.E494Kc.1480G>AMissense_Mutation10.11CAL148N000N
AKAP12LSKPPKGVVBREAST489p.E494Kc.1480G>AMissense_Mutation10.11CAL148N600N
AKAP12PKGVVSEVEBREAST493p.E494Kc.1480G>AMissense_Mutation10.11CAL148N000N
AKAP12PPKGVVSEVBREAST492p.E494Kc.1480G>AMissense_Mutation10.11CAL148N700N
AKAP12SKPPKGVVSBREAST490p.E494Kc.1480G>AMissense_Mutation10.11CAL148N200N
AKAP12VLSKPPKGVBREAST488p.E494Kc.1480G>AMissense_Mutation10.11CAL148N6010N
AKAP12AEQNELSLQBREAST69p.D72Nc.214G>AMissense_Mutation10.22HCC1954N000Y
AKAP12EKVLSKPPKBREAST486p.E494Kc.1480G>AMissense_Mutation10.22CAL148N100N
AKAP12EQNELSLQEBREAST70p.D72Nc.214G>AMissense_Mutation10.22HCC1954N000N
AKAP12GVAEQNELSBREAST67p.D72Nc.214G>AMissense_Mutation10.22HCC1954N000N
AKAP12INGVAEQNEBREAST65p.D72Nc.214G>AMissense_Mutation10.22HCC1954N000N
AKAP12NELSLQEGDBREAST72p.D72Nc.214G>AMissense_Mutation10.22HCC1954N000N
AKAP12NGVAEQNELBREAST66p.D72Nc.214G>AMissense_Mutation10.22HCC1954N1300N
AKAP12QNELSLQEGBREAST71p.D72Nc.214G>AMissense_Mutation10.22HCC1954N000N
AKAP12TINGVAEQNBREAST64p.D72Nc.214G>AMissense_Mutation10.22HCC1954N000N
AKAP12VAEQNELSLBREAST68p.D72Nc.214G>AMissense_Mutation10.22HCC1954N1200N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27AU565N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27BT474N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27BT483N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27BT549N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27EFM19N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27EVSATN000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1187N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1428N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1500N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1569N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1599N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1806N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1954N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC2157N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC38N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC70N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS281TN000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS343TN000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS578TN000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27JIMT1N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KPL1N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAMB134VIN000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAMB231N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAMB436N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAMB453N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAMB468N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKBR3N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27UACC812N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27UACC893N000N
AKAP9DLEKTKQLEBREAST1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27ZR7530N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27AU565N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27BT474N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27BT483N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27BT549N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27EFM19N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27EVSATN000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1187N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1428N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1500N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1569N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1599N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1806N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1954N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC2157N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC38N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC70N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS281TN000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS343TN000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS578TN000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27JIMT1N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KPL1N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAMB134VIN000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAMB231N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAMB436N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAMB453N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAMB468N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKBR3N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27UACC812N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27UACC893N000N
AKAP9EKTKQLEEQBREAST1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27ZR7530N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27AU565N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27BT474N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27BT483N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27BT549N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27EFM19N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27EVSATN000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1187N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1428N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1500N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1569N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1599N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1806N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1954N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC2157N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC38N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC70N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS281TN000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS343TN000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS578TN000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27JIMT1N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KPL1N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAMB134VIN000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAMB231N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAMB436N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAMB453N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAMB468N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKBR3N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27UACC812N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27UACC893N000N
AKAP9KQLEEQVQEBREAST1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27ZR7530N000N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27AU565N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27BT474N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27BT483N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27BT549N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27EFM19N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27EVSATN200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HCC1187N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HCC1428N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HCC1500N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HCC1569N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HCC1599N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HCC1806N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HCC1954N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HCC2157N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HCC38N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HCC70N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HS281TN200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HS343TN200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HS578TN200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27JIMT1N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27KPL1N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27MDAMB134VIN200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27MDAMB231N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27MDAMB436N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27MDAMB453N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27MDAMB468N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SKBR3N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27UACC812N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27UACC893N200N
AKAP9KTKQLEEQVBREAST1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27ZR7530N200N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27AU565N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27BT474N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27BT483N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27BT549N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27EFM19N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27EVSATN000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1187N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1428N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1500N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1569N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1599N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1806N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1954N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC2157N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC38N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC70N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS281TN000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS343TN000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS578TN000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27JIMT1N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KPL1N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAMB134VIN000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAMB231N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAMB436N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAMB453N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAMB468N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKBR3N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27UACC812N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27UACC893N000N
AKAP9LEKTKQLEEBREAST1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27ZR7530N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27AU565N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27BT474N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27BT483N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27BT549N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27EFM19N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27EVSATN000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC1187N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC1428N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC1500N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC1569N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC1599N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC1806N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC1954N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC2157N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC38N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC70N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS281TN000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS343TN000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS578TN000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27JIMT1N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KPL1N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MDAMB134VIN000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MDAMB231N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MDAMB436N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MDAMB453N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MDAMB468N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SKBR3N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27UACC812N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27UACC893N000N
AKAP9LQDLEKTKQBREAST1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27ZR7530N000N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27AU565N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27BT474N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27BT483N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27BT549N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27EFM19N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27EVSATN900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1187N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1428N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1500N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1569N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1599N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1806N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC1954N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC2157N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC38N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HCC70N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS281TN900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS343TN900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS578TN900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27JIMT1N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KPL1N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAMB134VIN900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAMB231N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAMB436N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAMB453N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MDAMB468N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKBR3N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27UACC812N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27UACC893N900N
AKAP9QDLEKTKQLBREAST1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27ZR7530N900N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27AU565N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27BT474N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27BT483N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27BT549N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27EFM19N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27EVSATN1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC1187N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC1428N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC1500N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC1569N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC1599N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC1806N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC1954N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC2157N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC38N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HCC70N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS281TN1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS343TN1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS578TN1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27JIMT1N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KPL1N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MDAMB134VIN1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MDAMB231N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MDAMB436N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MDAMB453N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MDAMB468N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SKBR3N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27UACC812N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27UACC893N1200N
