Cancertope

In silico Platform for designing genome-based
Personalized immunotherapy or Vaccine against Cancer

Browse Results ...


The result page of search shows exclusive peptide/epitopes generated due to mutation [Neoepitope], the tissue of origin [Tissue], position of peptide in protein [Position], number of mismatches counted by aligning mutated and normal protein sequence [Num Mismatch, percentage of cell lines with this peptide over total number of cell lines [Promiscuity %]. The immune information include CTL epitopes (Yes/No), MHC I binders, MHC II binders (both given as number of alleles) and B cell epitopes (Yes/No). For more information, please click HERE


<
Result Reset Search:
ProteinNeoepitopesTissuePositionProt MutationcDNA MutationMutation TypeNum MismatchPromiscuity (%)Cell LineCTLMHC INHLApredMHC IIBcell
AKAP12ALNSQEEEVAUTONOMIC_GANGLIA93p.E101delc.295_297delGAAIn_Frame_Del10.33IMR32Y3120N
AKAP12LNSQEEEVIAUTONOMIC_GANGLIA94p.E101delc.295_297delGAAIn_Frame_Del20.33IMR32N400N
AKAP12NSQEEEVIVAUTONOMIC_GANGLIA95p.E101delc.295_297delGAAIn_Frame_Del30.33IMR32N400N
AKAP12QEEEVIVTEAUTONOMIC_GANGLIA97p.E101delc.295_297delGAAIn_Frame_Del10.33IMR32N000N
AKAP12SQEEEVIVTAUTONOMIC_GANGLIA96p.E101delc.295_297delGAAIn_Frame_Del20.33IMR32N400N
AKAP12AIEEDLEPEAUTONOMIC_GANGLIA1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CHP212N000N
AKAP12AIEEDLEPEAUTONOMIC_GANGLIA1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86IMR32N000N
AKAP12AIEEDLEPEAUTONOMIC_GANGLIA1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KELLYN000N
AKAP12AIEEDLEPEAUTONOMIC_GANGLIA1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KPNRTBM1N000N
AKAP12AIEEDLEPEAUTONOMIC_GANGLIA1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KPNSI9SN000N
AKAP12AIEEDLEPEAUTONOMIC_GANGLIA1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KPNYNN000N
AKAP12AIEEDLEPEAUTONOMIC_GANGLIA1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MHHNB11N000N
AKAP12AIEEDLEPEAUTONOMIC_GANGLIA1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NB1N000N
AKAP12AIEEDLEPEAUTONOMIC_GANGLIA1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NH6N000N
AKAP12AIEEDLEPEAUTONOMIC_GANGLIA1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SHSY5YN000N
AKAP12AIEEDLEPEAUTONOMIC_GANGLIA1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SIMAN000N
AKAP12AIEEDLEPEAUTONOMIC_GANGLIA1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKNASN000N
AKAP12AIEEDLEPEAUTONOMIC_GANGLIA1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKNDZN000N
AKAP12AIEEDLEPEAUTONOMIC_GANGLIA1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKNFIN000N
AKAP12AIEEDLEPEAUTONOMIC_GANGLIA1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKNSHN000N
AKAP12EEDLEPENGAUTONOMIC_GANGLIA1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CHP212N000N
AKAP12EEDLEPENGAUTONOMIC_GANGLIA1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86IMR32N000N
AKAP12EEDLEPENGAUTONOMIC_GANGLIA1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KELLYN000N
AKAP12EEDLEPENGAUTONOMIC_GANGLIA1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KPNRTBM1N000N
AKAP12EEDLEPENGAUTONOMIC_GANGLIA1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KPNSI9SN000N
AKAP12EEDLEPENGAUTONOMIC_GANGLIA1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KPNYNN000N
AKAP12EEDLEPENGAUTONOMIC_GANGLIA1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MHHNB11N000N
AKAP12EEDLEPENGAUTONOMIC_GANGLIA1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NB1N000N
AKAP12EEDLEPENGAUTONOMIC_GANGLIA1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NH6N000N
AKAP12EEDLEPENGAUTONOMIC_GANGLIA1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SHSY5YN000N
AKAP12EEDLEPENGAUTONOMIC_GANGLIA1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SIMAN000N
AKAP12EEDLEPENGAUTONOMIC_GANGLIA1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKNASN000N
AKAP12EEDLEPENGAUTONOMIC_GANGLIA1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKNDZN000N
AKAP12EEDLEPENGAUTONOMIC_GANGLIA1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKNFIN000N
AKAP12EEDLEPENGAUTONOMIC_GANGLIA1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKNSHN000N
AKAP12IEEDLEPENAUTONOMIC_GANGLIA1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CHP212N200N
AKAP12IEEDLEPENAUTONOMIC_GANGLIA1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86IMR32N200N
AKAP12IEEDLEPENAUTONOMIC_GANGLIA1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KELLYN200N
AKAP12IEEDLEPENAUTONOMIC_GANGLIA1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KPNRTBM1N200N
AKAP12IEEDLEPENAUTONOMIC_GANGLIA1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KPNSI9SN200N
AKAP12IEEDLEPENAUTONOMIC_GANGLIA1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KPNYNN200N
AKAP12IEEDLEPENAUTONOMIC_GANGLIA1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MHHNB11N200N
AKAP12IEEDLEPENAUTONOMIC_GANGLIA1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NB1N200N
AKAP12IEEDLEPENAUTONOMIC_GANGLIA1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NH6N200N
AKAP12IEEDLEPENAUTONOMIC_GANGLIA1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SHSY5YN200N
AKAP12IEEDLEPENAUTONOMIC_GANGLIA1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SIMAN200N
AKAP12IEEDLEPENAUTONOMIC_GANGLIA1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKNASN200N
AKAP12IEEDLEPENAUTONOMIC_GANGLIA1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKNDZN200N
AKAP12IEEDLEPENAUTONOMIC_GANGLIA1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKNFIN200N
AKAP12IEEDLEPENAUTONOMIC_GANGLIA1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKNSHN200N
AKAP12KVSVAIEEDAUTONOMIC_GANGLIA1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CHP212N000N
AKAP12KVSVAIEEDAUTONOMIC_GANGLIA1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86IMR32N000N
AKAP12KVSVAIEEDAUTONOMIC_GANGLIA1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KELLYN000N
AKAP12KVSVAIEEDAUTONOMIC_GANGLIA1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KPNRTBM1N000N
AKAP12KVSVAIEEDAUTONOMIC_GANGLIA1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KPNSI9SN000N
AKAP12KVSVAIEEDAUTONOMIC_GANGLIA1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KPNYNN000N
AKAP12KVSVAIEEDAUTONOMIC_GANGLIA1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MHHNB11N000N
AKAP12KVSVAIEEDAUTONOMIC_GANGLIA1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NB1N000N
AKAP12KVSVAIEEDAUTONOMIC_GANGLIA1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86NH6N000N
AKAP12KVSVAIEEDAUTONOMIC_GANGLIA1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SHSY5YN000N
AKAP12KVSVAIEEDAUTONOMIC_GANGLIA1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SIMAN000N
AKAP12KVSVAIEEDAUTONOMIC_GANGLIA1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKNASN000N
AKAP12KVSVAIEEDAUTONOMIC_GANGLIA1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKNDZN000N
AKAP12KVSVAIEEDAUTONOMIC_GANGLIA1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKNFIN000N
AKAP12KVSVAIEEDAUTONOMIC_GANGLIA1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKNSHN000N
AKAP12SVAIEEDLEAUTONOMIC_GANGLIA1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CHP212N000N
AKAP12SVAIEEDLEAUTONOMIC_GANGLIA1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86IMR32N000N
AKAP12SVAIEEDLEAUTONOMIC_GANGLIA1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KELLYN000N
AKAP12SVAIEEDLEAUTONOMIC_GANGLIA1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KPNRTBM1N000N
AKAP12SVAIEEDLEAUTONOMIC_GANGLIA1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KPNSI9SN000N
AKAP12SVAIEEDLEAUTONOMIC_GANGLIA1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KPNYNN000N
AKAP12SVAIEEDLEAUTONOMIC_GANGLIA1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MHHNB11N000N
AKAP12SVAIEEDLEAUTONOMIC_GANGLIA1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NB1N000N
AKAP12SVAIEEDLEAUTONOMIC_GANGLIA1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NH6N000N
AKAP12SVAIEEDLEAUTONOMIC_GANGLIA1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SHSY5YN000N
AKAP12SVAIEEDLEAUTONOMIC_GANGLIA1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SIMAN000N
AKAP12SVAIEEDLEAUTONOMIC_GANGLIA1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKNASN000N
AKAP12SVAIEEDLEAUTONOMIC_GANGLIA1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKNDZN000N
AKAP12SVAIEEDLEAUTONOMIC_GANGLIA1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKNFIN000N
AKAP12SVAIEEDLEAUTONOMIC_GANGLIA1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKNSHN000N
AKAP12VAIEEDLEPAUTONOMIC_GANGLIA1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CHP212N000N
AKAP12VAIEEDLEPAUTONOMIC_GANGLIA1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86IMR32N000N
AKAP12VAIEEDLEPAUTONOMIC_GANGLIA1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KELLYN000N
AKAP12VAIEEDLEPAUTONOMIC_GANGLIA1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KPNRTBM1N000N
AKAP12VAIEEDLEPAUTONOMIC_GANGLIA1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KPNSI9SN000N
AKAP12VAIEEDLEPAUTONOMIC_GANGLIA1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KPNYNN000N
AKAP12VAIEEDLEPAUTONOMIC_GANGLIA1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MHHNB11N000N
AKAP12VAIEEDLEPAUTONOMIC_GANGLIA1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NB1N000N
AKAP12VAIEEDLEPAUTONOMIC_GANGLIA1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86NH6N000N
AKAP12VAIEEDLEPAUTONOMIC_GANGLIA1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SHSY5YN000N
AKAP12VAIEEDLEPAUTONOMIC_GANGLIA1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SIMAN000N
AKAP12VAIEEDLEPAUTONOMIC_GANGLIA1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKNASN000N
AKAP12VAIEEDLEPAUTONOMIC_GANGLIA1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKNDZN000N
AKAP12VAIEEDLEPAUTONOMIC_GANGLIA1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKNFIN000N
AKAP12VAIEEDLEPAUTONOMIC_GANGLIA1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKNSHN000N
AKAP12VKVSVAIEEAUTONOMIC_GANGLIA1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CHP212N002N
AKAP12VKVSVAIEEAUTONOMIC_GANGLIA1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86IMR32N002N
AKAP12VKVSVAIEEAUTONOMIC_GANGLIA1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KELLYN002N
AKAP12VKVSVAIEEAUTONOMIC_GANGLIA1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KPNRTBM1N002N
AKAP12VKVSVAIEEAUTONOMIC_GANGLIA1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KPNSI9SN002N
AKAP12VKVSVAIEEAUTONOMIC_GANGLIA1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KPNYNN002N
AKAP12VKVSVAIEEAUTONOMIC_GANGLIA1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MHHNB11N002N
AKAP12VKVSVAIEEAUTONOMIC_GANGLIA1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NB1N002N
AKAP12VKVSVAIEEAUTONOMIC_GANGLIA1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86NH6N002N
AKAP12VKVSVAIEEAUTONOMIC_GANGLIA1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SHSY5YN002N
AKAP12VKVSVAIEEAUTONOMIC_GANGLIA1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SIMAN002N
AKAP12VKVSVAIEEAUTONOMIC_GANGLIA1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKNASN002N
AKAP12VKVSVAIEEAUTONOMIC_GANGLIA1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKNDZN002N
AKAP12VKVSVAIEEAUTONOMIC_GANGLIA1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKNFIN002N
AKAP12VKVSVAIEEAUTONOMIC_GANGLIA1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKNSHN002N
AKAP12VSVAIEEDLAUTONOMIC_GANGLIA1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CHP212N1500Y
AKAP12VSVAIEEDLAUTONOMIC_GANGLIA1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86IMR32N1500Y
AKAP12VSVAIEEDLAUTONOMIC_GANGLIA1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KELLYN1500Y
AKAP12VSVAIEEDLAUTONOMIC_GANGLIA1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KPNRTBM1N1500Y
AKAP12VSVAIEEDLAUTONOMIC_GANGLIA1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KPNSI9SN1500Y
AKAP12VSVAIEEDLAUTONOMIC_GANGLIA1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KPNYNN1500Y
AKAP12VSVAIEEDLAUTONOMIC_GANGLIA1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MHHNB11N1500Y
AKAP12VSVAIEEDLAUTONOMIC_GANGLIA1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NB1N1500Y
AKAP12VSVAIEEDLAUTONOMIC_GANGLIA1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86NH6N1500Y
AKAP12VSVAIEEDLAUTONOMIC_GANGLIA1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SHSY5YN1500Y
AKAP12VSVAIEEDLAUTONOMIC_GANGLIA1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SIMAN1500Y
AKAP12VSVAIEEDLAUTONOMIC_GANGLIA1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKNASN1500Y
AKAP12VSVAIEEDLAUTONOMIC_GANGLIA1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKNDZN1500Y
AKAP12VSVAIEEDLAUTONOMIC_GANGLIA1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKNFIN1500Y
AKAP12VSVAIEEDLAUTONOMIC_GANGLIA1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKNSHN1500Y
AKAP9DLEKTKQLEAUTONOMIC_GANGLIA1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CHP212N000N
AKAP9DLEKTKQLEAUTONOMIC_GANGLIA1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KELLYN000N
AKAP9DLEKTKQLEAUTONOMIC_GANGLIA1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SHSY5YN000N
AKAP9DLEKTKQLEAUTONOMIC_GANGLIA1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKNSHN000N
AKAP9EKTKQLEEQAUTONOMIC_GANGLIA1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CHP212N000N
AKAP9EKTKQLEEQAUTONOMIC_GANGLIA1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KELLYN000N
AKAP9EKTKQLEEQAUTONOMIC_GANGLIA1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SHSY5YN000N
AKAP9EKTKQLEEQAUTONOMIC_GANGLIA1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKNSHN000N
AKAP9KQLEEQVQEAUTONOMIC_GANGLIA1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CHP212N000N
AKAP9KQLEEQVQEAUTONOMIC_GANGLIA1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KELLYN000N
AKAP9KQLEEQVQEAUTONOMIC_GANGLIA1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SHSY5YN000N
AKAP9KQLEEQVQEAUTONOMIC_GANGLIA1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKNSHN000N
AKAP9KTKQLEEQVAUTONOMIC_GANGLIA1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27CHP212N200N
AKAP9KTKQLEEQVAUTONOMIC_GANGLIA1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27KELLYN200N
AKAP9KTKQLEEQVAUTONOMIC_GANGLIA1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SHSY5YN200N
AKAP9KTKQLEEQVAUTONOMIC_GANGLIA1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SKNSHN200N
AKAP9LEKTKQLEEAUTONOMIC_GANGLIA1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CHP212N000N
AKAP9LEKTKQLEEAUTONOMIC_GANGLIA1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KELLYN000N
AKAP9LEKTKQLEEAUTONOMIC_GANGLIA1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SHSY5YN000N
AKAP9LEKTKQLEEAUTONOMIC_GANGLIA1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKNSHN000N
AKAP9LQDLEKTKQAUTONOMIC_GANGLIA1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27CHP212N000N
AKAP9LQDLEKTKQAUTONOMIC_GANGLIA1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KELLYN000N
AKAP9LQDLEKTKQAUTONOMIC_GANGLIA1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SHSY5YN000N
AKAP9LQDLEKTKQAUTONOMIC_GANGLIA1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SKNSHN000N
AKAP9QDLEKTKQLAUTONOMIC_GANGLIA1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CHP212N900N
AKAP9QDLEKTKQLAUTONOMIC_GANGLIA1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KELLYN900N
AKAP9QDLEKTKQLAUTONOMIC_GANGLIA1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SHSY5YN900N
AKAP9QDLEKTKQLAUTONOMIC_GANGLIA1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKNSHN900N
AKAP9QLEEQVQELAUTONOMIC_GANGLIA1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27CHP212N1200N
AKAP9QLEEQVQELAUTONOMIC_GANGLIA1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KELLYN1200N
AKAP9QLEEQVQELAUTONOMIC_GANGLIA1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SHSY5YN1200N
AKAP9QLEEQVQELAUTONOMIC_GANGLIA1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SKNSHN1200N
AKAP9TKQLEEQVQAUTONOMIC_GANGLIA1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CHP212N000N
AKAP9TKQLEEQVQAUTONOMIC_GANGLIA1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KELLYN000N
AKAP9TKQLEEQVQAUTONOMIC_GANGLIA1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SHSY5YN000N
AKAP9TKQLEEQVQAUTONOMIC_GANGLIA1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKNSHN000N
AKAP9ELENQVVEMAUTONOMIC_GANGLIA2610p.S2613Nc.7838G>AMissense_Mutation10.11SIMAN100N
AKAP9ENQVVEMHTAUTONOMIC_GANGLIA2612p.S2613Nc.7838G>AMissense_Mutation10.11SIMAN000Y
AKAP9ISELENQVVAUTONOMIC_GANGLIA2608p.S2613Nc.7838G>AMissense_Mutation10.11SIMAN400N
AKAP9LENQVVEMHAUTONOMIC_GANGLIA2611p.S2613Nc.7838G>AMissense_Mutation10.11SIMAN106Y
AKAP9LRISELENQAUTONOMIC_GANGLIA2606p.S2613Nc.7838G>AMissense_Mutation10.11SIMAN1023N
AKAP9NQVVEMHTSAUTONOMIC_GANGLIA2613p.S2613Nc.7838G>AMissense_Mutation10.11SIMAN000Y
AKAP9RISELENQVAUTONOMIC_GANGLIA2607p.S2613Nc.7838G>AMissense_Mutation10.11SIMAN300N
AKAP9SELENQVVEAUTONOMIC_GANGLIA2609p.S2613Nc.7838G>AMissense_Mutation10.11SIMAN100N
AKAP9TLRISELENAUTONOMIC_GANGLIA2605p.S2613Nc.7838G>AMissense_Mutation10.11SIMAN000N
ALKALIISKLNHAUTONOMIC_GANGLIA1168p.F1174Lc.3522C>AMissense_Mutation10.22KELLYN100N
ALKALIISKLNHAUTONOMIC_GANGLIA1168p.F1174Lc.3522C>AMissense_Mutation10.22KPNRTBM1N100N
ALKEALIISKLNAUTONOMIC_GANGLIA1167p.F1174Lc.3522C>AMissense_Mutation10.22KELLYN300N
ALKEALIISKLNAUTONOMIC_GANGLIA1167p.F1174Lc.3522C>AMissense_Mutation10.22KPNRTBM1N300N
ALKIISKLNHQNAUTONOMIC_GANGLIA1170p.F1174Lc.3522C>AMissense_Mutation10.22KELLYN002N
ALKIISKLNHQNAUTONOMIC_GANGLIA1170p.F1174Lc.3522C>AMissense_Mutation10.22KPNRTBM1N002N
ALKISKLNHQNIAUTONOMIC_GANGLIA1171p.F1174Lc.3522C>AMissense_Mutation10.22KELLYY8120N
ALKISKLNHQNIAUTONOMIC_GANGLIA1171p.F1174Lc.3522C>AMissense_Mutation10.22KPNRTBM1Y8120N
ALKKLNHQNIVRAUTONOMIC_GANGLIA1173p.F1174Lc.3522C>AMissense_Mutation10.22KELLYY790N
ALKKLNHQNIVRAUTONOMIC_GANGLIA1173p.F1174Lc.3522C>AMissense_Mutation10.22KPNRTBM1Y790N
ALKLIISKLNHQAUTONOMIC_GANGLIA1169p.F1174Lc.3522C>AMissense_Mutation10.22KELLYN0019N
ALKLIISKLNHQAUTONOMIC_GANGLIA1169p.F1174Lc.3522C>AMissense_Mutation10.22KPNRTBM1N0019N
ALKLNHQNIVRCAUTONOMIC_GANGLIA1174p.F1174Lc.3522C>AMissense_Mutation10.22KELLYN103N
ALKLNHQNIVRCAUTONOMIC_GANGLIA1174p.F1174Lc.3522C>AMissense_Mutation10.22KPNRTBM1N103N
ALKMEALIISKLAUTONOMIC_GANGLIA1166p.F1174Lc.3522C>AMissense_Mutation10.22KELLYY1190N
ALKMEALIISKLAUTONOMIC_GANGLIA1166p.F1174Lc.3522C>AMissense_Mutation10.22KPNRTBM1Y1190N
ALKSKLNHQNIVAUTONOMIC_GANGLIA1172p.F1174Lc.3522C>AMissense_Mutation10.22KELLYN300N
ALKSKLNHQNIVAUTONOMIC_GANGLIA1172p.F1174Lc.3522C>AMissense_Mutation10.22KPNRTBM1N300N
ALPK2AFKKFLTCPAUTONOMIC_GANGLIA1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27IMR32N000N
ALPK2AFKKFLTCPAUTONOMIC_GANGLIA1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27SIMAN000N
ALPK2DHTAFKKFLAUTONOMIC_GANGLIA1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27IMR32N600N
ALPK2DHTAFKKFLAUTONOMIC_GANGLIA1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27SIMAN600N
ALPK2HTAFKKFLTAUTONOMIC_GANGLIA1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27IMR32N100N
ALPK2HTAFKKFLTAUTONOMIC_GANGLIA1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27SIMAN100N
ALPK2KMDHTAFKKAUTONOMIC_GANGLIA1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27IMR32N600N
ALPK2KMDHTAFKKAUTONOMIC_GANGLIA1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27SIMAN600N
ALPK2LKMDHTAFKAUTONOMIC_GANGLIA1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27IMR32N1017N
ALPK2LKMDHTAFKAUTONOMIC_GANGLIA1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27SIMAN1017N
ALPK2MDHTAFKKFAUTONOMIC_GANGLIA1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27IMR32N600N
ALPK2MDHTAFKKFAUTONOMIC_GANGLIA1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27SIMAN600N
ALPK2TAFKKFLTCAUTONOMIC_GANGLIA1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27IMR32N600N
ALPK2TAFKKFLTCAUTONOMIC_GANGLIA1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27SIMAN600N
ALPK2ATRETVTIAAUTONOMIC_GANGLIA1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74CHP212Y1140N
ALPK2ATRETVTIAAUTONOMIC_GANGLIA1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74KELLYY1140N
ALPK2ATRETVTIAAUTONOMIC_GANGLIA1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74KPNSI9SY1140N
ALPK2ATRETVTIAAUTONOMIC_GANGLIA1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SKNASY1140N
ALPK2ATRETVTIAAUTONOMIC_GANGLIA1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SKNDZY1140N
ALPK2CFQATRETVAUTONOMIC_GANGLIA998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74CHP212Y2110N
ALPK2CFQATRETVAUTONOMIC_GANGLIA998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KELLYY2110N
ALPK2CFQATRETVAUTONOMIC_GANGLIA998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KPNSI9SY2110N
ALPK2CFQATRETVAUTONOMIC_GANGLIA998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SKNASY2110N
ALPK2CFQATRETVAUTONOMIC_GANGLIA998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SKNDZY2110N
ALPK2ETVTIATEVAUTONOMIC_GANGLIA1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74CHP212N400N
ALPK2ETVTIATEVAUTONOMIC_GANGLIA1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KELLYN400N
ALPK2ETVTIATEVAUTONOMIC_GANGLIA1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74KPNSI9SN400N
ALPK2ETVTIATEVAUTONOMIC_GANGLIA1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SKNASN400N
ALPK2ETVTIATEVAUTONOMIC_GANGLIA1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SKNDZN400N
ALPK2FQATRETVTAUTONOMIC_GANGLIA999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74CHP212N600N
ALPK2FQATRETVTAUTONOMIC_GANGLIA999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KELLYN600N
ALPK2FQATRETVTAUTONOMIC_GANGLIA999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KPNSI9SN600N
ALPK2FQATRETVTAUTONOMIC_GANGLIA999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SKNASN600N
ALPK2FQATRETVTAUTONOMIC_GANGLIA999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SKNDZN600N
ALPK2QATRETVTIAUTONOMIC_GANGLIA1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74CHP212N600N
ALPK2QATRETVTIAUTONOMIC_GANGLIA1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KELLYN600N
ALPK2QATRETVTIAUTONOMIC_GANGLIA1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KPNSI9SN600N
ALPK2QATRETVTIAUTONOMIC_GANGLIA1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SKNASN600N
ALPK2QATRETVTIAUTONOMIC_GANGLIA1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SKNDZN600N