AKAP9QLEEQVQELBREAST1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27ZR7530N1200N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27AU565N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27BT474N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27BT483N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27BT549N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27EFM19N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27EVSATN000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1187N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1428N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1500N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1569N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1599N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1806N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC1954N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC2157N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC38N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HCC70N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS281TN000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS343TN000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS578TN000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27JIMT1N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KPL1N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAMB134VIN000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAMB231N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAMB436N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAMB453N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MDAMB468N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKBR3N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27UACC812N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27UACC893N000N
AKAP9TKQLEEQVQBREAST1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27ZR7530N000N
AKAP9DREQELHAQBREAST3317p.R3320Qc.9959G>AMissense_Mutation10.11HCC1569N000N
AKAP9DRSSESQSSBREAST1758p.K1762Ec.5284A>GMissense_Mutation10.11UACC812N100N
AKAP9EQELHAQLQBREAST3319p.R3320Qc.9959G>AMissense_Mutation10.11HCC1569N000N
AKAP9ESQSSASLIBREAST1762p.K1762Ec.5284A>GMissense_Mutation10.11UACC812N500N
AKAP9GILDRSSESBREAST1755p.K1762Ec.5284A>GMissense_Mutation10.11UACC812N000Y
AKAP9HNKVIEEKNBREAST2313p.D2313Hc.6937G>CMissense_Mutation10.11HCC1395N000N
AKAP9ILDRSSESQBREAST1756p.K1762Ec.5284A>GMissense_Mutation10.11UACC812N000N
AKAP9ITTHNKVIEBREAST2310p.D2313Hc.6937G>CMissense_Mutation10.11HCC1395N001N
AKAP9KITTHNKVIBREAST2309p.D2313Hc.6937G>CMissense_Mutation10.11HCC1395N400N
AKAP9LDREQELHABREAST3316p.R3320Qc.9959G>AMissense_Mutation10.11HCC1569N400N
AKAP9LDRSSESQSBREAST1757p.K1762Ec.5284A>GMissense_Mutation10.11UACC812N100N
AKAP9LGILDRSSEBREAST1754p.K1762Ec.5284A>GMissense_Mutation10.11UACC812N004N
AKAP9LKITTHNKVBREAST2308p.D2313Hc.6937G>CMissense_Mutation10.11HCC1395N402N
AKAP9MSSTLDREQBREAST3312p.R3320Qc.9959G>AMissense_Mutation10.11HCC1569N000N
AKAP9QELHAQLQSBREAST3320p.R3320Qc.9959G>AMissense_Mutation10.11HCC1569N400N
AKAP9QLKITTHNKBREAST2307p.D2313Hc.6937G>CMissense_Mutation10.11HCC1395Y4200N
AKAP9QQLKITTHNBREAST2306p.D2313Hc.6937G>CMissense_Mutation10.11HCC1395N000N
AKAP9QQQLKITTHBREAST2305p.D2313Hc.6937G>CMissense_Mutation10.11HCC1395N100N
AKAP9REQELHAQLBREAST3318p.R3320Qc.9959G>AMissense_Mutation10.11HCC1569Y14100N
AKAP9RSSESQSSABREAST1759p.K1762Ec.5284A>GMissense_Mutation10.11UACC812Y3100N
AKAP9SESQSSASLBREAST1761p.K1762Ec.5284A>GMissense_Mutation10.11UACC812N700N
AKAP9SSESQSSASBREAST1760p.K1762Ec.5284A>GMissense_Mutation10.11UACC812N100N
AKAP9SSTLDREQEBREAST3313p.R3320Qc.9959G>AMissense_Mutation10.11HCC1569N000N
AKAP9STLDREQELBREAST3314p.R3320Qc.9959G>AMissense_Mutation10.11HCC1569Y16100N
AKAP9THNKVIEEKBREAST2312p.D2313Hc.6937G>CMissense_Mutation10.11HCC1395N000N
AKAP9TLDREQELHBREAST3315p.R3320Qc.9959G>AMissense_Mutation10.11HCC1569N000N
AKAP9TTHNKVIEEBREAST2311p.D2313Hc.6937G>CMissense_Mutation10.11HCC1395N000N
ALKESPTNMPSRBREAST228p.P236Rc.707C>GMissense_Mutation10.11MDAMB415N300N
ALKMPSRSPDYFBREAST233p.P236Rc.707C>GMissense_Mutation10.11MDAMB415Y1090N
ALKNMPSRSPDYBREAST232p.P236Rc.707C>GMissense_Mutation10.11MDAMB415N600N
ALKPSRSPDYFTBREAST234p.P236Rc.707C>GMissense_Mutation10.11MDAMB415N000N
ALKPTNMPSRSPBREAST230p.P236Rc.707C>GMissense_Mutation10.11MDAMB415N000N
ALKRSPDYFTWNBREAST236p.P236Rc.707C>GMissense_Mutation10.11MDAMB415N300N
ALKSPTNMPSRSBREAST229p.P236Rc.707C>GMissense_Mutation10.11MDAMB415N300N
ALKSRSPDYFTWBREAST235p.P236Rc.707C>GMissense_Mutation10.11MDAMB415Y390N
ALKTNMPSRSPDBREAST231p.P236Rc.707C>GMissense_Mutation10.11MDAMB415N000N
ALPK2AFKKFLTCPBREAST1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27BT20N000N
ALPK2AFKKFLTCPBREAST1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27CAL148N000N
ALPK2AFKKFLTCPBREAST1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27EFM19N000N
ALPK2AFKKFLTCPBREAST1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HCC1187N000N
ALPK2AFKKFLTCPBREAST1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HCC1569N000N
ALPK2AFKKFLTCPBREAST1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HCC2218N000N
ALPK2AFKKFLTCPBREAST1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HS281TN000N
ALPK2AFKKFLTCPBREAST1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HS343TN000N
ALPK2AFKKFLTCPBREAST1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27MDAMB453N000N
ALPK2DHTAFKKFLBREAST1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27BT20N600N
ALPK2DHTAFKKFLBREAST1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27CAL148N600N
ALPK2DHTAFKKFLBREAST1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27EFM19N600N
ALPK2DHTAFKKFLBREAST1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HCC1187N600N
ALPK2DHTAFKKFLBREAST1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HCC1569N600N
ALPK2DHTAFKKFLBREAST1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HCC2218N600N
ALPK2DHTAFKKFLBREAST1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HS281TN600N
ALPK2DHTAFKKFLBREAST1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HS343TN600N
ALPK2DHTAFKKFLBREAST1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27MDAMB453N600N
ALPK2HTAFKKFLTBREAST1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27BT20N100N
ALPK2HTAFKKFLTBREAST1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27CAL148N100N
ALPK2HTAFKKFLTBREAST1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27EFM19N100N
ALPK2HTAFKKFLTBREAST1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HCC1187N100N
ALPK2HTAFKKFLTBREAST1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HCC1569N100N
ALPK2HTAFKKFLTBREAST1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HCC2218N100N
ALPK2HTAFKKFLTBREAST1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HS281TN100N
ALPK2HTAFKKFLTBREAST1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HS343TN100N
ALPK2HTAFKKFLTBREAST1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27MDAMB453N100N
ALPK2KMDHTAFKKBREAST1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27BT20N600N
ALPK2KMDHTAFKKBREAST1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27CAL148N600N
ALPK2KMDHTAFKKBREAST1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27EFM19N600N
ALPK2KMDHTAFKKBREAST1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HCC1187N600N
ALPK2KMDHTAFKKBREAST1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HCC1569N600N
ALPK2KMDHTAFKKBREAST1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HCC2218N600N
ALPK2KMDHTAFKKBREAST1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HS281TN600N
ALPK2KMDHTAFKKBREAST1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HS343TN600N
ALPK2KMDHTAFKKBREAST1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27MDAMB453N600N
ALPK2LKMDHTAFKBREAST1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27BT20N1017N
ALPK2LKMDHTAFKBREAST1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27CAL148N1017N
ALPK2LKMDHTAFKBREAST1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27EFM19N1017N
ALPK2LKMDHTAFKBREAST1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HCC1187N1017N
ALPK2LKMDHTAFKBREAST1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HCC1569N1017N
ALPK2LKMDHTAFKBREAST1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HCC2218N1017N
ALPK2LKMDHTAFKBREAST1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HS281TN1017N
ALPK2LKMDHTAFKBREAST1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HS343TN1017N
ALPK2LKMDHTAFKBREAST1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27MDAMB453N1017N
ALPK2MDHTAFKKFBREAST1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27BT20N600N
ALPK2MDHTAFKKFBREAST1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27CAL148N600N
ALPK2MDHTAFKKFBREAST1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27EFM19N600N
ALPK2MDHTAFKKFBREAST1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HCC1187N600N
ALPK2MDHTAFKKFBREAST1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HCC1569N600N
ALPK2MDHTAFKKFBREAST1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HCC2218N600N
ALPK2MDHTAFKKFBREAST1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HS281TN600N
ALPK2MDHTAFKKFBREAST1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HS343TN600N
ALPK2MDHTAFKKFBREAST1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27MDAMB453N600N
ALPK2TAFKKFLTCBREAST1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27BT20N600N
ALPK2TAFKKFLTCBREAST1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27CAL148N600N
ALPK2TAFKKFLTCBREAST1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27EFM19N600N
ALPK2TAFKKFLTCBREAST1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HCC1187N600N
ALPK2TAFKKFLTCBREAST1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HCC1569N600N
ALPK2TAFKKFLTCBREAST1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HCC2218N600N
ALPK2TAFKKFLTCBREAST1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HS281TN600N
ALPK2TAFKKFLTCBREAST1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HS343TN600N
ALPK2TAFKKFLTCBREAST1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27MDAMB453N600N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74BT474Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74BT483Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74BT549Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74CAL51Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74CAL851Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74CAMA1Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74EFM192AY1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HCC1395Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HCC1419Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HCC1428Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HCC1599Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HCC1954Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HCC202Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HCC38Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HCC70Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HMC18Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HS578TY1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74KPL1Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74MCF7Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74MDAMB134VIY1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74MDAMB231Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74MDAMB436Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74T47DY1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74UACC893Y1140N
ALPK2ATRETVTIABREAST1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74ZR751Y1140N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74BT474Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74BT483Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74BT549Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74CAL51Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74CAL851Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74CAMA1Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74EFM192AY2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HCC1395Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HCC1419Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HCC1428Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HCC1599Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HCC1954Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HCC202Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HCC38Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HCC70Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HMC18Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HS578TY2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KPL1Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MCF7Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MDAMB134VIY2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MDAMB231Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MDAMB436Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74T47DY2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74UACC893Y2110N
ALPK2CFQATRETVBREAST998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74ZR751Y2110N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74BT474N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74BT483N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74BT549N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74CAL51N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74CAL851N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74CAMA1N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74EFM192AN400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HCC1395N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HCC1419N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HCC1428N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HCC1599N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HCC1954N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HCC202N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HCC38N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HCC70N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HMC18N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HS578TN400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KPL1N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MCF7N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MDAMB134VIN400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MDAMB231N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MDAMB436N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74T47DN400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74UACC893N400N