ALPK2RETVTIATEAUTONOMIC_GANGLIA1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74CHP212N100N
ALPK2RETVTIATEAUTONOMIC_GANGLIA1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KELLYN100N
ALPK2RETVTIATEAUTONOMIC_GANGLIA1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74KPNSI9SN100N
ALPK2RETVTIATEAUTONOMIC_GANGLIA1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SKNASN100N
ALPK2RETVTIATEAUTONOMIC_GANGLIA1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SKNDZN100N
ALPK2TRETVTIATAUTONOMIC_GANGLIA1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74CHP212N200N
ALPK2TRETVTIATAUTONOMIC_GANGLIA1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KELLYN200N
ALPK2TRETVTIATAUTONOMIC_GANGLIA1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74KPNSI9SN200N
ALPK2TRETVTIATAUTONOMIC_GANGLIA1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SKNASN200N
ALPK2TRETVTIATAUTONOMIC_GANGLIA1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SKNDZN200N
ATMAKGRDDLRQAUTONOMIC_GANGLIA2716p.V2716Ac.8147T>CMissense_Mutation10.11IMR32N000N
ATMDGKERRQLAAUTONOMIC_GANGLIA2708p.V2716Ac.8147T>CMissense_Mutation10.11IMR32N500N
ATMERRQLAKGRAUTONOMIC_GANGLIA2711p.V2716Ac.8147T>CMissense_Mutation10.11IMR32N200N
ATMGKERRQLAKAUTONOMIC_GANGLIA2709p.V2716Ac.8147T>CMissense_Mutation10.11IMR32N100N
ATMKERRQLAKGAUTONOMIC_GANGLIA2710p.V2716Ac.8147T>CMissense_Mutation10.11IMR32N000N
ATMLAKGRDDLRAUTONOMIC_GANGLIA2715p.V2716Ac.8147T>CMissense_Mutation10.11IMR32N400N
ATMQLAKGRDDLAUTONOMIC_GANGLIA2714p.V2716Ac.8147T>CMissense_Mutation10.11IMR32N1100N
ATMRQLAKGRDDAUTONOMIC_GANGLIA2713p.V2716Ac.8147T>CMissense_Mutation10.11IMR32N000N
ATMRRQLAKGRDAUTONOMIC_GANGLIA2712p.V2716Ac.8147T>CMissense_Mutation10.11IMR32N200N
CHD1DQRSYGSRSAUTONOMIC_GANGLIA1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86KELLYN100N
CHD1DQRSYGSRSAUTONOMIC_GANGLIA1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SHSY5YN100N
CHD1DQRSYGSRSAUTONOMIC_GANGLIA1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SIMAN100N
CHD1DQRSYGSRSAUTONOMIC_GANGLIA1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SKNASN100N
CHD1DQRSYGSRSAUTONOMIC_GANGLIA1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SKNSHN100N
CHD1LDQRSYGSRAUTONOMIC_GANGLIA1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86KELLYN000N
CHD1LDQRSYGSRAUTONOMIC_GANGLIA1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SHSY5YN000N
CHD1LDQRSYGSRAUTONOMIC_GANGLIA1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SIMAN000N
CHD1LDQRSYGSRAUTONOMIC_GANGLIA1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SKNASN000N
CHD1LDQRSYGSRAUTONOMIC_GANGLIA1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SKNSHN000N
CHD1PLDQRSYGSAUTONOMIC_GANGLIA1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86KELLYN000N
CHD1PLDQRSYGSAUTONOMIC_GANGLIA1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SHSY5YN000N
CHD1PLDQRSYGSAUTONOMIC_GANGLIA1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SIMAN000N
CHD1PLDQRSYGSAUTONOMIC_GANGLIA1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SKNASN000N
CHD1PLDQRSYGSAUTONOMIC_GANGLIA1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SKNSHN000N
CHD1QRSYGSRSPAUTONOMIC_GANGLIA1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86KELLYN000N
CHD1QRSYGSRSPAUTONOMIC_GANGLIA1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SHSY5YN000N
CHD1QRSYGSRSPAUTONOMIC_GANGLIA1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SIMAN000N
CHD1QRSYGSRSPAUTONOMIC_GANGLIA1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SKNASN000N
CHD1QRSYGSRSPAUTONOMIC_GANGLIA1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SKNSHN000N
CHD1RSPLDQRSYAUTONOMIC_GANGLIA1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86KELLYN600N
CHD1RSPLDQRSYAUTONOMIC_GANGLIA1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SHSY5YN600N
CHD1RSPLDQRSYAUTONOMIC_GANGLIA1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SIMAN600N
CHD1RSPLDQRSYAUTONOMIC_GANGLIA1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SKNASN600N
CHD1RSPLDQRSYAUTONOMIC_GANGLIA1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SKNSHN600N
CHD1RSYGSRSPFAUTONOMIC_GANGLIA1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86KELLYN900N
CHD1RSYGSRSPFAUTONOMIC_GANGLIA1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SHSY5YN900N
CHD1RSYGSRSPFAUTONOMIC_GANGLIA1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SIMAN900N
CHD1RSYGSRSPFAUTONOMIC_GANGLIA1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SKNASN900N
CHD1RSYGSRSPFAUTONOMIC_GANGLIA1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SKNSHN900N
CHD1SPLDQRSYGAUTONOMIC_GANGLIA1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86KELLYN000N
CHD1SPLDQRSYGAUTONOMIC_GANGLIA1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SHSY5YN000N
CHD1SPLDQRSYGAUTONOMIC_GANGLIA1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SIMAN000N
CHD1SPLDQRSYGAUTONOMIC_GANGLIA1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SKNASN000N
CHD1SPLDQRSYGAUTONOMIC_GANGLIA1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SKNSHN000N
CHD1SYGSRSPFEAUTONOMIC_GANGLIA1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86KELLYN000N
CHD1SYGSRSPFEAUTONOMIC_GANGLIA1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SHSY5YN000N
CHD1SYGSRSPFEAUTONOMIC_GANGLIA1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SIMAN000N
CHD1SYGSRSPFEAUTONOMIC_GANGLIA1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SKNASN000N
CHD1SYGSRSPFEAUTONOMIC_GANGLIA1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SKNSHN000N
CHD1DLEERKQYTAUTONOMIC_GANGLIA1231p.P1232Lc.3695C>TMissense_Mutation10.11NH6N100N
CHD1ETLKQQNVNAUTONOMIC_GANGLIA336p.R344Nc.1031_1032GA>ACMissense_Mutation10.11KPNSI9SN000N
CHD1HKSIPSDLEAUTONOMIC_GANGLIA1225p.P1232Lc.3695C>TMissense_Mutation10.11NH6N000N
CHD1IPSDLEERKAUTONOMIC_GANGLIA1228p.P1232Lc.3695C>TMissense_Mutation10.11NH6N200N
CHD1KQQNVNGMKAUTONOMIC_GANGLIA339p.R344Nc.1031_1032GA>ACMissense_Mutation10.11KPNSI9SN500N
CHD1KSIPSDLEEAUTONOMIC_GANGLIA1226p.P1232Lc.3695C>TMissense_Mutation10.11NH6N100N
CHD1LEERKQYTIAUTONOMIC_GANGLIA1232p.P1232Lc.3695C>TMissense_Mutation10.11NH6N900N
CHD1LHKSIPSDLAUTONOMIC_GANGLIA1224p.P1232Lc.3695C>TMissense_Mutation10.11NH6N602N
CHD1LKQQNVNGMAUTONOMIC_GANGLIA338p.R344Nc.1031_1032GA>ACMissense_Mutation10.11KPNSI9SN6025N
CHD1NGMKKLDNYAUTONOMIC_GANGLIA344p.R344Nc.1031_1032GA>ACMissense_Mutation10.11KPNSI9SN400N
CHD1NVNGMKKLDAUTONOMIC_GANGLIA342p.R344Nc.1031_1032GA>ACMissense_Mutation10.11KPNSI9SN000N
CHD1PSDLEERKQAUTONOMIC_GANGLIA1229p.P1232Lc.3695C>TMissense_Mutation10.11NH6N000N
CHD1QNVNGMKKLAUTONOMIC_GANGLIA341p.R344Nc.1031_1032GA>ACMissense_Mutation10.11KPNSI9SN1000N
CHD1QQNVNGMKKAUTONOMIC_GANGLIA340p.R344Nc.1031_1032GA>ACMissense_Mutation10.11KPNSI9SY4170N
CHD1SDLEERKQYAUTONOMIC_GANGLIA1230p.P1232Lc.3695C>TMissense_Mutation10.11NH6N200N
CHD1SIPSDLEERAUTONOMIC_GANGLIA1227p.P1232Lc.3695C>TMissense_Mutation10.11NH6N500N
CHD1TLKQQNVNGAUTONOMIC_GANGLIA337p.R344Nc.1031_1032GA>ACMissense_Mutation10.11KPNSI9SN000N
CHD1VNGMKKLDNAUTONOMIC_GANGLIA343p.R344Nc.1031_1032GA>ACMissense_Mutation10.11KPNSI9SN0020N
CREB3L2FTHITSDSFAUTONOMIC_GANGLIA95p.T100delc.299_301delCCAIn_Frame_Del444.47CHP212N801N
CREB3L2FTHITSDSFAUTONOMIC_GANGLIA95p.T100delc.299_301delCCAIn_Frame_Del444.47IMR32N801N
CREB3L2FTHITSDSFAUTONOMIC_GANGLIA95p.T100delc.299_301delCCAIn_Frame_Del444.47KPNSI9SN801N
CREB3L2FTHITSDSFAUTONOMIC_GANGLIA95p.T100delc.299_301delCCAIn_Frame_Del444.47MHHNB11N801N
CREB3L2FTHITSDSFAUTONOMIC_GANGLIA95p.T100delc.299_301delCCAIn_Frame_Del444.47NH6N801N
CREB3L2FTHITSDSFAUTONOMIC_GANGLIA95p.T100delc.299_301delCCAIn_Frame_Del444.47SIMAN801N
CREB3L2FTHITSDSFAUTONOMIC_GANGLIA95p.T100delc.299_301delCCAIn_Frame_Del444.47SKNASN801N
CREB3L2HITSDSFNDAUTONOMIC_GANGLIA97p.T100delc.299_301delCCAIn_Frame_Del244.47CHP212N000N
CREB3L2HITSDSFNDAUTONOMIC_GANGLIA97p.T100delc.299_301delCCAIn_Frame_Del244.47IMR32N000N
CREB3L2HITSDSFNDAUTONOMIC_GANGLIA97p.T100delc.299_301delCCAIn_Frame_Del244.47KPNSI9SN000N
CREB3L2HITSDSFNDAUTONOMIC_GANGLIA97p.T100delc.299_301delCCAIn_Frame_Del244.47MHHNB11N000N
CREB3L2HITSDSFNDAUTONOMIC_GANGLIA97p.T100delc.299_301delCCAIn_Frame_Del244.47NH6N000N
CREB3L2HITSDSFNDAUTONOMIC_GANGLIA97p.T100delc.299_301delCCAIn_Frame_Del244.47SIMAN000N
CREB3L2HITSDSFNDAUTONOMIC_GANGLIA97p.T100delc.299_301delCCAIn_Frame_Del244.47SKNASN000N
CREB3L2ITSDSFNDDAUTONOMIC_GANGLIA98p.T100delc.299_301delCCAIn_Frame_Del144.47CHP212N000N
CREB3L2ITSDSFNDDAUTONOMIC_GANGLIA98p.T100delc.299_301delCCAIn_Frame_Del144.47IMR32N000N
CREB3L2ITSDSFNDDAUTONOMIC_GANGLIA98p.T100delc.299_301delCCAIn_Frame_Del144.47KPNSI9SN000N
CREB3L2ITSDSFNDDAUTONOMIC_GANGLIA98p.T100delc.299_301delCCAIn_Frame_Del144.47MHHNB11N000N
CREB3L2ITSDSFNDDAUTONOMIC_GANGLIA98p.T100delc.299_301delCCAIn_Frame_Del144.47NH6N000N
CREB3L2ITSDSFNDDAUTONOMIC_GANGLIA98p.T100delc.299_301delCCAIn_Frame_Del144.47SIMAN000N
CREB3L2ITSDSFNDDAUTONOMIC_GANGLIA98p.T100delc.299_301delCCAIn_Frame_Del144.47SKNASN000N
CREB3L2PFTHITSDSAUTONOMIC_GANGLIA94p.T100delc.299_301delCCAIn_Frame_Del344.47CHP212N000N
CREB3L2PFTHITSDSAUTONOMIC_GANGLIA94p.T100delc.299_301delCCAIn_Frame_Del344.47IMR32N000N
CREB3L2PFTHITSDSAUTONOMIC_GANGLIA94p.T100delc.299_301delCCAIn_Frame_Del344.47KPNSI9SN000N
CREB3L2PFTHITSDSAUTONOMIC_GANGLIA94p.T100delc.299_301delCCAIn_Frame_Del344.47MHHNB11N000N
CREB3L2PFTHITSDSAUTONOMIC_GANGLIA94p.T100delc.299_301delCCAIn_Frame_Del344.47NH6N000N
CREB3L2PFTHITSDSAUTONOMIC_GANGLIA94p.T100delc.299_301delCCAIn_Frame_Del344.47SIMAN000N
CREB3L2PFTHITSDSAUTONOMIC_GANGLIA94p.T100delc.299_301delCCAIn_Frame_Del344.47SKNASN000N
CREB3L2QSPFTHITSAUTONOMIC_GANGLIA92p.T100delc.299_301delCCAIn_Frame_Del144.47CHP212N000N
CREB3L2QSPFTHITSAUTONOMIC_GANGLIA92p.T100delc.299_301delCCAIn_Frame_Del144.47IMR32N000N
CREB3L2QSPFTHITSAUTONOMIC_GANGLIA92p.T100delc.299_301delCCAIn_Frame_Del144.47KPNSI9SN000N
CREB3L2QSPFTHITSAUTONOMIC_GANGLIA92p.T100delc.299_301delCCAIn_Frame_Del144.47MHHNB11N000N
CREB3L2QSPFTHITSAUTONOMIC_GANGLIA92p.T100delc.299_301delCCAIn_Frame_Del144.47NH6N000N
CREB3L2QSPFTHITSAUTONOMIC_GANGLIA92p.T100delc.299_301delCCAIn_Frame_Del144.47SIMAN000N
CREB3L2QSPFTHITSAUTONOMIC_GANGLIA92p.T100delc.299_301delCCAIn_Frame_Del144.47SKNASN000N
CREB3L2SPFTHITSDAUTONOMIC_GANGLIA93p.T100delc.299_301delCCAIn_Frame_Del244.47CHP212N100N
CREB3L2SPFTHITSDAUTONOMIC_GANGLIA93p.T100delc.299_301delCCAIn_Frame_Del244.47IMR32N100N
CREB3L2SPFTHITSDAUTONOMIC_GANGLIA93p.T100delc.299_301delCCAIn_Frame_Del244.47KPNSI9SN100N
CREB3L2SPFTHITSDAUTONOMIC_GANGLIA93p.T100delc.299_301delCCAIn_Frame_Del244.47MHHNB11N100N
CREB3L2SPFTHITSDAUTONOMIC_GANGLIA93p.T100delc.299_301delCCAIn_Frame_Del244.47NH6N100N
CREB3L2SPFTHITSDAUTONOMIC_GANGLIA93p.T100delc.299_301delCCAIn_Frame_Del244.47SIMAN100N
CREB3L2SPFTHITSDAUTONOMIC_GANGLIA93p.T100delc.299_301delCCAIn_Frame_Del244.47SKNASN100N
CREB3L2THITSDSFNAUTONOMIC_GANGLIA96p.T100delc.299_301delCCAIn_Frame_Del344.47CHP212N100N
CREB3L2THITSDSFNAUTONOMIC_GANGLIA96p.T100delc.299_301delCCAIn_Frame_Del344.47IMR32N100N
CREB3L2THITSDSFNAUTONOMIC_GANGLIA96p.T100delc.299_301delCCAIn_Frame_Del344.47KPNSI9SN100N
CREB3L2THITSDSFNAUTONOMIC_GANGLIA96p.T100delc.299_301delCCAIn_Frame_Del344.47MHHNB11N100N
CREB3L2THITSDSFNAUTONOMIC_GANGLIA96p.T100delc.299_301delCCAIn_Frame_Del344.47NH6N100N
CREB3L2THITSDSFNAUTONOMIC_GANGLIA96p.T100delc.299_301delCCAIn_Frame_Del344.47SIMAN100N
CREB3L2THITSDSFNAUTONOMIC_GANGLIA96p.T100delc.299_301delCCAIn_Frame_Del344.47SKNASN100N
CTBP2APSPNQPTNAUTONOMIC_GANGLIA966p.K974fsc.2922_2922delAFrame_Shift_Del124.34KPNRTBM1N300N
CTBP2APSPNQPTNAUTONOMIC_GANGLIA966p.K974fsc.2922_2922delAFrame_Shift_Del124.34NB1N300N
CTBP2APSPNQPTNAUTONOMIC_GANGLIA966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SIMAN300N
CTBP2APSPNQPTNAUTONOMIC_GANGLIA966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SKNSHN300N
CTBP2GTIESTPTSAUTONOMIC_GANGLIA976p.K974fsc.2922_2922delAFrame_Shift_Del524.34KPNRTBM1N100N
CTBP2GTIESTPTSAUTONOMIC_GANGLIA976p.K974fsc.2922_2922delAFrame_Shift_Del524.34NB1N100N
CTBP2GTIESTPTSAUTONOMIC_GANGLIA976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SIMAN100N
CTBP2GTIESTPTSAUTONOMIC_GANGLIA976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SKNSHN100N
CTBP2NQPTNTGTIAUTONOMIC_GANGLIA970p.K974fsc.2922_2922delAFrame_Shift_Del424.34KPNRTBM1N1000N
CTBP2NQPTNTGTIAUTONOMIC_GANGLIA970p.K974fsc.2922_2922delAFrame_Shift_Del424.34NB1N1000N
CTBP2NQPTNTGTIAUTONOMIC_GANGLIA970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SIMAN1000N
CTBP2NQPTNTGTIAUTONOMIC_GANGLIA970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SKNSHN1000N
CTBP2NTGTIESTPAUTONOMIC_GANGLIA974p.K974fsc.2922_2922delAFrame_Shift_Del524.34KPNRTBM1N000N
CTBP2NTGTIESTPAUTONOMIC_GANGLIA974p.K974fsc.2922_2922delAFrame_Shift_Del524.34NB1N000N
CTBP2NTGTIESTPAUTONOMIC_GANGLIA974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SIMAN000N
CTBP2NTGTIESTPAUTONOMIC_GANGLIA974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SKNSHN000N
CTBP2PNQPTNTGTAUTONOMIC_GANGLIA969p.K974fsc.2922_2922delAFrame_Shift_Del324.34KPNRTBM1N000N
CTBP2PNQPTNTGTAUTONOMIC_GANGLIA969p.K974fsc.2922_2922delAFrame_Shift_Del324.34NB1N000N
CTBP2PNQPTNTGTAUTONOMIC_GANGLIA969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SIMAN000N
CTBP2PNQPTNTGTAUTONOMIC_GANGLIA969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SKNSHN000N
CTBP2PSPNQPTNTAUTONOMIC_GANGLIA967p.K974fsc.2922_2922delAFrame_Shift_Del224.34KPNRTBM1N000N
CTBP2PSPNQPTNTAUTONOMIC_GANGLIA967p.K974fsc.2922_2922delAFrame_Shift_Del224.34NB1N000N
CTBP2PSPNQPTNTAUTONOMIC_GANGLIA967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SIMAN000N
CTBP2PSPNQPTNTAUTONOMIC_GANGLIA967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SKNSHN000N
CTBP2PTNTGTIESAUTONOMIC_GANGLIA972p.K974fsc.2922_2922delAFrame_Shift_Del524.34KPNRTBM1N000N
CTBP2PTNTGTIESAUTONOMIC_GANGLIA972p.K974fsc.2922_2922delAFrame_Shift_Del524.34NB1N000N
CTBP2PTNTGTIESAUTONOMIC_GANGLIA972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SIMAN000N
CTBP2PTNTGTIESAUTONOMIC_GANGLIA972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SKNSHN000N
CTBP2QPTNTGTIEAUTONOMIC_GANGLIA971p.K974fsc.2922_2922delAFrame_Shift_Del524.34KPNRTBM1N000N
CTBP2QPTNTGTIEAUTONOMIC_GANGLIA971p.K974fsc.2922_2922delAFrame_Shift_Del524.34NB1N000N
CTBP2QPTNTGTIEAUTONOMIC_GANGLIA971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SIMAN000N
CTBP2QPTNTGTIEAUTONOMIC_GANGLIA971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SKNSHN000N
CTBP2SPNQPTNTGAUTONOMIC_GANGLIA968p.K974fsc.2922_2922delAFrame_Shift_Del224.34KPNRTBM1N000N
CTBP2SPNQPTNTGAUTONOMIC_GANGLIA968p.K974fsc.2922_2922delAFrame_Shift_Del224.34NB1N000N
CTBP2SPNQPTNTGAUTONOMIC_GANGLIA968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SIMAN000N
CTBP2SPNQPTNTGAUTONOMIC_GANGLIA968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SKNSHN000N
CTBP2TGTIESTPTAUTONOMIC_GANGLIA975p.K974fsc.2922_2922delAFrame_Shift_Del524.34KPNRTBM1N000N
CTBP2TGTIESTPTAUTONOMIC_GANGLIA975p.K974fsc.2922_2922delAFrame_Shift_Del524.34NB1N000N
CTBP2TGTIESTPTAUTONOMIC_GANGLIA975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SIMAN000N
CTBP2TGTIESTPTAUTONOMIC_GANGLIA975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SKNSHN000N
CTBP2TIESTPTSNAUTONOMIC_GANGLIA977p.K974fsc.2922_2922delAFrame_Shift_Del524.34KPNRTBM1N100N
CTBP2TIESTPTSNAUTONOMIC_GANGLIA977p.K974fsc.2922_2922delAFrame_Shift_Del524.34NB1N100N
CTBP2TIESTPTSNAUTONOMIC_GANGLIA977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SIMAN100N
CTBP2TIESTPTSNAUTONOMIC_GANGLIA977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SKNSHN100N
CTBP2TNTGTIESTAUTONOMIC_GANGLIA973p.K974fsc.2922_2922delAFrame_Shift_Del524.34KPNRTBM1N000N
CTBP2TNTGTIESTAUTONOMIC_GANGLIA973p.K974fsc.2922_2922delAFrame_Shift_Del524.34NB1N000N
CTBP2TNTGTIESTAUTONOMIC_GANGLIA973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SIMAN000N
CTBP2TNTGTIESTAUTONOMIC_GANGLIA973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SKNSHN000N
CTBP2DNRENPNEQAUTONOMIC_GANGLIA977p.H981Nc.2941C>AMissense_Mutation10.11SKNDZN000N
CTBP2GDNRENPNEAUTONOMIC_GANGLIA976p.H981Nc.2941C>AMissense_Mutation10.11SKNDZN000N
CTBP2HGDNRENPNAUTONOMIC_GANGLIA975p.H981Nc.2941C>AMissense_Mutation10.11SKNDZN100N
CTBP2KHGDNRENPAUTONOMIC_GANGLIA974p.H981Nc.2941C>AMissense_Mutation10.11SKNDZN000N
CTBP2TKHGDNRENAUTONOMIC_GANGLIA973p.H981Nc.2941C>AMissense_Mutation10.11SKNDZN100N
FLT3HPNSSMPRSAUTONOMIC_GANGLIA732p.G739Rc.2215G>CMissense_Mutation10.11SKNASN500N
FLT3MPRSREVQIAUTONOMIC_GANGLIA737p.G739Rc.2215G>CMissense_Mutation10.11SKNASN1300N
FLT3NSSMPRSREAUTONOMIC_GANGLIA734p.G739Rc.2215G>CMissense_Mutation10.11SKNASN000N
FLT3PNSSMPRSRAUTONOMIC_GANGLIA733p.G739Rc.2215G>CMissense_Mutation10.11SKNASN000N
FLT3PRSREVQIHAUTONOMIC_GANGLIA738p.G739Rc.2215G>CMissense_Mutation10.11SKNASN100N
FLT3RSREVQIHPAUTONOMIC_GANGLIA739p.G739Rc.2215G>CMissense_Mutation10.11SKNASN100N
FLT3SHPNSSMPRAUTONOMIC_GANGLIA731p.G739Rc.2215G>CMissense_Mutation10.11SKNASN100N
FLT3SMPRSREVQAUTONOMIC_GANGLIA736p.G739Rc.2215G>CMissense_Mutation10.11SKNASN000N
FLT3SSMPRSREVAUTONOMIC_GANGLIA735p.G739Rc.2215G>CMissense_Mutation10.11SKNASY5110Y
FMN2LPPLPGAAIAUTONOMIC_GANGLIA934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03KPNRTBM1N1401N
FMN2LPPLPGAAIAUTONOMIC_GANGLIA934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03NH6N1401N
FMN2LPPLPGAAIAUTONOMIC_GANGLIA934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03SKNDZN1401N
FMN2PLPPLPGAAAUTONOMIC_GANGLIA933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03KPNRTBM1N000N
FMN2PLPPLPGAAAUTONOMIC_GANGLIA933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03NH6N000N
FMN2PLPPLPGAAAUTONOMIC_GANGLIA933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03SKNDZN000N
GPR112ASISDMFIQAUTONOMIC_GANGLIA2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7CHP212N000N
GPR112ASISDMFIQAUTONOMIC_GANGLIA2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7IMR32N000N
GPR112ASISDMFIQAUTONOMIC_GANGLIA2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KELLYN000N
GPR112ASISDMFIQAUTONOMIC_GANGLIA2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KPNRTBM1N000N
GPR112ASISDMFIQAUTONOMIC_GANGLIA2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KPNSI9SN000N
GPR112ASISDMFIQAUTONOMIC_GANGLIA2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7NB1N000N
GPR112ASISDMFIQAUTONOMIC_GANGLIA2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7NH6N000N
GPR112ASISDMFIQAUTONOMIC_GANGLIA2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SIMAN000N
GPR112ASISDMFIQAUTONOMIC_GANGLIA2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SKNASN000N
GPR112ISDMFIQNLAUTONOMIC_GANGLIA2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7CHP212Y11100N
GPR112ISDMFIQNLAUTONOMIC_GANGLIA2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7IMR32Y11100N
GPR112ISDMFIQNLAUTONOMIC_GANGLIA2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KELLYY11100N
GPR112ISDMFIQNLAUTONOMIC_GANGLIA2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KPNRTBM1Y11100N
GPR112ISDMFIQNLAUTONOMIC_GANGLIA2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KPNSI9SY11100N
GPR112ISDMFIQNLAUTONOMIC_GANGLIA2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7NB1Y11100N
GPR112ISDMFIQNLAUTONOMIC_GANGLIA2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7NH6Y11100N
GPR112ISDMFIQNLAUTONOMIC_GANGLIA2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SIMAY11100N
GPR112ISDMFIQNLAUTONOMIC_GANGLIA2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SKNASY11100N
GPR112SASISDMFIAUTONOMIC_GANGLIA2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7CHP212N700N
GPR112SASISDMFIAUTONOMIC_GANGLIA2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7IMR32N700N
GPR112SASISDMFIAUTONOMIC_GANGLIA2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KELLYN700N
GPR112SASISDMFIAUTONOMIC_GANGLIA2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KPNRTBM1N700N
GPR112SASISDMFIAUTONOMIC_GANGLIA2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KPNSI9SN700N
GPR112SASISDMFIAUTONOMIC_GANGLIA2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7NB1N700N
GPR112SASISDMFIAUTONOMIC_GANGLIA2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7NH6N700N
GPR112SASISDMFIAUTONOMIC_GANGLIA2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SIMAN700N
GPR112SASISDMFIAUTONOMIC_GANGLIA2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SKNASN700N
GPR112SDMFIQNLAAUTONOMIC_GANGLIA2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7CHP212N400N
GPR112SDMFIQNLAAUTONOMIC_GANGLIA2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7IMR32N400N
GPR112SDMFIQNLAAUTONOMIC_GANGLIA2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KELLYN400N
GPR112SDMFIQNLAAUTONOMIC_GANGLIA2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KPNRTBM1N400N
GPR112SDMFIQNLAAUTONOMIC_GANGLIA2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KPNSI9SN400N
GPR112SDMFIQNLAAUTONOMIC_GANGLIA2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7NB1N400N
GPR112SDMFIQNLAAUTONOMIC_GANGLIA2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7NH6N400N
GPR112SDMFIQNLAAUTONOMIC_GANGLIA2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SIMAN400N
GPR112SDMFIQNLAAUTONOMIC_GANGLIA2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SKNASN400N
GPR112SISDMFIQNAUTONOMIC_GANGLIA2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7CHP212N000N
GPR112SISDMFIQNAUTONOMIC_GANGLIA2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7IMR32N000N
GPR112SISDMFIQNAUTONOMIC_GANGLIA2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KELLYN000N
GPR112SISDMFIQNAUTONOMIC_GANGLIA2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KPNRTBM1N000N
GPR112SISDMFIQNAUTONOMIC_GANGLIA2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KPNSI9SN000N
GPR112SISDMFIQNAUTONOMIC_GANGLIA2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7NB1N000N
GPR112SISDMFIQNAUTONOMIC_GANGLIA2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7NH6N000N
GPR112SISDMFIQNAUTONOMIC_GANGLIA2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SIMAN000N
GPR112SISDMFIQNAUTONOMIC_GANGLIA2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SKNASN000N
GPR112VSASISDMFAUTONOMIC_GANGLIA2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7CHP212N900N
GPR112VSASISDMFAUTONOMIC_GANGLIA2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7IMR32N900N
GPR112VSASISDMFAUTONOMIC_GANGLIA2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KELLYN900N
GPR112VSASISDMFAUTONOMIC_GANGLIA2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KPNRTBM1N900N
GPR112VSASISDMFAUTONOMIC_GANGLIA2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KPNSI9SN900N
GPR112VSASISDMFAUTONOMIC_GANGLIA2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7NB1N900N