ALPK2ETVTIATEVBREAST1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74ZR751N400N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74BT474N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74BT483N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74BT549N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74CAL51N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74CAL851N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74CAMA1N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74EFM192AN600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HCC1395N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HCC1419N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HCC1428N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HCC1599N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HCC1954N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HCC202N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HCC38N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HCC70N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HMC18N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HS578TN600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KPL1N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MCF7N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MDAMB134VIN600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MDAMB231N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MDAMB436N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74T47DN600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74UACC893N600N
ALPK2FQATRETVTBREAST999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74ZR751N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74BT474N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74BT483N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74BT549N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74CAL51N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74CAL851N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74CAMA1N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74EFM192AN600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HCC1395N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HCC1419N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HCC1428N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HCC1599N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HCC1954N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HCC202N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HCC38N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HCC70N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HMC18N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HS578TN600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KPL1N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MCF7N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MDAMB134VIN600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MDAMB231N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MDAMB436N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74T47DN600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74UACC893N600N
ALPK2QATRETVTIBREAST1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74ZR751N600N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74BT474N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74BT483N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74BT549N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74CAL51N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74CAL851N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74CAMA1N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74EFM192AN100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HCC1395N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HCC1419N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HCC1428N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HCC1599N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HCC1954N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HCC202N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HCC38N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HCC70N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HMC18N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HS578TN100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KPL1N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MCF7N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MDAMB134VIN100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MDAMB231N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MDAMB436N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74T47DN100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74UACC893N100N
ALPK2RETVTIATEBREAST1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74ZR751N100N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74BT474N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74BT483N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74BT549N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74CAL51N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74CAL851N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74CAMA1N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74EFM192AN200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HCC1395N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HCC1419N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HCC1428N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HCC1599N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HCC1954N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HCC202N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HCC38N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HCC70N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HMC18N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HS578TN200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KPL1N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MCF7N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MDAMB134VIN200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MDAMB231N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MDAMB436N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74T47DN200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74UACC893N200N
ALPK2TRETVTIATBREAST1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74ZR751N200N
ALPK2DQGLYYYCIBREAST1852p.C1858Yc.5573G>AMissense_Mutation10.11MDAMB231N700N
ALPK2GLYYYCIKNBREAST1854p.C1858Yc.5573G>AMissense_Mutation10.11MDAMB231N300N
ALPK2KDQGLYYYCBREAST1851p.C1858Yc.5573G>AMissense_Mutation10.11MDAMB231N200N
ALPK2LYYYCIKNSBREAST1855p.C1858Yc.5573G>AMissense_Mutation10.11MDAMB231N0025N
ALPK2PKDQGLYYYBREAST1850p.C1858Yc.5573G>AMissense_Mutation10.11MDAMB231N100N
ALPK2QGLYYYCIKBREAST1853p.C1858Yc.5573G>AMissense_Mutation10.11MDAMB231N000N
ALPK2YCIKNSYGKBREAST1858p.C1858Yc.5573G>AMissense_Mutation10.11MDAMB231N507N
ALPK2YYCIKNSYGBREAST1857p.C1858Yc.5573G>AMissense_Mutation10.11MDAMB231N208N
ALPK2YYYCIKNSYBREAST1856p.C1858Yc.5573G>AMissense_Mutation10.11MDAMB231N7011N
ATMAVKNYINCLBREAST2466p.E2468Kc.7402G>AMissense_Mutation10.11BT474Y6110N
ATMCEIFQLLKPBREAST1821p.L1824Fc.5470C>TMissense_Mutation10.11HCC1569N200N
ATMCKAVKNYINBREAST2464p.E2468Kc.7402G>AMissense_Mutation10.11BT474N100Y
ATMDILLQDTNQBREAST1848p.E1856Qc.5566G>CMissense_Mutation10.11MDAMB453N100N
ATMDTNQSWRNLBREAST1853p.E1856Qc.5566G>CMissense_Mutation10.11MDAMB453Y3110N
ATMDVIYTFIHYBREAST1467p.L1472Fc.4416G>CMissense_Mutation10.11EVSATY6110N
ATMEIFQLLKPMBREAST1822p.L1824Fc.5470C>TMissense_Mutation10.11HCC1569N600N
ATMFIHYINQRPBREAST1472p.L1472Fc.4416G>CMissense_Mutation10.11EVSATN100N
ATMFLCKAVKNYBREAST2462p.E2468Kc.7402G>AMissense_Mutation10.11BT474Y81310N
ATMFQLLKPMCEBREAST1824p.L1824Fc.5470C>TMissense_Mutation10.11HCC1569N2030N
ATMGGTKCEIFQBREAST1817p.L1824Fc.5470C>TMissense_Mutation10.11HCC1569N000N
ATMGTKCEIFQLBREAST1818p.L1824Fc.5470C>TMissense_Mutation10.11HCC1569Y6100N
ATMIFQLLKPMCBREAST1823p.L1824Fc.5470C>TMissense_Mutation10.11HCC1569N1012N
ATMILLQDTNQSBREAST1849p.E1856Qc.5566G>CMissense_Mutation10.11MDAMB453N0035N
ATMIYTFIHYINBREAST1469p.L1472Fc.4416G>CMissense_Mutation10.11EVSATN100N
ATMKAVKNYINCBREAST2465p.E2468Kc.7402G>AMissense_Mutation10.11BT474Y7100N
ATMKCEIFQLLKBREAST1820p.L1824Fc.5470C>TMissense_Mutation10.11HCC1569N400N
ATMKNYINCLLSBREAST2468p.E2468Kc.7402G>AMissense_Mutation10.11BT474N200N
ATMKRFLCKAVKBREAST2460p.E2468Kc.7402G>AMissense_Mutation10.11BT474Y290N
ATMLCKAVKNYIBREAST2463p.E2468Kc.7402G>AMissense_Mutation10.11BT474Y7110N
ATMLLQDTNQSWBREAST1850p.E1856Qc.5566G>CMissense_Mutation10.11MDAMB453N402N
ATMLQDTNQSWRBREAST1851p.E1856Qc.5566G>CMissense_Mutation10.11MDAMB453N600N
ATMLRDVIYTFIBREAST1465p.L1472Fc.4416G>CMissense_Mutation10.11EVSATN702N
ATMNQSWRNLLSBREAST1855p.E1856Qc.5566G>CMissense_Mutation10.11MDAMB453N000N
ATMQDTNQSWRNBREAST1852p.E1856Qc.5566G>CMissense_Mutation10.11MDAMB453N100N
ATMQSWRNLLSTBREAST1856p.E1856Qc.5566G>CMissense_Mutation10.11MDAMB453N300N
ATMRDVIYTFIHBREAST1466p.L1472Fc.4416G>CMissense_Mutation10.11EVSATN000N
ATMRFLCKAVKNBREAST2461p.E2468Kc.7402G>AMissense_Mutation10.11BT474N000N
ATMSGGTKCEIFBREAST1816p.L1824Fc.5470C>TMissense_Mutation10.11HCC1569N600N
ATMTFIHYINQRBREAST1471p.L1472Fc.4416G>CMissense_Mutation10.11EVSATN200N
ATMTKCEIFQLLBREAST1819p.L1824Fc.5470C>TMissense_Mutation10.11HCC1569N700N
ATMTNQSWRNLLBREAST1854p.E1856Qc.5566G>CMissense_Mutation10.11MDAMB453N600N
ATMVIYTFIHYIBREAST1468p.L1472Fc.4416G>CMissense_Mutation10.11EVSATY16102N
ATMVKNYINCLLBREAST2467p.E2468Kc.7402G>AMissense_Mutation10.11BT474N707N
ATMVLRDVIYTFBREAST1464p.L1472Fc.4416G>CMissense_Mutation10.11EVSATY8108N
ATMYTFIHYINQBREAST1470p.L1472Fc.4416G>CMissense_Mutation10.11EVSATN204N
BRAFAPSIYLEAYBREAST74p.P74Ac.220C>GMissense_Mutation10.11MDAMB415N1000N
BRAFDKFGGEHNABREAST66p.P74Ac.220C>GMissense_Mutation10.11MDAMB415N100N
BRAFEHNAPSIYLBREAST71p.P74Ac.220C>GMissense_Mutation10.11MDAMB415Y390N
BRAFFGGEHNAPSBREAST68p.P74Ac.220C>GMissense_Mutation10.11MDAMB415N204N
BRAFGEHNAPSIYBREAST70p.P74Ac.220C>GMissense_Mutation10.11MDAMB415N600N
BRAFGGEHNAPSIBREAST69p.P74Ac.220C>GMissense_Mutation10.11MDAMB415N700N
BRAFGQRIVSGSFBREAST460p.G464Vc.1391G>TMissense_Mutation10.11MDAMB231N400N
BRAFHNAPSIYLEBREAST72p.P74Ac.220C>GMissense_Mutation10.11MDAMB415N000N
BRAFITVGQRIVSBREAST457p.G464Vc.1391G>TMissense_Mutation10.11MDAMB231N008N
BRAFIVSGSFGTVBREAST463p.G464Vc.1391G>TMissense_Mutation10.11MDAMB231Y2100N
BRAFKFGGEHNAPBREAST67p.P74Ac.220C>GMissense_Mutation10.11MDAMB415N000N
BRAFNAPSIYLEABREAST73p.P74Ac.220C>GMissense_Mutation10.11MDAMB415Y490N
BRAFQITVGQRIVBREAST456p.G464Vc.1391G>TMissense_Mutation10.11MDAMB231N100N
BRAFQRIVSGSFGBREAST461p.G464Vc.1391G>TMissense_Mutation10.11MDAMB231N100N
BRAFRIVSGSFGTBREAST462p.G464Vc.1391G>TMissense_Mutation10.11MDAMB231N100N
BRAFTVGQRIVSGBREAST458p.G464Vc.1391G>TMissense_Mutation10.11MDAMB231N000N
BRAFVGQRIVSGSBREAST459p.G464Vc.1391G>TMissense_Mutation10.11MDAMB231N106N
BRAFVSGSFGTVYBREAST464p.G464Vc.1391G>TMissense_Mutation10.11MDAMB231N900N
BRAFATEKSRWSGBREAST598p.V600Ec.1799T>AMissense_Mutation16.08DU4475N000N
BRAFDFGLATEKSBREAST594p.V600Ec.1799T>AMissense_Mutation16.08DU4475N000N
BRAFEKSRWSGSHBREAST600p.V600Ec.1799T>AMissense_Mutation16.08DU4475N100N
BRAFFGLATEKSRBREAST595p.V600Ec.1799T>AMissense_Mutation16.08DU4475N302N
BRAFGDFGLATEKBREAST593p.V600Ec.1799T>AMissense_Mutation16.08DU4475N100N
BRAFGLATEKSRWBREAST596p.V600Ec.1799T>AMissense_Mutation16.08DU4475N400N
BRAFIGDFGLATEBREAST592p.V600Ec.1799T>AMissense_Mutation16.08DU4475N000N
BRAFLATEKSRWSBREAST597p.V600Ec.1799T>AMissense_Mutation16.08DU4475N200N
BRAFTEKSRWSGSBREAST599p.V600Ec.1799T>AMissense_Mutation16.08DU4475N300N
CARD10AENQRPTASBREAST285p.L290Pc.869T>CMissense_Mutation10.11HCC1806N300N
CARD10ELRAENQRPBREAST282p.L290Pc.869T>CMissense_Mutation10.11HCC1806N000N
CARD10ENQRPTASLBREAST286p.L290Pc.869T>CMissense_Mutation10.11HCC1806N600N
CARD10LRAENQRPTBREAST283p.L290Pc.869T>CMissense_Mutation10.11HCC1806N300Y
CARD10NQRPTASLRBREAST287p.L290Pc.869T>CMissense_Mutation10.11HCC1806N500N
CARD10PTASLRELQBREAST290p.L290Pc.869T>CMissense_Mutation10.11HCC1806N000N
CARD10QRPTASLREBREAST288p.L290Pc.869T>CMissense_Mutation10.11HCC1806N100N
CARD10RAENQRPTABREAST284p.L290Pc.869T>CMissense_Mutation10.11HCC1806N400Y
CARD10RPTASLRELBREAST289p.L290Pc.869T>CMissense_Mutation10.11HCC1806Y17110N
CBLAASAATALPBREAST847p.S854Lc.2561C>TMissense_Mutation10.11MDAMB415N000N
CBLAATALPQLSBREAST850p.S854Lc.2561C>TMissense_Mutation10.11MDAMB415N100N
CBLALPQLSSEIBREAST853p.S854Lc.2561C>TMissense_Mutation10.11MDAMB415Y8110N
CBLASAATALPQBREAST848p.S854Lc.2561C>TMissense_Mutation10.11MDAMB415N000N
CBLATALPQLSSBREAST851p.S854Lc.2561C>TMissense_Mutation10.11MDAMB415N000N
CBLLPQLSSEIEBREAST854p.S854Lc.2561C>TMissense_Mutation10.11MDAMB415N100N
CBLPAASAATALBREAST846p.S854Lc.2561C>TMissense_Mutation10.11MDAMB415N100N
CBLSAATALPQLBREAST849p.S854Lc.2561C>TMissense_Mutation10.11MDAMB415Y1190N
CBLTALPQLSSEBREAST852p.S854Lc.2561C>TMissense_Mutation10.11MDAMB415N000N
CDH1ANAPNTPAWBREAST401p.D402Nc.1204G>AMissense_Mutation10.11CAL148Y3160N
CDH1DANAPNTPABREAST400p.D402Nc.1204G>AMissense_Mutation10.11CAL148N200N
CDH1DNQYKDQVTBREAST671p.N674Yc.2020A>TMissense_Mutation10.11EFM19N000N
CDH1DTFMEQKIIBREAST514p.T522Ic.1565C>TMissense_Mutation10.11UACC812N600N
CDH1EQKIIYRIWBREAST518p.T522Ic.1565C>TMissense_Mutation10.11UACC812N200N
CDH1FMEQKIIYRBREAST516p.T522Ic.1565C>TMissense_Mutation10.11UACC812Y1190N
CDH1IIYRIWRDTBREAST521p.T522Ic.1565C>TMissense_Mutation10.11UACC812N101N
CDH1IYRIWRDTABREAST522p.T522Ic.1565C>TMissense_Mutation10.11UACC812N405N
CDH1KIIYRIWRDBREAST520p.T522Ic.1565C>TMissense_Mutation10.11UACC812Y090N
CDH1KLMDNQYKDBREAST668p.N674Yc.2020A>TMissense_Mutation10.11EFM19N100N
CDH1KVTDANAPNBREAST397p.D402Nc.1204G>AMissense_Mutation10.11CAL148N000N
CDH1LKLMDNQYKBREAST667p.N674Yc.2020A>TMissense_Mutation10.11EFM19N1011N
CDH1LKVTDANAPBREAST396p.D402Nc.1204G>AMissense_Mutation10.11CAL148N000N
CDH1LMDNQYKDQBREAST669p.N674Yc.2020A>TMissense_Mutation10.11EFM19N000N
CDH1MDNQYKDQVBREAST670p.N674Yc.2020A>TMissense_Mutation10.11EFM19N500N
CDH1MEQKIIYRIBREAST517p.T522Ic.1565C>TMissense_Mutation10.11UACC812N901N
CDH1NAPNTPAWEBREAST402p.D402Nc.1204G>AMissense_Mutation10.11CAL148N000N
CDH1NLKLMDNQYBREAST666p.N674Yc.2020A>TMissense_Mutation10.11EFM19N500N
CDH1NQYKDQVTTBREAST672p.N674Yc.2020A>TMissense_Mutation10.11EFM19N400N
CDH1QKIIYRIWRBREAST519p.T522Ic.1565C>TMissense_Mutation10.11UACC812N100N
CDH1QYKDQVTTLBREAST673p.N674Yc.2020A>TMissense_Mutation10.11EFM19Y5100N
CDH1TDANAPNTPBREAST399p.D402Nc.1204G>AMissense_Mutation10.11CAL148N000N
CDH1TFMEQKIIYBREAST515p.T522Ic.1565C>TMissense_Mutation10.11UACC812Y2110N
CDH1TLKVTDANABREAST395p.D402Nc.1204G>AMissense_Mutation10.11CAL148N100N
CDH1TTLKVTDANBREAST394p.D402Nc.1204G>AMissense_Mutation10.11CAL148N100N
CDH1VTDANAPNTBREAST398p.D402Nc.1204G>AMissense_Mutation10.11CAL148N200N
CDH1YKDQVTTLEBREAST674p.N674Yc.2020A>TMissense_Mutation10.11EFM19N201N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86BT483N100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86BT549N100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86CAL51N100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86DU4475N100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86EFM19N100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86EVSATN100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HCC1143N100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HCC1395N100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HCC1500N100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HCC1569N100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HCC1806N100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HCC2157N100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HCC70N100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86MDAMB134VIN100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86MDAMB361N100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86MDAMB415N100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86MDAMB453N100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86MDAMB468N100N