GPR112VSASISDMFAUTONOMIC_GANGLIA2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7NH6N900N
GPR112VSASISDMFAUTONOMIC_GANGLIA2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SIMAN900N
GPR112VSASISDMFAUTONOMIC_GANGLIA2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SKNASN900N
GPR112VVSASISDMAUTONOMIC_GANGLIA2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7CHP212N5020N
GPR112VVSASISDMAUTONOMIC_GANGLIA2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7IMR32N5020N
GPR112VVSASISDMAUTONOMIC_GANGLIA2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KELLYN5020N
GPR112VVSASISDMAUTONOMIC_GANGLIA2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KPNRTBM1N5020N
GPR112VVSASISDMAUTONOMIC_GANGLIA2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KPNSI9SN5020N
GPR112VVSASISDMAUTONOMIC_GANGLIA2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7NB1N5020N
GPR112VVSASISDMAUTONOMIC_GANGLIA2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7NH6N5020N
GPR112VVSASISDMAUTONOMIC_GANGLIA2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SIMAN5020N
GPR112VVSASISDMAUTONOMIC_GANGLIA2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SKNASN5020N
GPR112ATTQILNATAUTONOMIC_GANGLIA830p.R834Ic.2501G>TMissense_Mutation10.11NB1N100N
GPR112ILNATVTRKAUTONOMIC_GANGLIA834p.R834Ic.2501G>TMissense_Mutation10.11NB1Y5169N
GPR112KSATTQILNAUTONOMIC_GANGLIA828p.R834Ic.2501G>TMissense_Mutation10.11NB1N100N
GPR112PKSATTQILAUTONOMIC_GANGLIA827p.R834Ic.2501G>TMissense_Mutation10.11NB1N300N
GPR112QILNATVTRAUTONOMIC_GANGLIA833p.R834Ic.2501G>TMissense_Mutation10.11NB1N500N
GPR112SATTQILNAAUTONOMIC_GANGLIA829p.R834Ic.2501G>TMissense_Mutation10.11NB1N400N
GPR112TQILNATVTAUTONOMIC_GANGLIA832p.R834Ic.2501G>TMissense_Mutation10.11NB1N500N
GPR112TTQILNATVAUTONOMIC_GANGLIA831p.R834Ic.2501G>TMissense_Mutation10.11NB1N100Y
GPR112VPKSATTQIAUTONOMIC_GANGLIA826p.R834Ic.2501G>TMissense_Mutation10.11NB1N1402N
HSP90B1DEEETAKESAUTONOMIC_GANGLIA787p.E791delc.2362_2364delGAAIn_Frame_Del121.79IMR32N300N
HSP90B1DEEETAKESAUTONOMIC_GANGLIA787p.E791delc.2362_2364delGAAIn_Frame_Del121.79KPNRTBM1N300N
HSP90B1DEEETAKESAUTONOMIC_GANGLIA787p.E791delc.2362_2364delGAAIn_Frame_Del121.79KPNSI9SN300N
HSP90B1DEEETAKESAUTONOMIC_GANGLIA787p.E791delc.2362_2364delGAAIn_Frame_Del121.79SKNASN300N
HSP90B1DEEETAKESAUTONOMIC_GANGLIA787p.E791delc.2362_2364delGAAIn_Frame_Del121.79SKNSHN300N
HSP90B1DVGTDEEETAUTONOMIC_GANGLIA783p.E791delc.2362_2364delGAAIn_Frame_Del121.79IMR32N200N
HSP90B1DVGTDEEETAUTONOMIC_GANGLIA783p.E791delc.2362_2364delGAAIn_Frame_Del121.79KPNRTBM1N200N
HSP90B1DVGTDEEETAUTONOMIC_GANGLIA783p.E791delc.2362_2364delGAAIn_Frame_Del121.79KPNSI9SN200N
HSP90B1DVGTDEEETAUTONOMIC_GANGLIA783p.E791delc.2362_2364delGAAIn_Frame_Del121.79SKNASN200N
HSP90B1DVGTDEEETAUTONOMIC_GANGLIA783p.E791delc.2362_2364delGAAIn_Frame_Del121.79SKNSHN200N
HSP90B1GTDEEETAKAUTONOMIC_GANGLIA785p.E791delc.2362_2364delGAAIn_Frame_Del321.79IMR32N400N
HSP90B1GTDEEETAKAUTONOMIC_GANGLIA785p.E791delc.2362_2364delGAAIn_Frame_Del321.79KPNRTBM1N400N
HSP90B1GTDEEETAKAUTONOMIC_GANGLIA785p.E791delc.2362_2364delGAAIn_Frame_Del321.79KPNSI9SN400N
HSP90B1GTDEEETAKAUTONOMIC_GANGLIA785p.E791delc.2362_2364delGAAIn_Frame_Del321.79SKNASN400N
HSP90B1GTDEEETAKAUTONOMIC_GANGLIA785p.E791delc.2362_2364delGAAIn_Frame_Del321.79SKNSHN400N
HSP90B1TDEEETAKEAUTONOMIC_GANGLIA786p.E791delc.2362_2364delGAAIn_Frame_Del221.79IMR32N000N
HSP90B1TDEEETAKEAUTONOMIC_GANGLIA786p.E791delc.2362_2364delGAAIn_Frame_Del221.79KPNRTBM1N000N
HSP90B1TDEEETAKEAUTONOMIC_GANGLIA786p.E791delc.2362_2364delGAAIn_Frame_Del221.79KPNSI9SN000N
HSP90B1TDEEETAKEAUTONOMIC_GANGLIA786p.E791delc.2362_2364delGAAIn_Frame_Del221.79SKNASN000N
HSP90B1TDEEETAKEAUTONOMIC_GANGLIA786p.E791delc.2362_2364delGAAIn_Frame_Del221.79SKNSHN000N
HSP90B1VGTDEEETAAUTONOMIC_GANGLIA784p.E791delc.2362_2364delGAAIn_Frame_Del221.79IMR32N100N
HSP90B1VGTDEEETAAUTONOMIC_GANGLIA784p.E791delc.2362_2364delGAAIn_Frame_Del221.79KPNRTBM1N100N
HSP90B1VGTDEEETAAUTONOMIC_GANGLIA784p.E791delc.2362_2364delGAAIn_Frame_Del221.79KPNSI9SN100N
HSP90B1VGTDEEETAAUTONOMIC_GANGLIA784p.E791delc.2362_2364delGAAIn_Frame_Del221.79SKNASN100N
HSP90B1VGTDEEETAAUTONOMIC_GANGLIA784p.E791delc.2362_2364delGAAIn_Frame_Del221.79SKNSHN100N
MAP3K1STTTTTTTEAUTONOMIC_GANGLIA941p.T949delc.2822_2824delCAAIn_Frame_Del176.44CHP212N000N
MAP3K1STTTTTTTEAUTONOMIC_GANGLIA941p.T949delc.2822_2824delCAAIn_Frame_Del176.44IMR32N000N
MAP3K1STTTTTTTEAUTONOMIC_GANGLIA941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KELLYN000N
MAP3K1STTTTTTTEAUTONOMIC_GANGLIA941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KPNSI9SN000N
MAP3K1STTTTTTTEAUTONOMIC_GANGLIA941p.T949delc.2822_2824delCAAIn_Frame_Del176.44MHHNB11N000N
MAP3K1STTTTTTTEAUTONOMIC_GANGLIA941p.T949delc.2822_2824delCAAIn_Frame_Del176.44NB1N000N
MAP3K1STTTTTTTEAUTONOMIC_GANGLIA941p.T949delc.2822_2824delCAAIn_Frame_Del176.44NH6N000N
MAP3K1STTTTTTTEAUTONOMIC_GANGLIA941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SIMAN000N
MAP3K1STTTTTTTEAUTONOMIC_GANGLIA941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SKNASN000N
MAP3K1STTTTTTTEAUTONOMIC_GANGLIA941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SKNDZN000N
MAP3K4ENLYGTSPRAUTONOMIC_GANGLIA78p.P86Rc.257C>GMissense_Mutation10.11SIMAN300N
MAP3K4GTSPRSTPRAUTONOMIC_GANGLIA82p.P86Rc.257C>GMissense_Mutation10.11SIMAN600N
MAP3K4LYGTSPRSTAUTONOMIC_GANGLIA80p.P86Rc.257C>GMissense_Mutation10.11SIMAN100N
MAP3K4NLYGTSPRSAUTONOMIC_GANGLIA79p.P86Rc.257C>GMissense_Mutation10.11SIMAN000N
MAP3K4PRSTPRQMKAUTONOMIC_GANGLIA85p.P86Rc.257C>GMissense_Mutation10.11SIMAN100N
MAP3K4RSTPRQMKRAUTONOMIC_GANGLIA86p.P86Rc.257C>GMissense_Mutation10.11SIMAY590N
MAP3K4SPRSTPRQMAUTONOMIC_GANGLIA84p.P86Rc.257C>GMissense_Mutation10.11SIMAY1290N
MAP3K4TSPRSTPRQAUTONOMIC_GANGLIA83p.P86Rc.257C>GMissense_Mutation10.11SIMAN000N
MAP3K4YGTSPRSTPAUTONOMIC_GANGLIA81p.P86Rc.257C>GMissense_Mutation10.11SIMAN200N
MLL3DQRGPYRPDAUTONOMIC_GANGLIA2461p.P2467Rc.7400C>GMissense_Mutation10.22SHSY5YN000Y
MLL3DQRGPYRPDAUTONOMIC_GANGLIA2461p.P2467Rc.7400C>GMissense_Mutation10.22SKNSHN000Y
MLL3GPYRPDVASAUTONOMIC_GANGLIA2464p.P2467Rc.7400C>GMissense_Mutation10.22SHSY5YN600N
MLL3GPYRPDVASAUTONOMIC_GANGLIA2464p.P2467Rc.7400C>GMissense_Mutation10.22SKNSHN600N
MLL3KDQRGPYRPAUTONOMIC_GANGLIA2460p.P2467Rc.7400C>GMissense_Mutation10.22SHSY5YN000Y
MLL3KDQRGPYRPAUTONOMIC_GANGLIA2460p.P2467Rc.7400C>GMissense_Mutation10.22SKNSHN000Y
MLL3PKDQRGPYRAUTONOMIC_GANGLIA2459p.P2467Rc.7400C>GMissense_Mutation10.22SHSY5YN100N
MLL3PKDQRGPYRAUTONOMIC_GANGLIA2459p.P2467Rc.7400C>GMissense_Mutation10.22SKNSHN100N
MLL3PYRPDVASMAUTONOMIC_GANGLIA2465p.P2467Rc.7400C>GMissense_Mutation10.22SHSY5YN100N
MLL3PYRPDVASMAUTONOMIC_GANGLIA2465p.P2467Rc.7400C>GMissense_Mutation10.22SKNSHN100N
MLL3QRGPYRPDVAUTONOMIC_GANGLIA2462p.P2467Rc.7400C>GMissense_Mutation10.22SHSY5YN400Y
MLL3QRGPYRPDVAUTONOMIC_GANGLIA2462p.P2467Rc.7400C>GMissense_Mutation10.22SKNSHN400Y
MLL3RGPYRPDVAAUTONOMIC_GANGLIA2463p.P2467Rc.7400C>GMissense_Mutation10.22SHSY5YN300N
MLL3RGPYRPDVAAUTONOMIC_GANGLIA2463p.P2467Rc.7400C>GMissense_Mutation10.22SKNSHN300N
MLL3RPDVASMGMAUTONOMIC_GANGLIA2467p.P2467Rc.7400C>GMissense_Mutation10.22SHSY5YN1200N
MLL3RPDVASMGMAUTONOMIC_GANGLIA2467p.P2467Rc.7400C>GMissense_Mutation10.22SKNSHN1200N
MLL3YRPDVASMGAUTONOMIC_GANGLIA2466p.P2467Rc.7400C>GMissense_Mutation10.22SHSY5YN3012N
MLL3YRPDVASMGAUTONOMIC_GANGLIA2466p.P2467Rc.7400C>GMissense_Mutation10.22SKNSHN3012N
MSH3GAAAAAAPPAUTONOMIC_GANGLIA50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94KELLYN000N
MSH3GAAAAAAPPAUTONOMIC_GANGLIA50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94MHHNB11N000N
MSH3GAAAAAAPPAUTONOMIC_GANGLIA50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94SIMAN000N
MSH3PGAAAAAAPAUTONOMIC_GANGLIA49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94KELLYN000N
MSH3PGAAAAAAPAUTONOMIC_GANGLIA49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94MHHNB11N000N
MSH3PGAAAAAAPAUTONOMIC_GANGLIA49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94SIMAN000N
MSH3AAAAPPAPAAUTONOMIC_GANGLIA53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23KELLYN200N
MSH3AAAAPPAPAAUTONOMIC_GANGLIA59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23KELLYN200N
MSH3AAAAPPAPAAUTONOMIC_GANGLIA53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23MHHNB11N200N
MSH3AAAAPPAPAAUTONOMIC_GANGLIA59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23MHHNB11N200N
MSH3AAAAPPAPAAUTONOMIC_GANGLIA59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23SHSY5YN200N
MSH3AAAAPPAPAAUTONOMIC_GANGLIA53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23SIMAN200N
MSH3AAAAPPAPAAUTONOMIC_GANGLIA59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23SIMAN200N
MSH3AAAAPPAPAAUTONOMIC_GANGLIA59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23SKNASN200N
MSH3AAAPPAPAFAUTONOMIC_GANGLIA54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23KELLYY8100N
MSH3AAAPPAPAFAUTONOMIC_GANGLIA60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23KELLYY8100N
MSH3AAAPPAPAFAUTONOMIC_GANGLIA54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23MHHNB11Y8100N
MSH3AAAPPAPAFAUTONOMIC_GANGLIA60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23MHHNB11Y8100N
MSH3AAAPPAPAFAUTONOMIC_GANGLIA60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23SHSY5YY8100N
MSH3AAAPPAPAFAUTONOMIC_GANGLIA54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23SIMAY8100N
MSH3AAAPPAPAFAUTONOMIC_GANGLIA60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23SIMAY8100N
MSH3AAAPPAPAFAUTONOMIC_GANGLIA60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23SKNASY8100N
MSH3AAPPAPAFPAUTONOMIC_GANGLIA55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23KELLYN000N
MSH3AAPPAPAFPAUTONOMIC_GANGLIA61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23KELLYN000N
MSH3AAPPAPAFPAUTONOMIC_GANGLIA55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23MHHNB11N000N
MSH3AAPPAPAFPAUTONOMIC_GANGLIA61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23MHHNB11N000N
MSH3AAPPAPAFPAUTONOMIC_GANGLIA61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23SHSY5YN000N
MSH3AAPPAPAFPAUTONOMIC_GANGLIA55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23SIMAN000N
MSH3AAPPAPAFPAUTONOMIC_GANGLIA61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23SIMAN000N
MSH3AAPPAPAFPAUTONOMIC_GANGLIA61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23SKNASN000N
MSH6ASPKSYGFNAUTONOMIC_GANGLIA1293p.C1294Sc.3881G>CMissense_Mutation10.11KPNRTBM1N000N
MSH6FIKGASPKSAUTONOMIC_GANGLIA1289p.C1294Sc.3881G>CMissense_Mutation10.11KPNRTBM1N102N
MSH6GASPKSYGFAUTONOMIC_GANGLIA1292p.C1294Sc.3881G>CMissense_Mutation10.11KPNRTBM1N600N
MSH6IKGASPKSYAUTONOMIC_GANGLIA1290p.C1294Sc.3881G>CMissense_Mutation10.11KPNRTBM1N302N
MSH6KFIKGASPKAUTONOMIC_GANGLIA1288p.C1294Sc.3881G>CMissense_Mutation10.11KPNRTBM1N200N
MSH6KGASPKSYGAUTONOMIC_GANGLIA1291p.C1294Sc.3881G>CMissense_Mutation10.11KPNRTBM1N000N
MSH6LYKFIKGASAUTONOMIC_GANGLIA1286p.C1294Sc.3881G>CMissense_Mutation10.11KPNRTBM1N2017N
MSH6SPKSYGFNAAUTONOMIC_GANGLIA1294p.C1294Sc.3881G>CMissense_Mutation10.11KPNRTBM1Y890N
MSH6YKFIKGASPAUTONOMIC_GANGLIA1287p.C1294Sc.3881G>CMissense_Mutation10.11KPNRTBM1N202N
MYLKASKELKKDVAUTONOMIC_GANGLIA1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KPNRTBM1N400N
MYLKASKELKKDVAUTONOMIC_GANGLIA1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KPNSI9SN400N
MYLKKELKKDVKNAUTONOMIC_GANGLIA1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KPNRTBM1N500N
MYLKKELKKDVKNAUTONOMIC_GANGLIA1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KPNSI9SN500N
MYLKKSASKELKKAUTONOMIC_GANGLIA1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KPNRTBM1N400N
MYLKKSASKELKKAUTONOMIC_GANGLIA1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KPNSI9SN400N
MYLKLKSASKELKAUTONOMIC_GANGLIA1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KPNRTBM1N105N
MYLKLKSASKELKAUTONOMIC_GANGLIA1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KPNSI9SN105N
MYLKNLKSASKELAUTONOMIC_GANGLIA1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KPNRTBM1Y5100N
MYLKNLKSASKELAUTONOMIC_GANGLIA1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KPNSI9SY5100N
MYLKSASKELKKDAUTONOMIC_GANGLIA1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KPNRTBM1N000N
MYLKSASKELKKDAUTONOMIC_GANGLIA1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KPNSI9SN000N
MYLKSKELKKDVKAUTONOMIC_GANGLIA1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KPNRTBM1N200N
MYLKSKELKKDVKAUTONOMIC_GANGLIA1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KPNSI9SN200N
MYLKADVSQAFLEAUTONOMIC_GANGLIA1790p.E1790Ac.5369A>CMissense_Mutation10.11NB1N100Y
MYLKAEKLESEADAUTONOMIC_GANGLIA1783p.E1790Ac.5369A>CMissense_Mutation10.11NB1N000N
MYLKATDKFEGRVAUTONOMIC_GANGLIA48p.A50Dc.149C>AMissense_Mutation10.11NB1Y3130N
MYLKCIKEGATDKAUTONOMIC_GANGLIA43p.A50Dc.149C>AMissense_Mutation10.11NB1N200N
MYLKDKFEGRVRGAUTONOMIC_GANGLIA50p.A50Dc.149C>AMissense_Mutation10.11NB1N000Y
MYLKEADVSQAFLAUTONOMIC_GANGLIA1789p.E1790Ac.5369A>CMissense_Mutation10.11NB1Y990N
MYLKEGATDKFEGAUTONOMIC_GANGLIA46p.A50Dc.149C>AMissense_Mutation10.11NB1N000N
MYLKEKLESEADVAUTONOMIC_GANGLIA1784p.E1790Ac.5369A>CMissense_Mutation10.11NB1N300N
MYLKESEADVSQAAUTONOMIC_GANGLIA1787p.E1790Ac.5369A>CMissense_Mutation10.11NB1N200Y
MYLKGATDKFEGRAUTONOMIC_GANGLIA47p.A50Dc.149C>AMissense_Mutation10.11NB1N400N
MYLKIKEGATDKFAUTONOMIC_GANGLIA44p.A50Dc.149C>AMissense_Mutation10.11NB1N300N
MYLKKEGATDKFEAUTONOMIC_GANGLIA45p.A50Dc.149C>AMissense_Mutation10.11NB1N000N
MYLKKLESEADVSAUTONOMIC_GANGLIA1785p.E1790Ac.5369A>CMissense_Mutation10.11NB1N100N
MYLKLCIKEGATDAUTONOMIC_GANGLIA42p.A50Dc.149C>AMissense_Mutation10.11NB1N004N
MYLKLESEADVSQAUTONOMIC_GANGLIA1786p.E1790Ac.5369A>CMissense_Mutation10.11NB1N000N
MYLKNAEKLESEAAUTONOMIC_GANGLIA1782p.E1790Ac.5369A>CMissense_Mutation10.11NB1N300N
MYLKSEADVSQAFAUTONOMIC_GANGLIA1788p.E1790Ac.5369A>CMissense_Mutation10.11NB1Y890Y
MYLKTDKFEGRVRAUTONOMIC_GANGLIA49p.A50Dc.149C>AMissense_Mutation10.11NB1N000N
MYST4AKPTGRPKNAUTONOMIC_GANGLIA339p.I342Tc.1025T>CMissense_Mutation10.11KPNSI9SN100N
MYST4IKRRYAKPTAUTONOMIC_GANGLIA334p.I342Tc.1025T>CMissense_Mutation10.11KPNSI9SN104N
MYST4KPTGRPKNKAUTONOMIC_GANGLIA340p.I342Tc.1025T>CMissense_Mutation10.11KPNSI9SY3160N
MYST4KRRYAKPTGAUTONOMIC_GANGLIA335p.I342Tc.1025T>CMissense_Mutation10.11KPNSI9SN300N
MYST4PTGRPKNKLAUTONOMIC_GANGLIA341p.I342Tc.1025T>CMissense_Mutation10.11KPNSI9SN000N
MYST4RRYAKPTGRAUTONOMIC_GANGLIA336p.I342Tc.1025T>CMissense_Mutation10.11KPNSI9SN300N
MYST4RYAKPTGRPAUTONOMIC_GANGLIA337p.I342Tc.1025T>CMissense_Mutation10.11KPNSI9SN000N
MYST4TGRPKNKLKAUTONOMIC_GANGLIA342p.I342Tc.1025T>CMissense_Mutation10.11KPNSI9SN000N
MYST4YAKPTGRPKAUTONOMIC_GANGLIA338p.I342Tc.1025T>CMissense_Mutation10.11KPNSI9SY1110N
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.514_515insAACIn_Frame_Ins296.13CHP212N101Y
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.514_515insAACIn_Frame_Ins296.13IMR32N101Y
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13IMR32N101Y
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KELLYN101Y
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13KELLYN101Y
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KPNRTBM1N101Y
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KPNSI9SN101Y
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KPNYNN101Y
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.514_515insAACIn_Frame_Ins296.13MHHNB11N101Y
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.514_515insAACIn_Frame_Ins296.13NB1N101Y
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.514_515insAACIn_Frame_Ins296.13NH6N101Y
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SHSY5YN101Y
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SIMAN101Y
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SKNASN101Y
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SKNDZN101Y
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SKNFIN101Y
NR1H2IRKQQQQQEAUTONOMIC_GANGLIA170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SKNSHN101Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.514_515insAACIn_Frame_Ins196.13CHP212N000Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.514_515insAACIn_Frame_Ins196.13IMR32N000Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13IMR32N000Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KELLYN000Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13KELLYN000Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KPNRTBM1N000Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KPNSI9SN000Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KPNYNN000Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.514_515insAACIn_Frame_Ins196.13MHHNB11N000Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.514_515insAACIn_Frame_Ins196.13NB1N000Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.514_515insAACIn_Frame_Ins196.13NH6N000Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SHSY5YN000Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SIMAN000Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SKNASN000Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SKNDZN000Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SKNFIN000Y
NR1H2KIRKQQQQQAUTONOMIC_GANGLIA169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SKNSHN000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.514_515insAACIn_Frame_Ins296.13CHP212N000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.514_515insAACIn_Frame_Ins296.13IMR32N000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13IMR32N000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KELLYN000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13KELLYN000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KPNRTBM1N000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KPNSI9SN000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KPNYNN000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.514_515insAACIn_Frame_Ins296.13MHHNB11N000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.514_515insAACIn_Frame_Ins296.13NB1N000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.514_515insAACIn_Frame_Ins296.13NH6N000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SHSY5YN000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SIMAN000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SKNASN000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SKNDZN000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SKNFIN000Y
NR1H2KQQQQQESQAUTONOMIC_GANGLIA172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SKNSHN000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.514_515insAACIn_Frame_Ins196.13CHP212N000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.514_515insAACIn_Frame_Ins196.13IMR32N000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13IMR32N000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KELLYN000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13KELLYN000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KPNRTBM1N000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KPNSI9SN000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KPNYNN000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.514_515insAACIn_Frame_Ins196.13MHHNB11N000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.514_515insAACIn_Frame_Ins196.13NB1N000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.514_515insAACIn_Frame_Ins196.13NH6N000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SHSY5YN000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SIMAN000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SKNASN000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SKNDZN000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SKNFIN000Y
NR1H2QQQQQESQSAUTONOMIC_GANGLIA173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SKNSHN000Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.514_515insAACIn_Frame_Ins396.13CHP212N100Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.514_515insAACIn_Frame_Ins396.13IMR32N100Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13IMR32N100Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KELLYN100Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13KELLYN100Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KPNRTBM1N100Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KPNSI9SN100Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KPNYNN100Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.514_515insAACIn_Frame_Ins396.13MHHNB11N100Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.514_515insAACIn_Frame_Ins396.13NB1N100Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.514_515insAACIn_Frame_Ins396.13NH6N100Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13SHSY5YN100Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SIMAN100Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SKNASN100Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13SKNDZN100Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SKNFIN100Y
NR1H2RKQQQQQESAUTONOMIC_GANGLIA171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13SKNSHN100Y
NRASAGKEEYSAMAUTONOMIC_GANGLIA59p.Q61Kc.181C>AMissense_Mutation11.66CHP212Y6100N
NRASAGKEEYSAMAUTONOMIC_GANGLIA59p.Q61Kc.181C>AMissense_Mutation11.66SKNASY6100N
NRASAGKEEYSAMAUTONOMIC_GANGLIA59p.Q61Kc.181C>AMissense_Mutation11.66SKNSHY6100N
NRASDILDTAGKEAUTONOMIC_GANGLIA54p.Q61Kc.181C>AMissense_Mutation11.66CHP212N000N
NRASDILDTAGKEAUTONOMIC_GANGLIA54p.Q61Kc.181C>AMissense_Mutation11.66SKNASN000N
NRASDILDTAGKEAUTONOMIC_GANGLIA54p.Q61Kc.181C>AMissense_Mutation11.66SKNSHN000N
NRASDTAGKEEYSAUTONOMIC_GANGLIA57p.Q61Kc.181C>AMissense_Mutation11.66CHP212N000N
NRASDTAGKEEYSAUTONOMIC_GANGLIA57p.Q61Kc.181C>AMissense_Mutation11.66SKNASN000N
NRASDTAGKEEYSAUTONOMIC_GANGLIA57p.Q61Kc.181C>AMissense_Mutation11.66SKNSHN000N
NRASGKEEYSAMRAUTONOMIC_GANGLIA60p.Q61Kc.181C>AMissense_Mutation11.66CHP212N200N
NRASGKEEYSAMRAUTONOMIC_GANGLIA60p.Q61Kc.181C>AMissense_Mutation11.66SKNASN200N
NRASGKEEYSAMRAUTONOMIC_GANGLIA60p.Q61Kc.181C>AMissense_Mutation11.66SKNSHN200N
NRASILDTAGKEEAUTONOMIC_GANGLIA55p.Q61Kc.181C>AMissense_Mutation11.66CHP212N000N
NRASILDTAGKEEAUTONOMIC_GANGLIA55p.Q61Kc.181C>AMissense_Mutation11.66SKNASN000N
NRASILDTAGKEEAUTONOMIC_GANGLIA55p.Q61Kc.181C>AMissense_Mutation11.66SKNSHN000N
NRASKEEYSAMRDAUTONOMIC_GANGLIA61p.Q61Kc.181C>AMissense_Mutation11.66CHP212N000N
NRASKEEYSAMRDAUTONOMIC_GANGLIA61p.Q61Kc.181C>AMissense_Mutation11.66SKNASN000N
NRASKEEYSAMRDAUTONOMIC_GANGLIA61p.Q61Kc.181C>AMissense_Mutation11.66SKNSHN000N
NRASLDILDTAGKAUTONOMIC_GANGLIA53p.Q61Kc.181C>AMissense_Mutation11.66CHP212N006N