CHD1DQRSYGSRSBREAST1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86ZR751N100N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86BT483N000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86BT549N000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86CAL51N000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86DU4475N000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86EFM19N000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86EVSATN000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HCC1143N000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HCC1395N000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HCC1500N000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HCC1569N000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HCC1806N000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HCC2157N000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HCC70N000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86MDAMB134VIN000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86MDAMB361N000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86MDAMB415N000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86MDAMB453N000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86MDAMB468N000N
CHD1LDQRSYGSRBREAST1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86ZR751N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86BT483N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86BT549N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86CAL51N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86DU4475N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86EFM19N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86EVSATN000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HCC1143N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HCC1395N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HCC1500N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HCC1569N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HCC1806N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HCC2157N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HCC70N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86MDAMB134VIN000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86MDAMB361N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86MDAMB415N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86MDAMB453N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86MDAMB468N000N
CHD1PLDQRSYGSBREAST1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86ZR751N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86BT483N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86BT549N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86CAL51N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86DU4475N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86EFM19N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86EVSATN000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HCC1143N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HCC1395N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HCC1500N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HCC1569N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HCC1806N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HCC2157N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HCC70N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86MDAMB134VIN000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86MDAMB361N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86MDAMB415N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86MDAMB453N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86MDAMB468N000N
CHD1QRSYGSRSPBREAST1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86ZR751N000N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86BT483N600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86BT549N600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86CAL51N600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86DU4475N600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86EFM19N600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86EVSATN600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HCC1143N600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HCC1395N600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HCC1500N600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HCC1569N600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HCC1806N600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HCC2157N600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HCC70N600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86MDAMB134VIN600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86MDAMB361N600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86MDAMB415N600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86MDAMB453N600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86MDAMB468N600N
CHD1RSPLDQRSYBREAST1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86ZR751N600N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86BT483N900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86BT549N900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86CAL51N900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86DU4475N900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86EFM19N900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86EVSATN900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HCC1143N900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HCC1395N900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HCC1500N900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HCC1569N900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HCC1806N900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HCC2157N900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HCC70N900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86MDAMB134VIN900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86MDAMB361N900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86MDAMB415N900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86MDAMB453N900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86MDAMB468N900N
CHD1RSYGSRSPFBREAST1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86ZR751N900N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86BT483N000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86BT549N000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86CAL51N000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86DU4475N000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86EFM19N000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86EVSATN000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HCC1143N000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HCC1395N000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HCC1500N000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HCC1569N000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HCC1806N000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HCC2157N000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HCC70N000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86MDAMB134VIN000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86MDAMB361N000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86MDAMB415N000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86MDAMB453N000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86MDAMB468N000N
CHD1SPLDQRSYGBREAST1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86ZR751N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86BT483N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86BT549N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86CAL51N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86DU4475N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86EFM19N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86EVSATN000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HCC1143N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HCC1395N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HCC1500N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HCC1569N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HCC1806N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HCC2157N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HCC70N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86MDAMB134VIN000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86MDAMB361N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86MDAMB415N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86MDAMB453N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86MDAMB468N000N
CHD1SYGSRSPFEBREAST1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86ZR751N000N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47BT20N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47BT474N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47BT549N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47CAL120N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47CAMA1N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47DU4475N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47EFM192AN801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47HCC1143N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47HCC1187N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47HCC1395N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47HCC1569N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47HCC1954N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47HCC202N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47HCC2218N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47HCC38N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47HMC18N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47HS281TN801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47MDAMB361N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47MDAMB468N801N
CREB3L2FTHITSDSFBREAST95p.T100delc.299_301delCCAIn_Frame_Del444.47SKBR3N801N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47BT20N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47BT474N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47BT549N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47CAL120N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47CAMA1N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47DU4475N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47EFM192AN000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47HCC1143N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47HCC1187N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47HCC1395N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47HCC1569N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47HCC1954N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47HCC202N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47HCC2218N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47HCC38N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47HMC18N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47HS281TN000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47MDAMB361N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47MDAMB468N000N
CREB3L2HITSDSFNDBREAST97p.T100delc.299_301delCCAIn_Frame_Del244.47SKBR3N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47BT20N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47BT474N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47BT549N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47CAL120N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47CAMA1N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47DU4475N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47EFM192AN000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47HCC1143N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47HCC1187N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47HCC1395N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47HCC1569N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47HCC1954N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47HCC202N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47HCC2218N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47HCC38N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47HMC18N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47HS281TN000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47MDAMB361N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47MDAMB468N000N
CREB3L2ITSDSFNDDBREAST98p.T100delc.299_301delCCAIn_Frame_Del144.47SKBR3N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47BT20N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47BT474N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47BT549N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47CAL120N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47CAMA1N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47DU4475N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47EFM192AN000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47HCC1143N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47HCC1187N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47HCC1395N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47HCC1569N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47HCC1954N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47HCC202N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47HCC2218N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47HCC38N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47HMC18N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47HS281TN000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47MDAMB361N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47MDAMB468N000N
CREB3L2PFTHITSDSBREAST94p.T100delc.299_301delCCAIn_Frame_Del344.47SKBR3N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47BT20N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47BT474N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47BT549N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47CAL120N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47CAMA1N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47DU4475N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47EFM192AN000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47HCC1143N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47HCC1187N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47HCC1395N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47HCC1569N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47HCC1954N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47HCC202N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47HCC2218N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47HCC38N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47HMC18N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47HS281TN000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47MDAMB361N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47MDAMB468N000N
CREB3L2QSPFTHITSBREAST92p.T100delc.299_301delCCAIn_Frame_Del144.47SKBR3N000N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47BT20N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47BT474N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47BT549N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47CAL120N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47CAMA1N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47DU4475N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47EFM192AN100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47HCC1143N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47HCC1187N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47HCC1395N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47HCC1569N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47HCC1954N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47HCC202N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47HCC2218N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47HCC38N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47HMC18N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47HS281TN100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47MDAMB361N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47MDAMB468N100N
CREB3L2SPFTHITSDBREAST93p.T100delc.299_301delCCAIn_Frame_Del244.47SKBR3N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47BT20N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47BT474N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47BT549N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47CAL120N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47CAMA1N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47DU4475N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47EFM192AN100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47HCC1143N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47HCC1187N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47HCC1395N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47HCC1569N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47HCC1954N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47HCC202N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47HCC2218N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47HCC38N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47HMC18N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47HS281TN100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47MDAMB361N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47MDAMB468N100N
CREB3L2THITSDSFNBREAST96p.T100delc.299_301delCCAIn_Frame_Del344.47SKBR3N100N
CTBP2APSPNQPTNBREAST966p.K974fsc.2922_2922delAFrame_Shift_Del124.34BT20N300N
CTBP2APSPNQPTNBREAST966p.K974fsc.2922_2922delAFrame_Shift_Del124.34BT549N300N
CTBP2APSPNQPTNBREAST966p.K974fsc.2922_2922delAFrame_Shift_Del124.34CAL851N300N
CTBP2APSPNQPTNBREAST966p.K974fsc.2922_2922delAFrame_Shift_Del124.34EVSATN300N
CTBP2APSPNQPTNBREAST966p.K974fsc.2922_2922delAFrame_Shift_Del124.34HCC1143N300N
CTBP2APSPNQPTNBREAST966p.K974fsc.2922_2922delAFrame_Shift_Del124.34HCC1419N300N
CTBP2APSPNQPTNBREAST966p.K974fsc.2922_2922delAFrame_Shift_Del124.34HCC1500N300N
CTBP2APSPNQPTNBREAST966p.K974fsc.2922_2922delAFrame_Shift_Del124.34HCC2218N300N
CTBP2APSPNQPTNBREAST966p.K974fsc.2922_2922delAFrame_Shift_Del124.34KPL1N300N
CTBP2APSPNQPTNBREAST966p.K974fsc.2922_2922delAFrame_Shift_Del124.34MCF7N300N
CTBP2APSPNQPTNBREAST966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SKBR3N300N
CTBP2APSPNQPTNBREAST966p.K974fsc.2922_2922delAFrame_Shift_Del124.34T47DN300N
CTBP2GTIESTPTSBREAST976p.K974fsc.2922_2922delAFrame_Shift_Del524.34BT20N100N
CTBP2GTIESTPTSBREAST976p.K974fsc.2922_2922delAFrame_Shift_Del524.34BT549N100N
CTBP2GTIESTPTSBREAST976p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAL851N100N
CTBP2GTIESTPTSBREAST976p.K974fsc.2922_2922delAFrame_Shift_Del524.34EVSATN100N
CTBP2GTIESTPTSBREAST976p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1143N100N
CTBP2GTIESTPTSBREAST976p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1419N100N
CTBP2GTIESTPTSBREAST976p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1500N100N
CTBP2GTIESTPTSBREAST976p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC2218N100N
CTBP2GTIESTPTSBREAST976p.K974fsc.2922_2922delAFrame_Shift_Del524.34KPL1N100N
CTBP2GTIESTPTSBREAST976p.K974fsc.2922_2922delAFrame_Shift_Del524.34MCF7N100N
CTBP2GTIESTPTSBREAST976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SKBR3N100N
CTBP2GTIESTPTSBREAST976p.K974fsc.2922_2922delAFrame_Shift_Del524.34T47DN100N
CTBP2NQPTNTGTIBREAST970p.K974fsc.2922_2922delAFrame_Shift_Del424.34BT20N1000N
CTBP2NQPTNTGTIBREAST970p.K974fsc.2922_2922delAFrame_Shift_Del424.34BT549N1000N
CTBP2NQPTNTGTIBREAST970p.K974fsc.2922_2922delAFrame_Shift_Del424.34CAL851N1000N
CTBP2NQPTNTGTIBREAST970p.K974fsc.2922_2922delAFrame_Shift_Del424.34EVSATN1000N
CTBP2NQPTNTGTIBREAST970p.K974fsc.2922_2922delAFrame_Shift_Del424.34HCC1143N1000N
CTBP2NQPTNTGTIBREAST970p.K974fsc.2922_2922delAFrame_Shift_Del424.34HCC1419N1000N
CTBP2NQPTNTGTIBREAST970p.K974fsc.2922_2922delAFrame_Shift_Del424.34HCC1500N1000N
CTBP2NQPTNTGTIBREAST970p.K974fsc.2922_2922delAFrame_Shift_Del424.34HCC2218N1000N
CTBP2NQPTNTGTIBREAST970p.K974fsc.2922_2922delAFrame_Shift_Del424.34KPL1N1000N
CTBP2NQPTNTGTIBREAST970p.K974fsc.2922_2922delAFrame_Shift_Del424.34MCF7N1000N
CTBP2NQPTNTGTIBREAST970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SKBR3N1000N
CTBP2NQPTNTGTIBREAST970p.K974fsc.2922_2922delAFrame_Shift_Del424.34T47DN1000N
CTBP2NTGTIESTPBREAST974p.K974fsc.2922_2922delAFrame_Shift_Del524.34BT20N000N
CTBP2NTGTIESTPBREAST974p.K974fsc.2922_2922delAFrame_Shift_Del524.34BT549N000N
CTBP2NTGTIESTPBREAST974p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAL851N000N
CTBP2NTGTIESTPBREAST974p.K974fsc.2922_2922delAFrame_Shift_Del524.34EVSATN000N
CTBP2NTGTIESTPBREAST974p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1143N000N
CTBP2NTGTIESTPBREAST974p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1419N000N
CTBP2NTGTIESTPBREAST974p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1500N000N
CTBP2NTGTIESTPBREAST974p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC2218N000N
CTBP2NTGTIESTPBREAST974p.K974fsc.2922_2922delAFrame_Shift_Del524.34KPL1N000N
CTBP2NTGTIESTPBREAST974p.K974fsc.2922_2922delAFrame_Shift_Del524.34MCF7N000N
CTBP2NTGTIESTPBREAST974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SKBR3N000N
CTBP2NTGTIESTPBREAST974p.K974fsc.2922_2922delAFrame_Shift_Del524.34T47DN000N
CTBP2PNQPTNTGTBREAST969p.K974fsc.2922_2922delAFrame_Shift_Del324.34BT20N000N
CTBP2PNQPTNTGTBREAST969p.K974fsc.2922_2922delAFrame_Shift_Del324.34BT549N000N
CTBP2PNQPTNTGTBREAST969p.K974fsc.2922_2922delAFrame_Shift_Del324.34CAL851N000N
CTBP2PNQPTNTGTBREAST969p.K974fsc.2922_2922delAFrame_Shift_Del324.34EVSATN000N
CTBP2PNQPTNTGTBREAST969p.K974fsc.2922_2922delAFrame_Shift_Del324.34HCC1143N000N
CTBP2PNQPTNTGTBREAST969p.K974fsc.2922_2922delAFrame_Shift_Del324.34HCC1419N000N
CTBP2PNQPTNTGTBREAST969p.K974fsc.2922_2922delAFrame_Shift_Del324.34HCC1500N000N
CTBP2PNQPTNTGTBREAST969p.K974fsc.2922_2922delAFrame_Shift_Del324.34HCC2218N000N
CTBP2PNQPTNTGTBREAST969p.K974fsc.2922_2922delAFrame_Shift_Del324.34KPL1N000N
CTBP2PNQPTNTGTBREAST969p.K974fsc.2922_2922delAFrame_Shift_Del324.34MCF7N000N
CTBP2PNQPTNTGTBREAST969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SKBR3N000N
CTBP2PNQPTNTGTBREAST969p.K974fsc.2922_2922delAFrame_Shift_Del324.34T47DN000N
CTBP2PSPNQPTNTBREAST967p.K974fsc.2922_2922delAFrame_Shift_Del224.34BT20N000N
CTBP2PSPNQPTNTBREAST967p.K974fsc.2922_2922delAFrame_Shift_Del224.34BT549N000N
CTBP2PSPNQPTNTBREAST967p.K974fsc.2922_2922delAFrame_Shift_Del224.34CAL851N000N
CTBP2PSPNQPTNTBREAST967p.K974fsc.2922_2922delAFrame_Shift_Del224.34EVSATN000N
CTBP2PSPNQPTNTBREAST967p.K974fsc.2922_2922delAFrame_Shift_Del224.34HCC1143N000N
CTBP2PSPNQPTNTBREAST967p.K974fsc.2922_2922delAFrame_Shift_Del224.34HCC1419N000N
CTBP2PSPNQPTNTBREAST967p.K974fsc.2922_2922delAFrame_Shift_Del224.34HCC1500N000N
CTBP2PSPNQPTNTBREAST967p.K974fsc.2922_2922delAFrame_Shift_Del224.34HCC2218N000N
CTBP2PSPNQPTNTBREAST967p.K974fsc.2922_2922delAFrame_Shift_Del224.34KPL1N000N
CTBP2PSPNQPTNTBREAST967p.K974fsc.2922_2922delAFrame_Shift_Del224.34MCF7N000N
CTBP2PSPNQPTNTBREAST967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SKBR3N000N
CTBP2PSPNQPTNTBREAST967p.K974fsc.2922_2922delAFrame_Shift_Del224.34T47DN000N
CTBP2PTNTGTIESBREAST972p.K974fsc.2922_2922delAFrame_Shift_Del524.34BT20N000N
CTBP2PTNTGTIESBREAST972p.K974fsc.2922_2922delAFrame_Shift_Del524.34BT549N000N
CTBP2PTNTGTIESBREAST972p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAL851N000N
CTBP2PTNTGTIESBREAST972p.K974fsc.2922_2922delAFrame_Shift_Del524.34EVSATN000N
CTBP2PTNTGTIESBREAST972p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1143N000N
CTBP2PTNTGTIESBREAST972p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1419N000N
CTBP2PTNTGTIESBREAST972p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1500N000N
CTBP2PTNTGTIESBREAST972p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC2218N000N
CTBP2PTNTGTIESBREAST972p.K974fsc.2922_2922delAFrame_Shift_Del524.34KPL1N000N
CTBP2PTNTGTIESBREAST972p.K974fsc.2922_2922delAFrame_Shift_Del524.34MCF7N000N
CTBP2PTNTGTIESBREAST972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SKBR3N000N
CTBP2PTNTGTIESBREAST972p.K974fsc.2922_2922delAFrame_Shift_Del524.34T47DN000N
CTBP2QPTNTGTIEBREAST971p.K974fsc.2922_2922delAFrame_Shift_Del524.34BT20N000N
CTBP2QPTNTGTIEBREAST971p.K974fsc.2922_2922delAFrame_Shift_Del524.34BT549N000N
CTBP2QPTNTGTIEBREAST971p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAL851N000N
CTBP2QPTNTGTIEBREAST971p.K974fsc.2922_2922delAFrame_Shift_Del524.34EVSATN000N
CTBP2QPTNTGTIEBREAST971p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1143N000N
CTBP2QPTNTGTIEBREAST971p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1419N000N
CTBP2QPTNTGTIEBREAST971p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1500N000N
CTBP2QPTNTGTIEBREAST971p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC2218N000N
CTBP2QPTNTGTIEBREAST971p.K974fsc.2922_2922delAFrame_Shift_Del524.34KPL1N000N
CTBP2QPTNTGTIEBREAST971p.K974fsc.2922_2922delAFrame_Shift_Del524.34MCF7N000N
CTBP2QPTNTGTIEBREAST971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SKBR3N000N
CTBP2QPTNTGTIEBREAST971p.K974fsc.2922_2922delAFrame_Shift_Del524.34T47DN000N
CTBP2SPNQPTNTGBREAST968p.K974fsc.2922_2922delAFrame_Shift_Del224.34BT20N000N
CTBP2SPNQPTNTGBREAST968p.K974fsc.2922_2922delAFrame_Shift_Del224.34BT549N000N
CTBP2SPNQPTNTGBREAST968p.K974fsc.2922_2922delAFrame_Shift_Del224.34CAL851N000N
CTBP2SPNQPTNTGBREAST968p.K974fsc.2922_2922delAFrame_Shift_Del224.34EVSATN000N
CTBP2SPNQPTNTGBREAST968p.K974fsc.2922_2922delAFrame_Shift_Del224.34HCC1143N000N
CTBP2SPNQPTNTGBREAST968p.K974fsc.2922_2922delAFrame_Shift_Del224.34HCC1419N000N
CTBP2SPNQPTNTGBREAST968p.K974fsc.2922_2922delAFrame_Shift_Del224.34HCC1500N000N
CTBP2SPNQPTNTGBREAST968p.K974fsc.2922_2922delAFrame_Shift_Del224.34HCC2218N000N
CTBP2SPNQPTNTGBREAST968p.K974fsc.2922_2922delAFrame_Shift_Del224.34KPL1N000N
CTBP2SPNQPTNTGBREAST968p.K974fsc.2922_2922delAFrame_Shift_Del224.34MCF7N000N
CTBP2SPNQPTNTGBREAST968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SKBR3N000N
CTBP2SPNQPTNTGBREAST968p.K974fsc.2922_2922delAFrame_Shift_Del224.34T47DN000N
CTBP2TGTIESTPTBREAST975p.K974fsc.2922_2922delAFrame_Shift_Del524.34BT20N000N
CTBP2TGTIESTPTBREAST975p.K974fsc.2922_2922delAFrame_Shift_Del524.34BT549N000N
CTBP2TGTIESTPTBREAST975p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAL851N000N
CTBP2TGTIESTPTBREAST975p.K974fsc.2922_2922delAFrame_Shift_Del524.34EVSATN000N
CTBP2TGTIESTPTBREAST975p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1143N000N
CTBP2TGTIESTPTBREAST975p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1419N000N
CTBP2TGTIESTPTBREAST975p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1500N000N
CTBP2TGTIESTPTBREAST975p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC2218N000N
CTBP2TGTIESTPTBREAST975p.K974fsc.2922_2922delAFrame_Shift_Del524.34KPL1N000N
CTBP2TGTIESTPTBREAST975p.K974fsc.2922_2922delAFrame_Shift_Del524.34MCF7N000N
CTBP2TGTIESTPTBREAST975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SKBR3N000N
CTBP2TGTIESTPTBREAST975p.K974fsc.2922_2922delAFrame_Shift_Del524.34T47DN000N
CTBP2TIESTPTSNBREAST977p.K974fsc.2922_2922delAFrame_Shift_Del524.34BT20N100N
CTBP2TIESTPTSNBREAST977p.K974fsc.2922_2922delAFrame_Shift_Del524.34BT549N100N
CTBP2TIESTPTSNBREAST977p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAL851N100N
CTBP2TIESTPTSNBREAST977p.K974fsc.2922_2922delAFrame_Shift_Del524.34EVSATN100N
CTBP2TIESTPTSNBREAST977p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1143N100N
CTBP2TIESTPTSNBREAST977p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1419N100N
CTBP2TIESTPTSNBREAST977p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1500N100N
CTBP2TIESTPTSNBREAST977p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC2218N100N
CTBP2TIESTPTSNBREAST977p.K974fsc.2922_2922delAFrame_Shift_Del524.34KPL1N100N
CTBP2TIESTPTSNBREAST977p.K974fsc.2922_2922delAFrame_Shift_Del524.34MCF7N100N
CTBP2TIESTPTSNBREAST977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SKBR3N100N
CTBP2TIESTPTSNBREAST977p.K974fsc.2922_2922delAFrame_Shift_Del524.34T47DN100N
CTBP2TNTGTIESTBREAST973p.K974fsc.2922_2922delAFrame_Shift_Del524.34BT20N000N
CTBP2TNTGTIESTBREAST973p.K974fsc.2922_2922delAFrame_Shift_Del524.34BT549N000N
CTBP2TNTGTIESTBREAST973p.K974fsc.2922_2922delAFrame_Shift_Del524.34CAL851N000N
CTBP2TNTGTIESTBREAST973p.K974fsc.2922_2922delAFrame_Shift_Del524.34EVSATN000N
CTBP2TNTGTIESTBREAST973p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1143N000N
CTBP2TNTGTIESTBREAST973p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1419N000N
CTBP2TNTGTIESTBREAST973p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC1500N000N
CTBP2TNTGTIESTBREAST973p.K974fsc.2922_2922delAFrame_Shift_Del524.34HCC2218N000N
CTBP2TNTGTIESTBREAST973p.K974fsc.2922_2922delAFrame_Shift_Del524.34KPL1N000N
CTBP2TNTGTIESTBREAST973p.K974fsc.2922_2922delAFrame_Shift_Del524.34MCF7N000N
CTBP2TNTGTIESTBREAST973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SKBR3N000N
CTBP2TNTGTIESTBREAST973p.K974fsc.2922_2922delAFrame_Shift_Del524.34T47DN000N
CTBP2AADTEQGCIBREAST176p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N500N
CTBP2AARHQVWGGBREAST192p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N000N
CTBP2ACLPPQPGLBREAST202p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N1100N
CTBP2ADTEQGCISBREAST177p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N100N
CTBP2ARHQVWGGGBREAST193p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N100N
CTBP2AVWTGAARHBREAST187p.Q175fsc.524_525delAGFrame_Shift_Del40.44MDAMB468N000N
CTBP2CISRAVWTGBREAST183p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N000N
CTBP2CLPPQPGLQBREAST203p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N000N
CTBP2DPGGKMIPRBREAST167p.Q175fsc.524_525delAGFrame_Shift_Del10.44MDAMB468Y590N
CTBP2DTEQGCISRBREAST178p.Q175fsc.524_525delAGFrame_Shift_Del60.44MDAMB468N500N
CTBP2EQGCISRAVBREAST180p.Q175fsc.524_525delAGFrame_Shift_Del40.44MDAMB468Y2130Y
CTBP2GAARHQVWGBREAST191p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N000N
CTBP2GACLPPQPGBREAST201p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N000N
CTBP2GCISRAVWTBREAST182p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N100N
CTBP2GGACLPPQPBREAST200p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N000N
CTBP2GGGACLPPQBREAST199p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N000N
CTBP2GGKMIPRAABREAST169p.Q175fsc.524_525delAGFrame_Shift_Del30.44MDAMB468N100N
CTBP2GKMIPRAADBREAST170p.Q175fsc.524_525delAGFrame_Shift_Del40.44MDAMB468N000N
CTBP2GLQRHQRKTBREAST209p.Q175fsc.524_525delAGFrame_Shift_Del60.44MDAMB468N100N
CTBP2HQVWGGGACBREAST195p.Q175fsc.524_525delAGFrame_Shift_Del60.44MDAMB468N200N
CTBP2IPRAADTEQBREAST173p.Q175fsc.524_525delAGFrame_Shift_Del40.44MDAMB468N100N
CTBP2ISRAVWTGABREAST184p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468Y2110N
CTBP2KMIPRAADTBREAST171p.Q175fsc.524_525delAGFrame_Shift_Del40.44MDAMB468N400N
CTBP2LPPQPGLQRBREAST204p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N600N
CTBP2LQRHQRKTHBREAST210p.Q175fsc.524_525delAGFrame_Shift_Del60.44MDAMB468N0021N
CTBP2MIPRAADTEBREAST172p.Q175fsc.524_525delAGFrame_Shift_Del40.44MDAMB468N001N
CTBP2PGGKMIPRABREAST168p.Q175fsc.524_525delAGFrame_Shift_Del20.44MDAMB468N000N
CTBP2PGLQRHQRKBREAST208p.Q175fsc.524_525delAGFrame_Shift_Del60.44MDAMB468N000N
CTBP2PPQPGLQRHBREAST205p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N000N