NRASLDILDTAGKAUTONOMIC_GANGLIA53p.Q61Kc.181C>AMissense_Mutation11.66SKNASN006N
NRASLDILDTAGKAUTONOMIC_GANGLIA53p.Q61Kc.181C>AMissense_Mutation11.66SKNSHN006N
NRASLDTAGKEEYAUTONOMIC_GANGLIA56p.Q61Kc.181C>AMissense_Mutation11.66CHP212N500N
NRASLDTAGKEEYAUTONOMIC_GANGLIA56p.Q61Kc.181C>AMissense_Mutation11.66SKNASN500N
NRASLDTAGKEEYAUTONOMIC_GANGLIA56p.Q61Kc.181C>AMissense_Mutation11.66SKNSHN500N
NRASTAGKEEYSAAUTONOMIC_GANGLIA58p.Q61Kc.181C>AMissense_Mutation11.66CHP212N300N
NRASTAGKEEYSAAUTONOMIC_GANGLIA58p.Q61Kc.181C>AMissense_Mutation11.66SKNASN300N
NRASTAGKEEYSAAUTONOMIC_GANGLIA58p.Q61Kc.181C>AMissense_Mutation11.66SKNSHN300N
PDE4DIPADSRKKSSKAUTONOMIC_GANGLIA242p.E243fsc.729_729delAFrame_Shift_Del517.59NB1N000Y
PDE4DIPADSRKKSSKAUTONOMIC_GANGLIA242p.E243fsc.729_729delAFrame_Shift_Del517.59SKNFIN000Y
PDE4DIPDSHLADSRKAUTONOMIC_GANGLIA238p.E243fsc.729_729delAFrame_Shift_Del417.59NB1N200N
PDE4DIPDSHLADSRKAUTONOMIC_GANGLIA238p.E243fsc.729_729delAFrame_Shift_Del417.59SKNFIN200N
PDE4DIPDSRKKSSKQAUTONOMIC_GANGLIA243p.E243fsc.729_729delAFrame_Shift_Del417.59NB1N200Y
PDE4DIPDSRKKSSKQAUTONOMIC_GANGLIA243p.E243fsc.729_729delAFrame_Shift_Del417.59SKNFIN200Y
PDE4DIPHLADSRKKSAUTONOMIC_GANGLIA240p.E243fsc.729_729delAFrame_Shift_Del517.59NB1N000N
PDE4DIPHLADSRKKSAUTONOMIC_GANGLIA240p.E243fsc.729_729delAFrame_Shift_Del517.59SKNFIN000N
PDE4DIPKKSSKQRPPAUTONOMIC_GANGLIA246p.E243fsc.729_729delAFrame_Shift_Del517.59NB1N100Y
PDE4DIPKKSSKQRPPAUTONOMIC_GANGLIA246p.E243fsc.729_729delAFrame_Shift_Del517.59SKNFIN100Y
PDE4DIPKQRPPTRFFAUTONOMIC_GANGLIA250p.E243fsc.729_729delAFrame_Shift_Del617.59NB1Y7100Y
PDE4DIPKQRPPTRFFAUTONOMIC_GANGLIA250p.E243fsc.729_729delAFrame_Shift_Del617.59SKNFIY7100Y
PDE4DIPKSSKQRPPTAUTONOMIC_GANGLIA247p.E243fsc.729_729delAFrame_Shift_Del517.59NB1N200Y
PDE4DIPKSSKQRPPTAUTONOMIC_GANGLIA247p.E243fsc.729_729delAFrame_Shift_Del517.59SKNFIN200Y
PDE4DIPLADSRKKSSAUTONOMIC_GANGLIA241p.E243fsc.729_729delAFrame_Shift_Del517.59NB1N100N
PDE4DIPLADSRKKSSAUTONOMIC_GANGLIA241p.E243fsc.729_729delAFrame_Shift_Del517.59SKNFIN100N
PDE4DIPPPTRFFKRNAUTONOMIC_GANGLIA253p.E243fsc.729_729delAFrame_Shift_Del517.59NB1N000Y
PDE4DIPPPTRFFKRNAUTONOMIC_GANGLIA253p.E243fsc.729_729delAFrame_Shift_Del517.59SKNFIN000Y
PDE4DIPPTRFFKRNLAUTONOMIC_GANGLIA254p.E243fsc.729_729delAFrame_Shift_Del617.59NB1Y2110Y
PDE4DIPPTRFFKRNLAUTONOMIC_GANGLIA254p.E243fsc.729_729delAFrame_Shift_Del617.59SKNFIY2110Y
PDE4DIPQRPPTRFFKAUTONOMIC_GANGLIA251p.E243fsc.729_729delAFrame_Shift_Del617.59NB1Y2100Y
PDE4DIPQRPPTRFFKAUTONOMIC_GANGLIA251p.E243fsc.729_729delAFrame_Shift_Del617.59SKNFIY2100Y
PDE4DIPRFFKRNLMKAUTONOMIC_GANGLIA256p.E243fsc.729_729delAFrame_Shift_Del617.59NB1Y2130N
PDE4DIPRFFKRNLMKAUTONOMIC_GANGLIA256p.E243fsc.729_729delAFrame_Shift_Del617.59SKNFIY2130N
PDE4DIPRKKSSKQRPAUTONOMIC_GANGLIA245p.E243fsc.729_729delAFrame_Shift_Del417.59NB1N100Y
PDE4DIPRKKSSKQRPAUTONOMIC_GANGLIA245p.E243fsc.729_729delAFrame_Shift_Del417.59SKNFIN100Y
PDE4DIPRPPTRFFKRAUTONOMIC_GANGLIA252p.E243fsc.729_729delAFrame_Shift_Del617.59NB1Y590Y
PDE4DIPRPPTRFFKRAUTONOMIC_GANGLIA252p.E243fsc.729_729delAFrame_Shift_Del617.59SKNFIY590Y
PDE4DIPSDSHLADSRAUTONOMIC_GANGLIA237p.E243fsc.729_729delAFrame_Shift_Del317.59NB1N000N
PDE4DIPSDSHLADSRAUTONOMIC_GANGLIA237p.E243fsc.729_729delAFrame_Shift_Del317.59SKNFIN000N
PDE4DIPSHLADSRKKAUTONOMIC_GANGLIA239p.E243fsc.729_729delAFrame_Shift_Del417.59NB1N000N
PDE4DIPSHLADSRKKAUTONOMIC_GANGLIA239p.E243fsc.729_729delAFrame_Shift_Del417.59SKNFIN000N
PDE4DIPSKQRPPTRFAUTONOMIC_GANGLIA249p.E243fsc.729_729delAFrame_Shift_Del517.59NB1N200Y
PDE4DIPSKQRPPTRFAUTONOMIC_GANGLIA249p.E243fsc.729_729delAFrame_Shift_Del517.59SKNFIN200Y
PDE4DIPSRKKSSKQRAUTONOMIC_GANGLIA244p.E243fsc.729_729delAFrame_Shift_Del417.59NB1Y390Y
PDE4DIPSRKKSSKQRAUTONOMIC_GANGLIA244p.E243fsc.729_729delAFrame_Shift_Del417.59SKNFIY390Y
PDE4DIPSSKQRPPTRAUTONOMIC_GANGLIA248p.E243fsc.729_729delAFrame_Shift_Del517.59NB1Y390Y
PDE4DIPSSKQRPPTRAUTONOMIC_GANGLIA248p.E243fsc.729_729delAFrame_Shift_Del517.59SKNFIY390Y
PDE4DIPSVSDSHLADAUTONOMIC_GANGLIA235p.E243fsc.729_729delAFrame_Shift_Del117.59NB1N000N
PDE4DIPSVSDSHLADAUTONOMIC_GANGLIA235p.E243fsc.729_729delAFrame_Shift_Del117.59SKNFIN000N
PDE4DIPTRFFKRNLMAUTONOMIC_GANGLIA255p.E243fsc.729_729delAFrame_Shift_Del617.59NB1Y390Y
PDE4DIPTRFFKRNLMAUTONOMIC_GANGLIA255p.E243fsc.729_729delAFrame_Shift_Del617.59SKNFIY390Y
PDE4DIPVSDSHLADSAUTONOMIC_GANGLIA236p.E243fsc.729_729delAFrame_Shift_Del217.59NB1N100N
PDE4DIPVSDSHLADSAUTONOMIC_GANGLIA236p.E243fsc.729_729delAFrame_Shift_Del217.59SKNFIN100N
PDE4DIPDKAVLWSGLAUTONOMIC_GANGLIA483p.V486fsc.1458_1458delTFrame_Shift_Del518.58KELLYN400N
PDE4DIPDKAVLWSGLAUTONOMIC_GANGLIA483p.V486fsc.1458_1458delTFrame_Shift_Del518.58SIMAN400N
PDE4DIPDKAVLWSGLAUTONOMIC_GANGLIA483p.V486fsc.1458_1458delTFrame_Shift_Del518.58SKNASN400N
PDE4DIPHDKAVLWSGAUTONOMIC_GANGLIA482p.V486fsc.1458_1458delTFrame_Shift_Del418.58KELLYN000N
PDE4DIPHDKAVLWSGAUTONOMIC_GANGLIA482p.V486fsc.1458_1458delTFrame_Shift_Del418.58SIMAN000N
PDE4DIPHDKAVLWSGAUTONOMIC_GANGLIA482p.V486fsc.1458_1458delTFrame_Shift_Del418.58SKNASN000N
PDE4DIPIHDKAVLWSAUTONOMIC_GANGLIA481p.V486fsc.1458_1458delTFrame_Shift_Del318.58KELLYN2020N
PDE4DIPIHDKAVLWSAUTONOMIC_GANGLIA481p.V486fsc.1458_1458delTFrame_Shift_Del318.58SIMAN2020N
PDE4DIPIHDKAVLWSAUTONOMIC_GANGLIA481p.V486fsc.1458_1458delTFrame_Shift_Del318.58SKNASN2020N
PDE4DIPQRIHDKAVLAUTONOMIC_GANGLIA479p.V486fsc.1458_1458delTFrame_Shift_Del118.58KELLYN600N
PDE4DIPQRIHDKAVLAUTONOMIC_GANGLIA479p.V486fsc.1458_1458delTFrame_Shift_Del118.58SIMAN600N
PDE4DIPQRIHDKAVLAUTONOMIC_GANGLIA479p.V486fsc.1458_1458delTFrame_Shift_Del118.58SKNASN600N
PDE4DIPRIHDKAVLWAUTONOMIC_GANGLIA480p.V486fsc.1458_1458delTFrame_Shift_Del218.58KELLYN400N
PDE4DIPRIHDKAVLWAUTONOMIC_GANGLIA480p.V486fsc.1458_1458delTFrame_Shift_Del218.58SIMAN400N
PDE4DIPRIHDKAVLWAUTONOMIC_GANGLIA480p.V486fsc.1458_1458delTFrame_Shift_Del218.58SKNASN400N
PDE4DIPAAVRHQWSPAUTONOMIC_GANGLIA1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYN000N
PDE4DIPAAVRHQWSPAUTONOMIC_GANGLIA1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAN000N
PDE4DIPAAVRHQWSPAUTONOMIC_GANGLIA1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASN000N
PDE4DIPACQLPRIPPAUTONOMIC_GANGLIA1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYN000N
PDE4DIPACQLPRIPPAUTONOMIC_GANGLIA1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAN000N
PDE4DIPACQLPRIPPAUTONOMIC_GANGLIA1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASN000N
PDE4DIPAFIFTPYPSAUTONOMIC_GANGLIA1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPAFIFTPYPSAUTONOMIC_GANGLIA1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPAFIFTPYPSAUTONOMIC_GANGLIA1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPAFLRHHCPQAUTONOMIC_GANGLIA1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPAFLRHHCPQAUTONOMIC_GANGLIA1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPAFLRHHCPQAUTONOMIC_GANGLIA1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPALFLLLPQLAUTONOMIC_GANGLIA1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYY16110N
PDE4DIPALFLLLPQLAUTONOMIC_GANGLIA1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAY16110N
PDE4DIPALFLLLPQLAUTONOMIC_GANGLIA1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASY16110N
PDE4DIPALSSLAAVRAUTONOMIC_GANGLIA1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYY6100N
PDE4DIPALSSLAAVRAUTONOMIC_GANGLIA1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAY6100N
PDE4DIPALSSLAAVRAUTONOMIC_GANGLIA1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASY6100N
PDE4DIPAPLALSSLAAUTONOMIC_GANGLIA1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN1000N
PDE4DIPAPLALSSLAAUTONOMIC_GANGLIA1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN1000N
PDE4DIPAPLALSSLAAUTONOMIC_GANGLIA1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN1000N
PDE4DIPASCLSAPLAAUTONOMIC_GANGLIA1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYN100N
PDE4DIPASCLSAPLAAUTONOMIC_GANGLIA1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAN100N
PDE4DIPASCLSAPLAAUTONOMIC_GANGLIA1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASN100N
PDE4DIPASRGLRPNPAUTONOMIC_GANGLIA1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000Y
PDE4DIPASRGLRPNPAUTONOMIC_GANGLIA1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000Y
PDE4DIPASRGLRPNPAUTONOMIC_GANGLIA1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000Y
PDE4DIPATPSACQLPAUTONOMIC_GANGLIA1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPATPSACQLPAUTONOMIC_GANGLIA1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPATPSACQLPAUTONOMIC_GANGLIA1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPAVRHQWSPWAUTONOMIC_GANGLIA1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYN100N
PDE4DIPAVRHQWSPWAUTONOMIC_GANGLIA1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAN100N
PDE4DIPAVRHQWSPWAUTONOMIC_GANGLIA1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASN100N
PDE4DIPCCRSSWEKVAUTONOMIC_GANGLIA1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN100N
PDE4DIPCCRSSWEKVAUTONOMIC_GANGLIA1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN100N
PDE4DIPCCRSSWEKVAUTONOMIC_GANGLIA1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN100N
PDE4DIPCLSAPLALSAUTONOMIC_GANGLIA1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPCLSAPLALSAUTONOMIC_GANGLIA1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPCLSAPLALSAUTONOMIC_GANGLIA1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPCPQLHPASCAUTONOMIC_GANGLIA1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN400N
PDE4DIPCPQLHPASCAUTONOMIC_GANGLIA1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN400N
PDE4DIPCPQLHPASCAUTONOMIC_GANGLIA1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN400N
PDE4DIPCQLPRIPPRAUTONOMIC_GANGLIA1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN600Y
PDE4DIPCQLPRIPPRAUTONOMIC_GANGLIA1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN600Y
PDE4DIPCQLPRIPPRAUTONOMIC_GANGLIA1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN600Y
PDE4DIPCRSSWEKVPAUTONOMIC_GANGLIA1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPCRSSWEKVPAUTONOMIC_GANGLIA1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPCRSSWEKVPAUTONOMIC_GANGLIA1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPEKVPALFLLAUTONOMIC_GANGLIA1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYN800N
PDE4DIPEKVPALFLLAUTONOMIC_GANGLIA1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAN800N
PDE4DIPEKVPALFLLAUTONOMIC_GANGLIA1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASN800N
PDE4DIPFIFTPYPSWAUTONOMIC_GANGLIA1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYN500N
PDE4DIPFIFTPYPSWAUTONOMIC_GANGLIA1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAN500N
PDE4DIPFIFTPYPSWAUTONOMIC_GANGLIA1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASN500N
PDE4DIPFLLLPQLHCAUTONOMIC_GANGLIA1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN7023N
PDE4DIPFLLLPQLHCAUTONOMIC_GANGLIA1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN7023N
PDE4DIPFLLLPQLHCAUTONOMIC_GANGLIA1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN7023N
PDE4DIPFLRHHCPQLAUTONOMIC_GANGLIA1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYY1399N
PDE4DIPFLRHHCPQLAUTONOMIC_GANGLIA1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAY1399N
PDE4DIPFLRHHCPQLAUTONOMIC_GANGLIA1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASY1399N