CTBP2PQPGLQRHQBREAST206p.Q175fsc.524_525delAGFrame_Shift_Del60.44MDAMB468N000N
CTBP2PRAADTEQGBREAST174p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N000N
CTBP2QGCISRAVWBREAST181p.Q175fsc.524_525delAGFrame_Shift_Del40.44MDAMB468N100N
CTBP2QPGLQRHQRBREAST207p.Q175fsc.524_525delAGFrame_Shift_Del60.44MDAMB468N300N
CTBP2QVWGGGACLBREAST196p.Q175fsc.524_525delAGFrame_Shift_Del60.44MDAMB468N1200N
CTBP2RAADTEQGCBREAST175p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N200N
CTBP2RAVWTGAARBREAST186p.Q175fsc.524_525delAGFrame_Shift_Del30.44MDAMB468Y490N
CTBP2RHQVWGGGABREAST194p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N100N
CTBP2SRAVWTGAABREAST185p.Q175fsc.524_525delAGFrame_Shift_Del40.44MDAMB468N200N
CTBP2TEQGCISRABREAST179p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N500N
CTBP2TGAARHQVWBREAST190p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N200N
CTBP2VWGGGACLPBREAST197p.Q175fsc.524_525delAGFrame_Shift_Del60.44MDAMB468N000N
CTBP2VWTGAARHQBREAST188p.Q175fsc.524_525delAGFrame_Shift_Del40.44MDAMB468N000N
CTBP2WGGGACLPPBREAST198p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N200N
CTBP2WTGAARHQVBREAST189p.Q175fsc.524_525delAGFrame_Shift_Del50.44MDAMB468N500N
CTBP2AARIREETLBREAST715p.G720Ec.2159G>AMissense_Mutation10.11MDAMB453Y9100N
CTBP2ARIREETLGBREAST716p.G720Ec.2159G>AMissense_Mutation10.11MDAMB453N100N
CTBP2ASGAARIREBREAST712p.G720Ec.2159G>AMissense_Mutation10.11MDAMB453N000N
CTBP2AYETYGADLBREAST269p.E274Gc.821A>GMissense_Mutation10.11HCC1569Y7100N
CTBP2EETLGLIGFBREAST720p.G720Ec.2159G>AMissense_Mutation10.11MDAMB453Y690N
CTBP2ETYGADLSTBREAST271p.E274Gc.821A>GMissense_Mutation10.11HCC1569N000N
CTBP2GAARIREETBREAST714p.G720Ec.2159G>AMissense_Mutation10.11MDAMB453N300N
CTBP2GADLSTFQGBREAST274p.E274Gc.821A>GMissense_Mutation10.11HCC1569N100N
CTBP2IREETLGLIBREAST718p.G720Ec.2159G>AMissense_Mutation10.11MDAMB453N500Y
CTBP2KMAYETYGABREAST267p.E274Gc.821A>GMissense_Mutation10.11HCC1569N500N
CTBP2MAYETYGADBREAST268p.E274Gc.821A>GMissense_Mutation10.11HCC1569N000N
CTBP2REETLGLIGBREAST719p.G720Ec.2159G>AMissense_Mutation10.11MDAMB453N000N
CTBP2RIREETLGLBREAST717p.G720Ec.2159G>AMissense_Mutation10.11MDAMB453Y7100N
CTBP2SGAARIREEBREAST713p.G720Ec.2159G>AMissense_Mutation10.11MDAMB453N000N
CTBP2SKMAYETYGBREAST266p.E274Gc.821A>GMissense_Mutation10.11HCC1569N000N
CTBP2TYGADLSTFBREAST272p.E274Gc.821A>GMissense_Mutation10.11HCC1569N600N
CTBP2YETYGADLSBREAST270p.E274Gc.821A>GMissense_Mutation10.11HCC1569N700N
CTBP2YGADLSTFQBREAST273p.E274Gc.821A>GMissense_Mutation10.11HCC1569N2012N
CTBP2DFNIKQMRQBREAST795p.T797Nc.2390C>AMissense_Mutation10.22AU565N000N
CTBP2DFNIKQMRQBREAST795p.T797Nc.2390C>AMissense_Mutation10.22SKBR3N000N
CTBP2FNIKQMRQGBREAST796p.T797Nc.2390C>AMissense_Mutation10.22AU565N2012N
CTBP2FNIKQMRQGBREAST796p.T797Nc.2390C>AMissense_Mutation10.22SKBR3N2012N
CTBP2HHLINDFNIBREAST790p.T797Nc.2390C>AMissense_Mutation10.22AU565Y6120N
CTBP2HHLINDFNIBREAST790p.T797Nc.2390C>AMissense_Mutation10.22SKBR3Y6120N
CTBP2HLINDFNIKBREAST791p.T797Nc.2390C>AMissense_Mutation10.22AU565N600N
CTBP2HLINDFNIKBREAST791p.T797Nc.2390C>AMissense_Mutation10.22SKBR3N600N
CTBP2INDFNIKQMBREAST793p.T797Nc.2390C>AMissense_Mutation10.22AU565N300N
CTBP2INDFNIKQMBREAST793p.T797Nc.2390C>AMissense_Mutation10.22SKBR3N300N
CTBP2LINDFNIKQBREAST792p.T797Nc.2390C>AMissense_Mutation10.22AU565N0016N
CTBP2LINDFNIKQBREAST792p.T797Nc.2390C>AMissense_Mutation10.22SKBR3N0016N
CTBP2NDFNIKQMRBREAST794p.T797Nc.2390C>AMissense_Mutation10.22AU565N100N
CTBP2NDFNIKQMRBREAST794p.T797Nc.2390C>AMissense_Mutation10.22SKBR3N100N
CTBP2NHHLINDFNBREAST789p.T797Nc.2390C>AMissense_Mutation10.22AU565N100N
CTBP2NHHLINDFNBREAST789p.T797Nc.2390C>AMissense_Mutation10.22SKBR3N100N
CTBP2NIKQMRQGABREAST797p.T797Nc.2390C>AMissense_Mutation10.22AU565N000N
CTBP2NIKQMRQGABREAST797p.T797Nc.2390C>AMissense_Mutation10.22SKBR3N000N
EGFRETKFKKIKVBREAST709p.E711Kc.2131G>AMissense_Mutation10.11EVSATY2100N
EGFRILKETKFKKBREAST706p.E711Kc.2131G>AMissense_Mutation10.11EVSATN500N
EGFRKETKFKKIKBREAST708p.E711Kc.2131G>AMissense_Mutation10.11EVSATN100N
EGFRKFKKIKVLGBREAST711p.E711Kc.2131G>AMissense_Mutation10.11EVSATN100N
EGFRLKETKFKKIBREAST707p.E711Kc.2131G>AMissense_Mutation10.11EVSATN300N
EGFRLLRILKETKBREAST703p.E711Kc.2131G>AMissense_Mutation10.11EVSATN4013N
EGFRLRILKETKFBREAST704p.E711Kc.2131G>AMissense_Mutation10.11EVSATN5010N
EGFRRILKETKFKBREAST705p.E711Kc.2131G>AMissense_Mutation10.11EVSATN400N
EGFRTKFKKIKVLBREAST710p.E711Kc.2131G>AMissense_Mutation10.11EVSATN700N
ERBB2LTEILKGGSBREAST145p.G152fsc.454_454delGFrame_Shift_Del10.11MDAMB468N100N
FBXW7CKPTQVKHMBREAST260p.E261Kc.781G>AMissense_Mutation10.11EVSATN400N
FBXW7DELIDSCKPBREAST254p.E261Kc.781G>AMissense_Mutation10.11EVSATN100N
FBXW7DSCKPTQVKBREAST258p.E261Kc.781G>AMissense_Mutation10.11EVSATN200N
FBXW7ELIDSCKPTBREAST255p.E261Kc.781G>AMissense_Mutation10.11EVSATN100N
FBXW7IDSCKPTQVBREAST257p.E261Kc.781G>AMissense_Mutation10.11EVSATN500N
FBXW7KPTQVKHMMBREAST261p.E261Kc.781G>AMissense_Mutation10.11EVSATY13100N
FBXW7LDELIDSCKBREAST253p.E261Kc.781G>AMissense_Mutation10.11EVSATN100N
FBXW7LIDSCKPTQBREAST256p.E261Kc.781G>AMissense_Mutation10.11EVSATN002N
FBXW7SCKPTQVKHBREAST259p.E261Kc.781G>AMissense_Mutation10.11EVSATN000N
FGFR2CIGGYKVRNBREAST203p.R203Cc.607C>TMissense_Mutation10.11HCC1143N000N
FGFR2EFKQEHCIGBREAST197p.R203Cc.607C>TMissense_Mutation10.11HCC1143N000N
FGFR2EHCIGGYKVBREAST201p.R203Cc.607C>TMissense_Mutation10.11HCC1143N200N
FGFR2FKQEHCIGGBREAST198p.R203Cc.607C>TMissense_Mutation10.11HCC1143N204N
FGFR2GKEFKQEHCBREAST195p.R203Cc.607C>TMissense_Mutation10.11HCC1143N100N
FGFR2HCIGGYKVRBREAST202p.R203Cc.607C>TMissense_Mutation10.11HCC1143N300N
FGFR2IDYYKETTNBREAST655p.K660Ec.1978A>GMissense_Mutation10.11EFM19N100N
FGFR2INNIDYYKEBREAST652p.K660Ec.1978A>GMissense_Mutation10.11EFM19N000N
FGFR2KEFKQEHCIBREAST196p.R203Cc.607C>TMissense_Mutation10.11HCC1143Y1090N
FGFR2KQEHCIGGYBREAST199p.R203Cc.607C>TMissense_Mutation10.11HCC1143N700N
FGFR2NIDYYKETTBREAST654p.K660Ec.1978A>GMissense_Mutation10.11EFM19N000N
FGFR2NNIDYYKETBREAST653p.K660Ec.1978A>GMissense_Mutation10.11EFM19N100N
FGFR2QEHCIGGYKBREAST200p.R203Cc.607C>TMissense_Mutation10.11HCC1143N100N
FGFR2DYYKETTNGBREAST656p.K660Ec.1978A>GMissense_Mutation10.33EFM19N000N
FGFR2ETTNGRLPVBREAST660p.K660Ec.1978A>GMissense_Mutation10.33EFM19N200N
FGFR2KETTNGRLPBREAST659p.K660Ec.1978A>GMissense_Mutation10.33EFM19N000N
FGFR2YKETTNGRLBREAST658p.K660Ec.1978A>GMissense_Mutation10.33EFM19N702N
FGFR2YYKETTNGRBREAST657p.K660Ec.1978A>GMissense_Mutation10.33EFM19N304N
FGFR3CRQRLTERVBREAST109p.Q115Ec.343C>GMissense_Mutation10.11HS742TY3120N
FGFR3ERVLCHFSVBREAST115p.Q115Ec.343C>GMissense_Mutation10.11HS742TY4100N
FGFR3LTERVLCHFBREAST113p.Q115Ec.343C>GMissense_Mutation10.11HS742TN600N
FGFR3QRLTERVLCBREAST111p.Q115Ec.343C>GMissense_Mutation10.11HS742TN300N
FGFR3RLTERVLCHBREAST112p.Q115Ec.343C>GMissense_Mutation10.11HS742TN200N
FGFR3RQRLTERVLBREAST110p.Q115Ec.343C>GMissense_Mutation10.11HS742TY10130N
FGFR3SCRQRLTERBREAST108p.Q115Ec.343C>GMissense_Mutation10.11HS742TY5100N
FGFR3TERVLCHFSBREAST114p.Q115Ec.343C>GMissense_Mutation10.11HS742TN400N
FGFR3YSCRQRLTEBREAST107p.Q115Ec.343C>GMissense_Mutation10.11HS742TN205N
FMN2LPPLPGAAIBREAST934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03AU565N1401N
FMN2LPPLPGAAIBREAST934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03BT549N1401N
FMN2LPPLPGAAIBREAST934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03DU4475N1401N
FMN2LPPLPGAAIBREAST934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03HCC1806N1401N
FMN2LPPLPGAAIBREAST934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03KPL1N1401N
FMN2LPPLPGAAIBREAST934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03MCF7N1401N
FMN2LPPLPGAAIBREAST934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03SKBR3N1401N
FMN2LPPLPGAAIBREAST934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03ZR7530N1401N
FMN2PLPPLPGAABREAST933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03AU565N000N
FMN2PLPPLPGAABREAST933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03BT549N000N
FMN2PLPPLPGAABREAST933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03DU4475N000N
FMN2PLPPLPGAABREAST933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03HCC1806N000N
FMN2PLPPLPGAABREAST933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03KPL1N000N
FMN2PLPPLPGAABREAST933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03MCF7N000N
FMN2PLPPLPGAABREAST933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03SKBR3N000N
FMN2PLPPLPGAABREAST933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03ZR7530N000N
FMN2GIPPPPLPGBREAST1106p.P1116delc.3334_3336delCCTIn_Frame_Del20.44HCC1500N000N
FMN2GIPPPPLPGBREAST1106p.P1116delc.3334_3336delCCTIn_Frame_Del20.44HCC70N000N
FMN2GVGIPPPPLBREAST1104p.P1116delc.3334_3336delCCTIn_Frame_Del10.44HCC1500Y5120Y
FMN2GVGIPPPPLBREAST1104p.P1116delc.3334_3336delCCTIn_Frame_Del10.44HCC70Y5120Y
FMN2IPPPPLPGABREAST1107p.P1116delc.3334_3336delCCTIn_Frame_Del10.44HCC1500N900N
FMN2IPPPPLPGABREAST1107p.P1116delc.3334_3336delCCTIn_Frame_Del10.44HCC70N900N
FMN2VGIPPPPLPBREAST1105p.P1116delc.3334_3336delCCTIn_Frame_Del20.44HCC1500N000N
FMN2VGIPPPPLPBREAST1105p.P1116delc.3334_3336delCCTIn_Frame_Del20.44HCC70N000N
FMN2DKGTRKQPIBREAST1279p.Q1282Pc.3845A>CMissense_Mutation10.11HMC18N300N
FMN2FQNVFTGQTBREAST533p.R540Qc.1619G>AMissense_Mutation10.11CAL148N509N
FMN2FTGQTLLEKBREAST537p.R540Qc.1619G>AMissense_Mutation10.11CAL148N701N
FMN2GFQNVFTGQBREAST532p.R540Qc.1619G>AMissense_Mutation10.11CAL148N000Y
FMN2GMNQDKGTRBREAST1275p.Q1282Pc.3845A>CMissense_Mutation10.11HMC18N700N
FMN2GQTLLEKLFBREAST539p.R540Qc.1619G>AMissense_Mutation10.11CAL148N600N
FMN2GTRKQPIEPBREAST1281p.Q1282Pc.3845A>CMissense_Mutation10.11HMC18N000N
FMN2KGTRKQPIEBREAST1280p.Q1282Pc.3845A>CMissense_Mutation10.11HMC18N000N
FMN2LGMNQDKGTBREAST1274p.Q1282Pc.3845A>CMissense_Mutation10.11HMC18N000N
FMN2MNQDKGTRKBREAST1276p.Q1282Pc.3845A>CMissense_Mutation10.11HMC18N000N
FMN2NQDKGTRKQBREAST1277p.Q1282Pc.3845A>CMissense_Mutation10.11HMC18N000N
FMN2NVFTGQTLLBREAST535p.R540Qc.1619G>AMissense_Mutation10.11CAL148N1600N
FMN2QDKGTRKQPBREAST1278p.Q1282Pc.3845A>CMissense_Mutation10.11HMC18N000N
FMN2QNVFTGQTLBREAST534p.R540Qc.1619G>AMissense_Mutation10.11CAL148N700N
FMN2QTLLEKLFSBREAST540p.R540Qc.1619G>AMissense_Mutation10.11CAL148N000N
FMN2TGQTLLEKLBREAST538p.R540Qc.1619G>AMissense_Mutation10.11CAL148N1200N
FMN2TRKQPIEPCBREAST1282p.Q1282Pc.3845A>CMissense_Mutation10.11HMC18N200Y
FMN2VFTGQTLLEBREAST536p.R540Qc.1619G>AMissense_Mutation10.11CAL148N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7BT20N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7BT483N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7CAL51N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7CAMA1N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7EFM19N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HCC1143N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HCC1187N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HCC1419N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HCC1428N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HCC1500N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HCC1569N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HCC1599N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HCC1806N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HCC1954N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HCC202N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HCC2157N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HCC2218N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HCC38N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HCC70N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HMC18N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HS281TN000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HS578TN000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HS739TN000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HS742TN000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KPL1N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7MDAMB134VIN000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7MDAMB361N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7MDAMB415N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7MDAMB453N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7MDAMB468N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7UACC812N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7UACC893N000N
GPR112ASISDMFIQBREAST2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7ZR7530N000N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7BT20Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7BT483Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7CAL51Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7CAMA1Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7EFM19Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1143Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1187Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1419Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1428Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1500Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1569Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1599Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1806Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1954Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC202Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC2157Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC2218Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC38Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC70Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HMC18Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS281TY11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS578TY11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS739TY11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS742TY11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KPL1Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7MDAMB134VIY11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7MDAMB361Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7MDAMB415Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7MDAMB453Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7MDAMB468Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7UACC812Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7UACC893Y11100N
GPR112ISDMFIQNLBREAST2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7ZR7530Y11100N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7BT20N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7BT483N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7CAL51N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7CAMA1N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7EFM19N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1143N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1187N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1419N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1428N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1500N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1569N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1599N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1806N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1954N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC202N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC2157N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC2218N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC38N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC70N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HMC18N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS281TN700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS578TN700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS739TN700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS742TN700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KPL1N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7MDAMB134VIN700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7MDAMB361N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7MDAMB415N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7MDAMB453N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7MDAMB468N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7UACC812N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7UACC893N700N
GPR112SASISDMFIBREAST2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7ZR7530N700N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7BT20N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7BT483N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7CAL51N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7CAMA1N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7EFM19N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1143N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1187N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1419N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1428N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1500N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1569N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1599N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1806N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1954N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC202N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC2157N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC2218N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC38N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC70N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HMC18N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS281TN400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS578TN400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS739TN400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS742TN400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KPL1N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7MDAMB134VIN400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7MDAMB361N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7MDAMB415N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7MDAMB453N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7MDAMB468N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7UACC812N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7UACC893N400N
GPR112SDMFIQNLABREAST2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7ZR7530N400N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7BT20N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7BT483N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7CAL51N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7CAMA1N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7EFM19N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1143N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1187N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1419N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1428N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1500N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1569N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1599N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1806N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC1954N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC202N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC2157N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC2218N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC38N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HCC70N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HMC18N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS281TN000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS578TN000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS739TN000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS742TN000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KPL1N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7MDAMB134VIN000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7MDAMB361N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7MDAMB415N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7MDAMB453N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7MDAMB468N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7UACC812N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7UACC893N000N
GPR112SISDMFIQNBREAST2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7ZR7530N000N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7BT20N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7BT483N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7CAL51N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7CAMA1N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7EFM19N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1143N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1187N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1419N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1428N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1500N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1569N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1599N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1806N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC1954N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC202N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC2157N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC2218N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC38N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HCC70N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HMC18N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS281TN900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS578TN900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS739TN900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS742TN900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KPL1N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7MDAMB134VIN900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7MDAMB361N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7MDAMB415N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7MDAMB453N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7MDAMB468N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7UACC812N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7UACC893N900N
GPR112VSASISDMFBREAST2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7ZR7530N900N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7BT20N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7BT483N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7CAL51N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7CAMA1N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7EFM19N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1143N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1187N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1419N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1428N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1500N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1569N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1599N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1806N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC1954N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC202N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC2157N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC2218N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC38N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HCC70N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HMC18N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS281TN5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS578TN5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS739TN5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS742TN5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KPL1N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7MDAMB134VIN5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7MDAMB361N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7MDAMB415N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7MDAMB453N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7MDAMB468N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7UACC812N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7UACC893N5020N
GPR112VVSASISDMBREAST2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7ZR7530N5020N
GPR112ADETASKYEBREAST2388p.K2396Ec.7186A>GMissense_Mutation10.11HCC1599N000N
GPR112ASKYEGTYKBREAST2392p.K2396Ec.7186A>GMissense_Mutation10.11HCC1599Y1120N
GPR112CVMKESVWEBREAST2987p.R2994Wc.8980C>TMissense_Mutation10.11T47DN000N
GPR112DETASKYEGBREAST2389p.K2396Ec.7186A>GMissense_Mutation10.11HCC1599N100N
GPR112EFPVLGIRMBREAST1862p.T1868Ic.5603C>TMissense_Mutation10.11HCC1428Y590N
GPR112EGTYKWLLTBREAST2396p.K2396Ec.7186A>GMissense_Mutation10.11HCC1599N100N
GPR112ESLSLSTSGBREAST1464p.A1471Sc.4411G>TMissense_Mutation10.11CAL148N000Y
GPR112ESVWEQWQIBREAST2991p.R2994Wc.8980C>TMissense_Mutation10.11T47DN700N
GPR112ETASKYEGTBREAST2390p.K2396Ec.7186A>GMissense_Mutation10.11HCC1599N200N
GPR112FLLGPTWGFBREAST2947p.L2951Pc.8852T>CMissense_Mutation10.11HCC1806N1007N
GPR112FPVLGIRMTBREAST1863p.T1868Ic.5603C>TMissense_Mutation10.11HCC1428N800N
GPR112GIRMTSSNTBREAST1867p.T1868Ic.5603C>TMissense_Mutation10.11HCC1428N000N
GPR112GPTWGFAFFBREAST2950p.L2951Pc.8852T>CMissense_Mutation10.11HCC1806Y1290N
GPR112HCVMKESVWBREAST2986p.R2994Wc.8980C>TMissense_Mutation10.11T47DN300N
GPR112IRMTSSNTQBREAST1868p.T1868Ic.5603C>TMissense_Mutation10.11HCC1428N1034N
GPR112KESVWEQWQBREAST2990p.R2994Wc.8980C>TMissense_Mutation10.11T47DN000N
GPR112KTMSPSTSDBREAST2129p.T2136Sc.6407C>GMissense_Mutation10.11DU4475N000N
GPR112KYEGTYKWLBREAST2394p.K2396Ec.7186A>GMissense_Mutation10.11HCC1599Y10100N
GPR112LGIRMTSSNBREAST1866p.T1868Ic.5603C>TMissense_Mutation10.11HCC1428N009N
GPR112LGPTWGFAFBREAST2949p.L2951Pc.8852T>CMissense_Mutation10.11HCC1806N804N
GPR112LLGPTWGFABREAST2948p.L2951Pc.8852T>CMissense_Mutation10.11HCC1806N500N
GPR112LSLSTSGLYBREAST1466p.A1471Sc.4411G>TMissense_Mutation10.11CAL148N800N
GPR112LSTSGLYNDBREAST1468p.A1471Sc.4411G>TMissense_Mutation10.11CAL148N000N
GPR112LTFLLGPTWBREAST2945p.L2951Pc.8852T>CMissense_Mutation10.11HCC1806N600N
GPR112MKESVWEQWBREAST2989p.R2994Wc.8980C>TMissense_Mutation10.11T47DN400N
GPR112MSLTFLLGPBREAST2943p.L2951Pc.8852T>CMissense_Mutation10.11HCC1806N000N
GPR112MSPSTSDHTBREAST2131p.T2136Sc.6407C>GMissense_Mutation10.11DU4475N200N
GPR112MVEFPVLGIBREAST1860p.T1868Ic.5603C>TMissense_Mutation10.11HCC1428Y61434N
GPR112PESLSLSTSBREAST1463p.A1471Sc.4411G>TMissense_Mutation10.11CAL148N000Y
GPR112PSTSDHTLSBREAST2133p.T2136Sc.6407C>GMissense_Mutation10.11DU4475N000N
GPR112PTWGFAFFABREAST2951p.L2951Pc.8852T>CMissense_Mutation10.11HCC1806Y4110N
GPR112PVLGIRMTSBREAST1864p.T1868Ic.5603C>TMissense_Mutation10.11HCC1428N000N
GPR112RKTMSPSTSBREAST2128p.T2136Sc.6407C>GMissense_Mutation10.11DU4475N100N
GPR112SDHTLSVGABREAST2136p.T2136Sc.6407C>GMissense_Mutation10.11DU4475N300N
GPR112SGLYNDGFTBREAST1471p.A1471Sc.4411G>TMissense_Mutation10.11CAL148N300N
GPR112SKYEGTYKWBREAST2393p.K2396Ec.7186A>GMissense_Mutation10.11HCC1599N300N
GPR112SLSLSTSGLBREAST1465p.A1471Sc.4411G>TMissense_Mutation10.11CAL148N1100Y
GPR112SLSTSGLYNBREAST1467p.A1471Sc.4411G>TMissense_Mutation10.11CAL148N000N
GPR112SLTFLLGPTBREAST2944p.L2951Pc.8852T>CMissense_Mutation10.11HCC1806N200N
GPR112SPSTSDHTLBREAST2132p.T2136Sc.6407C>GMissense_Mutation10.11DU4475N1500N
GPR112STSDHTLSVBREAST2134p.T2136Sc.6407C>GMissense_Mutation10.11DU4475Y2100N
GPR112STSGLYNDGBREAST1469p.A1471Sc.4411G>TMissense_Mutation10.11CAL148N000N
GPR112SVWEQWQIHBREAST2992p.R2994Wc.8980C>TMissense_Mutation10.11T47DN000N
GPR112TASKYEGTYBREAST2391p.K2396Ec.7186A>GMissense_Mutation10.11HCC1599N400N
GPR112TFLLGPTWGBREAST2946p.L2951Pc.8852T>CMissense_Mutation10.11HCC1806N000N
GPR112TMSPSTSDHBREAST2130p.T2136Sc.6407C>GMissense_Mutation10.11DU4475N000N
GPR112TSDHTLSVGBREAST2135p.T2136Sc.6407C>GMissense_Mutation10.11DU4475N100N
GPR112TSGLYNDGFBREAST1470p.A1471Sc.4411G>TMissense_Mutation10.11CAL148N400N
GPR112VEFPVLGIRBREAST1861p.T1868Ic.5603C>TMissense_Mutation10.11HCC1428Y490N
GPR112VLGIRMTSSBREAST1865p.T1868Ic.5603C>TMissense_Mutation10.11HCC1428N003N
GPR112VMKESVWEQBREAST2988p.R2994Wc.8980C>TMissense_Mutation10.11T47DN006N
GPR112VWEQWQIHLBREAST2993p.R2994Wc.8980C>TMissense_Mutation10.11T47DN800N
GPR112WEQWQIHLCBREAST2994p.R2994Wc.8980C>TMissense_Mutation10.11T47DN802N
GPR112YEGTYKWLLBREAST2395p.K2396Ec.7186A>GMissense_Mutation10.11HCC1599N1302N
GPR112AFYENTTYTBREAST685p.H687Yc.2059C>TMissense_Mutation10.22MDAMB361N200N
GPR112ENFTSAFYEBREAST680p.H687Yc.2059C>TMissense_Mutation10.22MDAMB361N000N
GPR112FTSAFYENTBREAST682p.H687Yc.2059C>TMissense_Mutation10.22MDAMB361N400N
GPR112FYENTTYTEBREAST686p.H687Yc.2059C>TMissense_Mutation10.22MDAMB361N201N
GPR112NENFTSAFYBREAST679p.H687Yc.2059C>TMissense_Mutation10.22MDAMB361Y6120N
GPR112NFTSAFYENBREAST681p.H687Yc.2059C>TMissense_Mutation10.22MDAMB361N000N
GPR112SAFYENTTYBREAST684p.H687Yc.2059C>TMissense_Mutation10.22MDAMB361N800N
GPR112TSAFYENTTBREAST683p.H687Yc.2059C>TMissense_Mutation10.22MDAMB361N100N
GPR112YENTTYTEYBREAST687p.H687Yc.2059C>TMissense_Mutation10.22MDAMB361N900N
HSP90B1DEEETAKESBREAST787p.E791delc.2362_2364delGAAIn_Frame_Del121.79BT20N300N
HSP90B1DEEETAKESBREAST787p.E791delc.2362_2364delGAAIn_Frame_Del121.79CAL120N300N
HSP90B1DEEETAKESBREAST787p.E791delc.2362_2364delGAAIn_Frame_Del121.79CAMA1N300N
HSP90B1DEEETAKESBREAST787p.E791delc.2362_2364delGAAIn_Frame_Del121.79HCC1143N300N
HSP90B1DEEETAKESBREAST787p.E791delc.2362_2364delGAAIn_Frame_Del121.79HCC1954N300N
HSP90B1DEEETAKESBREAST787p.E791delc.2362_2364delGAAIn_Frame_Del121.79HS739TN300N
HSP90B1DEEETAKESBREAST787p.E791delc.2362_2364delGAAIn_Frame_Del121.79JIMT1N300N
HSP90B1DVGTDEEETBREAST783p.E791delc.2362_2364delGAAIn_Frame_Del121.79BT20N200N
HSP90B1DVGTDEEETBREAST783p.E791delc.2362_2364delGAAIn_Frame_Del121.79CAL120N200N
HSP90B1DVGTDEEETBREAST783p.E791delc.2362_2364delGAAIn_Frame_Del121.79CAMA1N200N
HSP90B1DVGTDEEETBREAST783p.E791delc.2362_2364delGAAIn_Frame_Del121.79HCC1143N200N
HSP90B1DVGTDEEETBREAST783p.E791delc.2362_2364delGAAIn_Frame_Del121.79HCC1954N200N
HSP90B1DVGTDEEETBREAST783p.E791delc.2362_2364delGAAIn_Frame_Del121.79HS739TN200N
HSP90B1DVGTDEEETBREAST783p.E791delc.2362_2364delGAAIn_Frame_Del121.79JIMT1N200N
HSP90B1GTDEEETAKBREAST785p.E791delc.2362_2364delGAAIn_Frame_Del321.79BT20N400N
HSP90B1GTDEEETAKBREAST785p.E791delc.2362_2364delGAAIn_Frame_Del321.79CAL120N400N
HSP90B1GTDEEETAKBREAST785p.E791delc.2362_2364delGAAIn_Frame_Del321.79CAMA1N400N
HSP90B1GTDEEETAKBREAST785p.E791delc.2362_2364delGAAIn_Frame_Del321.79HCC1143N400N
HSP90B1GTDEEETAKBREAST785p.E791delc.2362_2364delGAAIn_Frame_Del321.79HCC1954N400N
HSP90B1GTDEEETAKBREAST785p.E791delc.2362_2364delGAAIn_Frame_Del321.79HS739TN400N
HSP90B1GTDEEETAKBREAST785p.E791delc.2362_2364delGAAIn_Frame_Del321.79JIMT1N400N
HSP90B1TDEEETAKEBREAST786p.E791delc.2362_2364delGAAIn_Frame_Del221.79BT20N000N
HSP90B1TDEEETAKEBREAST786p.E791delc.2362_2364delGAAIn_Frame_Del221.79CAL120N000N
HSP90B1TDEEETAKEBREAST786p.E791delc.2362_2364delGAAIn_Frame_Del221.79CAMA1N000N
HSP90B1TDEEETAKEBREAST786p.E791delc.2362_2364delGAAIn_Frame_Del221.79HCC1143N000N
HSP90B1TDEEETAKEBREAST786p.E791delc.2362_2364delGAAIn_Frame_Del221.79HCC1954N000N
HSP90B1TDEEETAKEBREAST786p.E791delc.2362_2364delGAAIn_Frame_Del221.79HS739TN000N
HSP90B1TDEEETAKEBREAST786p.E791delc.2362_2364delGAAIn_Frame_Del221.79JIMT1N000N
HSP90B1VGTDEEETABREAST784p.E791delc.2362_2364delGAAIn_Frame_Del221.79BT20N100N
HSP90B1VGTDEEETABREAST784p.E791delc.2362_2364delGAAIn_Frame_Del221.79CAL120N100N
HSP90B1VGTDEEETABREAST784p.E791delc.2362_2364delGAAIn_Frame_Del221.79CAMA1N100N
HSP90B1VGTDEEETABREAST784p.E791delc.2362_2364delGAAIn_Frame_Del221.79HCC1143N100N
HSP90B1VGTDEEETABREAST784p.E791delc.2362_2364delGAAIn_Frame_Del221.79HCC1954N100N
HSP90B1VGTDEEETABREAST784p.E791delc.2362_2364delGAAIn_Frame_Del221.79HS739TN100N
HSP90B1VGTDEEETABREAST784p.E791delc.2362_2364delGAAIn_Frame_Del221.79JIMT1N100N
HSP90B1ATLRSGYLSBREAST721p.L729Sc.2186T>CMissense_Mutation10.11UACC812N000N
HSP90B1DKIYFIAGSBREAST536p.M541Ic.1623G>AMissense_Mutation10.11BT474N200N
HSP90B1EKQDKIYFIBREAST533p.M541Ic.1623G>AMissense_Mutation10.11BT474N400N
HSP90B1FIAGSSRKEBREAST540p.M541Ic.1623G>AMissense_Mutation10.11BT474N100N
HSP90B1GYLSPDTKABREAST726p.L729Sc.2186T>CMissense_Mutation10.11UACC812N300N
HSP90B1IAGSSRKEABREAST541p.M541Ic.1623G>AMissense_Mutation10.11BT474N400N
HSP90B1IYFIAGSSRBREAST538p.M541Ic.1623G>AMissense_Mutation10.11BT474N303N
HSP90B1KIYFIAGSSBREAST537p.M541Ic.1623G>AMissense_Mutation10.11BT474N000N
HSP90B1KQDKIYFIABREAST534p.M541Ic.1623G>AMissense_Mutation10.11BT474N600N
HSP90B1LRSGYLSPDBREAST723p.L729Sc.2186T>CMissense_Mutation10.11UACC812N100N
HSP90B1LSPDTKAYGBREAST728p.L729Sc.2186T>CMissense_Mutation10.11UACC812N007N
HSP90B1QDKIYFIAGBREAST535p.M541Ic.1623G>AMissense_Mutation10.11BT474N000N
HSP90B1RSGYLSPDTBREAST724p.L729Sc.2186T>CMissense_Mutation10.11UACC812N100N
HSP90B1SGYLSPDTKBREAST725p.L729Sc.2186T>CMissense_Mutation10.11UACC812N100N
HSP90B1SPDTKAYGDBREAST729p.L729Sc.2186T>CMissense_Mutation10.11UACC812N000N
HSP90B1TLRSGYLSPBREAST722p.L729Sc.2186T>CMissense_Mutation10.11UACC812N000N
HSP90B1YFIAGSSRKBREAST539p.M541Ic.1623G>AMissense_Mutation10.11BT474N3012N
HSP90B1YLSPDTKAYBREAST727p.L729Sc.2186T>CMissense_Mutation10.11UACC812N700N
KITDDDTLVRCPBREAST129p.N130Dc.388A>GMissense_Mutation10.22AU565N000N
KITDDDTLVRCPBREAST129p.N130Dc.388A>GMissense_Mutation10.22SKBR3N000N
KITDDTLVRCPLBREAST130p.N130Dc.388A>GMissense_Mutation10.22AU565N700N
KITDDTLVRCPLBREAST130p.N130Dc.388A>GMissense_Mutation10.22SKBR3N700N
KITEDDDTLVRCBREAST128p.N130Dc.388A>GMissense_Mutation10.22AU565N100N
KITEDDDTLVRCBREAST128p.N130Dc.388A>GMissense_Mutation10.22SKBR3N100N
KITGKEDDDTLVBREAST126p.N130Dc.388A>GMissense_Mutation10.22AU565N100N
KITGKEDDDTLVBREAST126p.N130Dc.388A>GMissense_Mutation10.22SKBR3N100N
KITKEDDDTLVRBREAST127p.N130Dc.388A>GMissense_Mutation10.22AU565N200N
KITKEDDDTLVRBREAST127p.N130Dc.388A>GMissense_Mutation10.22SKBR3N200N
KITLYGKEDDDTBREAST124p.N130Dc.388A>GMissense_Mutation10.22AU565N100N
KITLYGKEDDDTBREAST124p.N130Dc.388A>GMissense_Mutation10.22SKBR3N100N
KITRSLYGKEDDBREAST122p.N130Dc.388A>GMissense_Mutation10.22AU565N100N
KITRSLYGKEDDBREAST122p.N130Dc.388A>GMissense_Mutation10.22SKBR3N100N
KITSLYGKEDDDBREAST123p.N130Dc.388A>GMissense_Mutation10.22AU565N100N
KITSLYGKEDDDBREAST123p.N130Dc.388A>GMissense_Mutation10.22SKBR3N100N
KITYGKEDDDTLBREAST125p.N130Dc.388A>GMissense_Mutation10.22AU565N1000N
KITYGKEDDDTLBREAST125p.N130Dc.388A>GMissense_Mutation10.22SKBR3N1000N
MAP3K1AAAPAGLRWBREAST156p.R162fsc.485_485delGFrame_Shift_Del30.11MDAMB415Y3120N
MAP3K1AAPAGLRWRBREAST157p.R162fsc.485_485delGFrame_Shift_Del40.11MDAMB415N300N
MAP3K1AGLRWRIKKBREAST160p.R162fsc.485_485delGFrame_Shift_Del50.11MDAMB415Y0110N
MAP3K1APAGLRWRIBREAST158p.R162fsc.485_485delGFrame_Shift_Del50.11MDAMB415Y13140N
MAP3K1CTRWMIVQRBREAST173p.R162fsc.485_485delGFrame_Shift_Del60.11MDAMB415Y5100N
MAP3K1GCTRWMIVQBREAST172p.R162fsc.485_485delGFrame_Shift_Del60.11MDAMB415N000N
MAP3K1GLRWRIKKLBREAST161p.R162fsc.485_485delGFrame_Shift_Del50.11MDAMB415Y11120N
MAP3K1IKKLSKGCTBREAST166p.R162fsc.485_485delGFrame_Shift_Del50.11MDAMB415N101N
MAP3K1KGCTRWMIVBREAST171p.R162fsc.485_485delGFrame_Shift_Del60.11MDAMB415N700N
MAP3K1KKLSKGCTRBREAST167p.R162fsc.485_485delGFrame_Shift_Del50.11MDAMB415N100Y
MAP3K1KLSKGCTRWBREAST168p.R162fsc.485_485delGFrame_Shift_Del50.11MDAMB415Y5110N
MAP3K1LRWRIKKLSBREAST162p.R162fsc.485_485delGFrame_Shift_Del50.11MDAMB415N2030N
MAP3K1LSKGCTRWMBREAST169p.R162fsc.485_485delGFrame_Shift_Del60.11MDAMB415N301N
MAP3K1PAAAPAGLRBREAST155p.R162fsc.485_485delGFrame_Shift_Del20.11MDAMB415N000N
MAP3K1PAGLRWRIKBREAST159p.R162fsc.485_485delGFrame_Shift_Del50.11MDAMB415N000N
MAP3K1RIKKLSKGCBREAST165p.R162fsc.485_485delGFrame_Shift_Del50.11MDAMB415N100N
MAP3K1RWMIVQRNEBREAST175p.R162fsc.485_485delGFrame_Shift_Del60.11MDAMB415N000N
MAP3K1RWRIKKLSKBREAST163p.R162fsc.485_485delGFrame_Shift_Del50.11MDAMB415N100N
MAP3K1SKGCTRWMIBREAST170p.R162fsc.485_485delGFrame_Shift_Del60.11MDAMB415Y2130N
MAP3K1SPAAAPAGLBREAST154p.R162fsc.485_485delGFrame_Shift_Del10.11MDAMB415N1500N
MAP3K1TRWMIVQRNBREAST174p.R162fsc.485_485delGFrame_Shift_Del60.11MDAMB415N200N
MAP3K1WRIKKLSKGBREAST164p.R162fsc.485_485delGFrame_Shift_Del50.11MDAMB415N3024N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44BT20N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44BT474N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44BT483N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44CAL148N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44CAL51N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44CAL851N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44CAMA1N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44EFM192AN000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44EFM19N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44EVSATN000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HCC1395N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HCC1419N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HCC1428N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HCC1500N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HCC1569N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HCC1599N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HCC1806N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HCC202N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HCC2157N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HCC38N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HCC70N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HMC18N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HS281TN000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HS343TN000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HS578TN000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HS742TN000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44JIMT1N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KPL1N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44MCF7N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44MDAMB134VIN000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44MDAMB361N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44MDAMB415N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44MDAMB436N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44MDAMB453N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44MDAMB468N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44T47DN000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44UACC812N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44UACC893N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44ZR751N000N
MAP3K1STTTTTTTEBREAST941p.T949delc.2822_2824delCAAIn_Frame_Del176.44ZR7530N000N
MAP3K1AEAIQLVVEBREAST866p.G872Vc.2615G>TMissense_Mutation10.11CAMA1N200N
MAP3K1AIQLVVEDTBREAST868p.G872Vc.2615G>TMissense_Mutation10.11CAMA1N000N
MAP3K1EAIQLVVEDBREAST867p.G872Vc.2615G>TMissense_Mutation10.11CAMA1N000N
MAP3K1EIAEAIQLVBREAST864p.G872Vc.2615G>TMissense_Mutation10.11CAMA1Y4110N
MAP3K1IAEAIQLVVBREAST865p.G872Vc.2615G>TMissense_Mutation10.11CAMA1N800N
MAP3K1IQLVVEDTLBREAST869p.G872Vc.2615G>TMissense_Mutation10.11CAMA1N1900N
MAP3K1LVVEDTLDGBREAST871p.G872Vc.2615G>TMissense_Mutation10.11CAMA1N0029N
MAP3K1QLVVEDTLDBREAST870p.G872Vc.2615G>TMissense_Mutation10.11CAMA1N000N
MAP3K1VVEDTLDGQBREAST872p.G872Vc.2615G>TMissense_Mutation10.11CAMA1N106N
MAP3K4ALVTNDRPVBREAST560p.K563Tc.1688A>CMissense_Mutation10.11MDAMB436Y5100N
MAP3K4ARIALVTNDBREAST557p.K563Tc.1688A>CMissense_Mutation10.11MDAMB436N100N
MAP3K4IALVTNDRPBREAST559p.K563Tc.1688A>CMissense_Mutation10.11MDAMB436N000N
MAP3K4LVTNDRPVEBREAST561p.K563Tc.1688A>CMissense_Mutation10.11MDAMB436N008N
MAP3K4QRARIALVTBREAST555p.K563Tc.1688A>CMissense_Mutation10.11MDAMB436N200N
MAP3K4RARIALVTNBREAST556p.K563Tc.1688A>CMissense_Mutation10.11MDAMB436N200N
MAP3K4RIALVTNDRBREAST558p.K563Tc.1688A>CMissense_Mutation10.11MDAMB436Y690N
MAP3K4TNDRPVEFSBREAST563p.K563Tc.1688A>CMissense_Mutation10.11MDAMB436N000N
MAP3K4VTNDRPVEFBREAST562p.K563Tc.1688A>CMissense_Mutation10.11MDAMB436Y6117N
METETHNPTVKHBREAST1190p.D1198Hc.3592G>CMissense_Mutation10.11HCC202N000N
METHLIGFGLQVBREAST1198p.D1198Hc.3592G>CMissense_Mutation10.11HCC202N700N
METHNPTVKHLIBREAST1192p.D1198Hc.3592G>CMissense_Mutation10.11HCC202N500N
METKHLIGFGLQBREAST1197p.D1198Hc.3592G>CMissense_Mutation10.11HCC202N000N
METNPTVKHLIGBREAST1193p.D1198Hc.3592G>CMissense_Mutation10.11HCC202N000N
METPTVKHLIGFBREAST1194p.D1198Hc.3592G>CMissense_Mutation10.11HCC202N100N
METTHNPTVKHLBREAST1191p.D1198Hc.3592G>CMissense_Mutation10.11HCC202Y4110N
METTVKHLIGFGBREAST1195p.D1198Hc.3592G>CMissense_Mutation10.11HCC202N000N
METVKHLIGFGLBREAST1196p.D1198Hc.3592G>CMissense_Mutation10.11HCC202N808N
MLH1ASYSHGKLKBREAST128p.D132Hc.394G>CMissense_Mutation10.11HCC1428N100N
MLH1AYRASYSHGBREAST125p.D132Hc.394G>CMissense_Mutation10.11HCC1428Y090N
MLH1CAYRASYSHBREAST124p.D132Hc.394G>CMissense_Mutation10.11HCC1428N000N
MLH1FGVLRLSGPBREAST571p.E578Gc.1733A>GMissense_Mutation10.11BT20N200N
MLH1GPAPLFDLABREAST578p.E578Gc.1733A>GMissense_Mutation10.11BT20N1000N
MLH1GVLRLSGPABREAST572p.E578Gc.1733A>GMissense_Mutation10.11BT20N200N
MLH1HGKLKAPPKBREAST132p.D132Hc.394G>CMissense_Mutation10.11HCC1428N100N
MLH1LRLSGPAPLBREAST574p.E578Gc.1733A>GMissense_Mutation10.11BT20N9031N
MLH1LSGPAPLFDBREAST576p.E578Gc.1733A>GMissense_Mutation10.11BT20N000N
MLH1NFGVLRLSGBREAST570p.E578Gc.1733A>GMissense_Mutation10.11BT20N000Y
MLH1RASYSHGKLBREAST127p.D132Hc.394G>CMissense_Mutation10.11HCC1428N1100N
MLH1RLSGPAPLFBREAST575p.E578Gc.1733A>GMissense_Mutation10.11BT20N1000N
MLH1SGPAPLFDLBREAST577p.E578Gc.1733A>GMissense_Mutation10.11BT20Y1290N
MLH1SHGKLKAPPBREAST131p.D132Hc.394G>CMissense_Mutation10.11HCC1428N000N
MLH1SYSHGKLKABREAST129p.D132Hc.394G>CMissense_Mutation10.11HCC1428N200N
MLH1VLRLSGPAPBREAST573p.E578Gc.1733A>GMissense_Mutation10.11BT20N002N
MLH1YRASYSHGKBREAST126p.D132Hc.394G>CMissense_Mutation10.11HCC1428N4011N
MLH1YSHGKLKAPBREAST130p.D132Hc.394G>CMissense_Mutation10.11HCC1428N100N
MLL3AGWQYPECKBREAST381p.C385Yc.1154G>AMissense_Mutation10.11MDAMB453N100N
MLL3AKTKEIKLEBREAST3713p.E3716Kc.11146G>AMissense_Mutation10.11MDAMB415N000N
MLL3CDFMLPLGPBREAST3460p.Q3464Lc.10391A>TMissense_Mutation10.11HCC1500N000N
MLL3CDKPTDHEPBREAST496p.L504Pc.1511T>CMissense_Mutation10.11HCC1569N000N
MLL3DFMLPLGPLBREAST3461p.Q3464Lc.10391A>TMissense_Mutation10.11HCC1500N700N
MLL3DHEPDTQLKBREAST501p.L504Pc.1511T>CMissense_Mutation10.11HCC1569N100N
MLL3DKPTDHEPDBREAST497p.L504Pc.1511T>CMissense_Mutation10.11HCC1569N000N
MLL3DLPCDFMLPBREAST3457p.Q3464Lc.10391A>TMissense_Mutation10.11HCC1500N000N
MLL3EGPENQMVFBREAST549p.D553Nc.1657G>AMissense_Mutation10.11DU4475N800N
MLL3EMEVEGPENBREAST545p.D553Nc.1657G>AMissense_Mutation10.11DU4475N100N
MLL3ENQMVFSEQBREAST552p.D553Nc.1657G>AMissense_Mutation10.11DU4475N000N
MLL3EPDTQLKEEBREAST503p.L504Pc.1511T>CMissense_Mutation10.11HCC1569N000N
MLL3ETPAKTKEIBREAST3710p.E3716Kc.11146G>AMissense_Mutation10.11MDAMB415N500Y
MLL3EVEGPENQMBREAST547p.D553Nc.1657G>AMissense_Mutation10.11DU4475N300N
MLL3FMLPLGPLQBREAST3462p.Q3464Lc.10391A>TMissense_Mutation10.11HCC1500N300N
MLL3GINEQELSYBREAST4510p.H4512Nc.13534C>AMissense_Mutation10.11EVSATN500N
MLL3GPENQMVFSBREAST550p.D553Nc.1657G>AMissense_Mutation10.11DU4475N100N
MLL3GWQYPECKVBREAST382p.C385Yc.1154G>AMissense_Mutation10.11MDAMB453N100N
MLL3HEPDTQLKEBREAST502p.L504Pc.1511T>CMissense_Mutation10.11HCC1569N000N
MLL3HKPKGINEQBREAST4506p.H4512Nc.13534C>AMissense_Mutation10.11EVSATN000N
MLL3INEQELSYFBREAST4511p.H4512Nc.13534C>AMissense_Mutation10.11EVSATN600N
MLL3KEIKLEKAEBREAST3716p.E3716Kc.11146G>AMissense_Mutation10.11MDAMB415N200N
MLL3KGINEQELSBREAST4509p.H4512Nc.13534C>AMissense_Mutation10.11EVSATN100Y
MLL3KPKGINEQEBREAST4507p.H4512Nc.13534C>AMissense_Mutation10.11EVSATN100N
MLL3KPTDHEPDTBREAST498p.L504Pc.1511T>CMissense_Mutation10.11HCC1569N500N
MLL3KRAGWQYPEBREAST379p.C385Yc.1154G>AMissense_Mutation10.11MDAMB453N200N
MLL3KTKEIKLEKBREAST3714p.E3716Kc.11146G>AMissense_Mutation10.11MDAMB415N700N
MLL3LKRAGWQYPBREAST378p.C385Yc.1154G>AMissense_Mutation10.11MDAMB453N000N
MLL3LPCDFMLPLBREAST3458p.Q3464Lc.10391A>TMissense_Mutation10.11HCC1500N2100N
MLL3LPLGPLQQSBREAST3464p.Q3464Lc.10391A>TMissense_Mutation10.11HCC1500N500Y
MLL3METPAKTKEBREAST3709p.E3716Kc.11146G>AMissense_Mutation10.11MDAMB415N100Y
MLL3MEVEGPENQBREAST546p.D553Nc.1657G>AMissense_Mutation10.11DU4475N102N
MLL3MHKPKGINEBREAST4505p.H4512Nc.13534C>AMissense_Mutation10.11EVSATN000N
MLL3MLPLGPLQQBREAST3463p.Q3464Lc.10391A>TMissense_Mutation10.11HCC1500N0036N
MLL3NEQELSYFABREAST4512p.H4512Nc.13534C>AMissense_Mutation10.11EVSATN600N
MLL3NQMVFSEQABREAST553p.D553Nc.1657G>AMissense_Mutation10.11DU4475N400N
MLL3PAKTKEIKLBREAST3712p.E3716Kc.11146G>AMissense_Mutation10.11MDAMB415N100N
MLL3PCDFMLPLGBREAST3459p.Q3464Lc.10391A>TMissense_Mutation10.11HCC1500N000N
MLL3PDTQLKEEYBREAST504p.L504Pc.1511T>CMissense_Mutation10.11HCC1569N100N
MLL3PENQMVFSEBREAST551p.D553Nc.1657G>AMissense_Mutation10.11DU4475N000N
MLL3PKGINEQELBREAST4508p.H4512Nc.13534C>AMissense_Mutation10.11EVSATN300N
MLL3PLKRAGWQYBREAST377p.C385Yc.1154G>AMissense_Mutation10.11MDAMB453N200N
MLL3PMHKPKGINBREAST4504p.H4512Nc.13534C>AMissense_Mutation10.11EVSATN000N
MLL3PTDHEPDTQBREAST499p.L504Pc.1511T>CMissense_Mutation10.11HCC1569N000N
MLL3QYPECKVCQBREAST384p.C385Yc.1154G>AMissense_Mutation10.11MDAMB453N000N
MLL3RAGWQYPECBREAST380p.C385Yc.1154G>AMissense_Mutation10.11MDAMB453N300N
MLL3SDLPCDFMLBREAST3456p.Q3464Lc.10391A>TMissense_Mutation10.11HCC1500N700N
MLL3SMETPAKTKBREAST3708p.E3716Kc.11146G>AMissense_Mutation10.11MDAMB415N400N
MLL3TDHEPDTQLBREAST500p.L504Pc.1511T>CMissense_Mutation10.11HCC1569N300N
MLL3TKEIKLEKABREAST3715p.E3716Kc.11146G>AMissense_Mutation10.11MDAMB415N100N
MLL3TPAKTKEIKBREAST3711p.E3716Kc.11146G>AMissense_Mutation10.11MDAMB415N200N
MLL3VEGPENQMVBREAST548p.D553Nc.1657G>AMissense_Mutation10.11DU4475N700N
MLL3WQYPECKVCBREAST383p.C385Yc.1154G>AMissense_Mutation10.11MDAMB453N700N
MLL3YPECKVCQNBREAST385p.C385Yc.1154G>AMissense_Mutation10.11MDAMB453N500N
MLL3EDPYGSVSQBREAST2054p.Q2054Ec.6160C>GMissense_Mutation10.22AU565N000N
MLL3EDPYGSVSQBREAST2054p.Q2054Ec.6160C>GMissense_Mutation10.22SKBR3N000N
MLL3MQPPPSSEDBREAST2047p.Q2054Ec.6160C>GMissense_Mutation10.22AU565N001N
MLL3MQPPPSSEDBREAST2047p.Q2054Ec.6160C>GMissense_Mutation10.22SKBR3N001N
MLL3PMQPPPSSEBREAST2046p.Q2054Ec.6160C>GMissense_Mutation10.22AU565N000N
MLL3PMQPPPSSEBREAST2046p.Q2054Ec.6160C>GMissense_Mutation10.22SKBR3N000N
MLL3PPPSSEDPYBREAST2049p.Q2054Ec.6160C>GMissense_Mutation