PDE4DIPFTPYPSWLAAUTONOMIC_GANGLIA1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYN602N
PDE4DIPFTPYPSWLAAUTONOMIC_GANGLIA1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAN602N
PDE4DIPFTPYPSWLAAUTONOMIC_GANGLIA1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASN602N
PDE4DIPGLRPNPTATAUTONOMIC_GANGLIA1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN200N
PDE4DIPGLRPNPTATAUTONOMIC_GANGLIA1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN200N
PDE4DIPGLRPNPTATAUTONOMIC_GANGLIA1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN200N
PDE4DIPHCPQLHPASAUTONOMIC_GANGLIA1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN100N
PDE4DIPHCPQLHPASAUTONOMIC_GANGLIA1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN100N
PDE4DIPHCPQLHPASAUTONOMIC_GANGLIA1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN100N
PDE4DIPHHCPQLHPAAUTONOMIC_GANGLIA1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYN200N
PDE4DIPHHCPQLHPAAUTONOMIC_GANGLIA1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAN200N
PDE4DIPHHCPQLHPAAUTONOMIC_GANGLIA1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASN200N
PDE4DIPHPASCLSAPAUTONOMIC_GANGLIA1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN100N
PDE4DIPHPASCLSAPAUTONOMIC_GANGLIA1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN100N
PDE4DIPHPASCLSAPAUTONOMIC_GANGLIA1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN100N
PDE4DIPHQWSPWLRLAUTONOMIC_GANGLIA1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYY14120Y
PDE4DIPHQWSPWLRLAUTONOMIC_GANGLIA1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAY14120Y
PDE4DIPHQWSPWLRLAUTONOMIC_GANGLIA1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASY14120Y
PDE4DIPIFTPYPSWLAUTONOMIC_GANGLIA1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYN900N
PDE4DIPIFTPYPSWLAUTONOMIC_GANGLIA1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAN900N
PDE4DIPIFTPYPSWLAUTONOMIC_GANGLIA1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASN900N
PDE4DIPIPPRRPTRPAUTONOMIC_GANGLIA1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN100N
PDE4DIPIPPRRPTRPAUTONOMIC_GANGLIA1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN100N
PDE4DIPIPPRRPTRPAUTONOMIC_GANGLIA1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN100N
PDE4DIPIQAFIFTPYAUTONOMIC_GANGLIA1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYN900N
PDE4DIPIQAFIFTPYAUTONOMIC_GANGLIA1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAN900N
PDE4DIPIQAFIFTPYAUTONOMIC_GANGLIA1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASN900N
PDE4DIPKPSSTSASRAUTONOMIC_GANGLIA1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35KELLYY490N
PDE4DIPKPSSTSASRAUTONOMIC_GANGLIA1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35SIMAY490N
PDE4DIPKPSSTSASRAUTONOMIC_GANGLIA1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35SKNASY490N
PDE4DIPKVPALFLLLAUTONOMIC_GANGLIA1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYY1890N
PDE4DIPKVPALFLLLAUTONOMIC_GANGLIA1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAY1890N
PDE4DIPKVPALFLLLAUTONOMIC_GANGLIA1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASY1890N
PDE4DIPLAAVRHQWSAUTONOMIC_GANGLIA1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN100N
PDE4DIPLAAVRHQWSAUTONOMIC_GANGLIA1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN100N
PDE4DIPLAAVRHQWSAUTONOMIC_GANGLIA1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN100N
PDE4DIPLAFLRHHCPAUTONOMIC_GANGLIA1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYN000N
PDE4DIPLAFLRHHCPAUTONOMIC_GANGLIA1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAN000N
PDE4DIPLAFLRHHCPAUTONOMIC_GANGLIA1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASN000N
PDE4DIPLALSSLAAVAUTONOMIC_GANGLIA1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYN1000N
PDE4DIPLALSSLAAVAUTONOMIC_GANGLIA1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAN1000N
PDE4DIPLALSSLAAVAUTONOMIC_GANGLIA1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASN1000N
PDE4DIPLFLLLPQLHAUTONOMIC_GANGLIA1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN0032N
PDE4DIPLFLLLPQLHAUTONOMIC_GANGLIA1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN0032N
PDE4DIPLFLLLPQLHAUTONOMIC_GANGLIA1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN0032N
PDE4DIPLHPASCLSAAUTONOMIC_GANGLIA1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYN307N
PDE4DIPLHPASCLSAAUTONOMIC_GANGLIA1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAN307N
PDE4DIPLHPASCLSAAUTONOMIC_GANGLIA1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASN307N
PDE4DIPLPRIPPRRPAUTONOMIC_GANGLIA1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN100N
PDE4DIPLPRIPPRRPAUTONOMIC_GANGLIA1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN100N
PDE4DIPLPRIPPRRPAUTONOMIC_GANGLIA1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN100N
PDE4DIPLRHHCPQLHAUTONOMIC_GANGLIA1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN2020N
PDE4DIPLRHHCPQLHAUTONOMIC_GANGLIA1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN2020N
PDE4DIPLRHHCPQLHAUTONOMIC_GANGLIA1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN2020N
PDE4DIPLRLSRSYRCAUTONOMIC_GANGLIA1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYN3033N
PDE4DIPLRLSRSYRCAUTONOMIC_GANGLIA1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAN3033N
PDE4DIPLRLSRSYRCAUTONOMIC_GANGLIA1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASN3033N
PDE4DIPLRPNPTATPAUTONOMIC_GANGLIA1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN1029N
PDE4DIPLRPNPTATPAUTONOMIC_GANGLIA1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN1029N
PDE4DIPLRPNPTATPAUTONOMIC_GANGLIA1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN1029N
PDE4DIPLSAPLALSSAUTONOMIC_GANGLIA1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYN200N
PDE4DIPLSAPLALSSAUTONOMIC_GANGLIA1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAN200N
PDE4DIPLSAPLALSSAUTONOMIC_GANGLIA1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASN200N
PDE4DIPLSRSYRCCRAUTONOMIC_GANGLIA1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN300N
PDE4DIPLSRSYRCCRAUTONOMIC_GANGLIA1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN300N
PDE4DIPLSRSYRCCRAUTONOMIC_GANGLIA1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN300N
PDE4DIPLSSLAAVRHAUTONOMIC_GANGLIA1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPLSSLAAVRHAUTONOMIC_GANGLIA1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPLSSLAAVRHAUTONOMIC_GANGLIA1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPNPTATPSACAUTONOMIC_GANGLIA1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYN400N
PDE4DIPNPTATPSACAUTONOMIC_GANGLIA1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAN400N
PDE4DIPNPTATPSACAUTONOMIC_GANGLIA1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASN400N
PDE4DIPPALFLLLPQAUTONOMIC_GANGLIA1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPPALFLLLPQAUTONOMIC_GANGLIA1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPPALFLLLPQAUTONOMIC_GANGLIA1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPPASCLSAPLAUTONOMIC_GANGLIA1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYN000N
PDE4DIPPASCLSAPLAUTONOMIC_GANGLIA1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAN000N
PDE4DIPPASCLSAPLAUTONOMIC_GANGLIA1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASN000N
PDE4DIPPIQAFIFTPAUTONOMIC_GANGLIA1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYN000N
PDE4DIPPIQAFIFTPAUTONOMIC_GANGLIA1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAN000N
PDE4DIPPIQAFIFTPAUTONOMIC_GANGLIA1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASN000N
PDE4DIPPLALSSLAAAUTONOMIC_GANGLIA1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYN100N
PDE4DIPPLALSSLAAAUTONOMIC_GANGLIA1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAN100N
PDE4DIPPLALSSLAAAUTONOMIC_GANGLIA1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASN100N
PDE4DIPPNPTATPSAAUTONOMIC_GANGLIA1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPPNPTATPSAAUTONOMIC_GANGLIA1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPPNPTATPSAAUTONOMIC_GANGLIA1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPPPRRPTRPIAUTONOMIC_GANGLIA1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN900N
PDE4DIPPPRRPTRPIAUTONOMIC_GANGLIA1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN900N
PDE4DIPPPRRPTRPIAUTONOMIC_GANGLIA1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN900N
PDE4DIPPQLHPASCLAUTONOMIC_GANGLIA1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN200N
PDE4DIPPQLHPASCLAUTONOMIC_GANGLIA1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN200N
PDE4DIPPQLHPASCLAUTONOMIC_GANGLIA1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN200N
PDE4DIPPRIPPRRPTAUTONOMIC_GANGLIA1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPPRIPPRRPTAUTONOMIC_GANGLIA1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPPRIPPRRPTAUTONOMIC_GANGLIA1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPPRRPTRPIQAUTONOMIC_GANGLIA1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPPRRPTRPIQAUTONOMIC_GANGLIA1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPPRRPTRPIQAUTONOMIC_GANGLIA1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPPSACQLPRIAUTONOMIC_GANGLIA1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPPSACQLPRIAUTONOMIC_GANGLIA1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPPSACQLPRIAUTONOMIC_GANGLIA1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPPSSTSASRGAUTONOMIC_GANGLIA1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35KELLYN000Y
PDE4DIPPSSTSASRGAUTONOMIC_GANGLIA1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35SIMAN000Y
PDE4DIPPSSTSASRGAUTONOMIC_GANGLIA1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35SKNASN000Y
PDE4DIPPSWLAFLRHAUTONOMIC_GANGLIA1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPPSWLAFLRHAUTONOMIC_GANGLIA1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPPSWLAFLRHAUTONOMIC_GANGLIA1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPPTATPSACQAUTONOMIC_GANGLIA1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPPTATPSACQAUTONOMIC_GANGLIA1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPPTATPSACQAUTONOMIC_GANGLIA1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPPTRPIQAFIAUTONOMIC_GANGLIA1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPPTRPIQAFIAUTONOMIC_GANGLIA1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPPTRPIQAFIAUTONOMIC_GANGLIA1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPPWLRLSRSYAUTONOMIC_GANGLIA1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYN000N
PDE4DIPPWLRLSRSYAUTONOMIC_GANGLIA1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAN000N
PDE4DIPPWLRLSRSYAUTONOMIC_GANGLIA1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASN000N
PDE4DIPPYPSWLAFLAUTONOMIC_GANGLIA1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYY4100N
PDE4DIPPYPSWLAFLAUTONOMIC_GANGLIA1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAY4100N
PDE4DIPPYPSWLAFLAUTONOMIC_GANGLIA1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASY4100N
PDE4DIPQAFIFTPYPAUTONOMIC_GANGLIA1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYN000N
PDE4DIPQAFIFTPYPAUTONOMIC_GANGLIA1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAN000N
PDE4DIPQAFIFTPYPAUTONOMIC_GANGLIA1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASN000N
PDE4DIPQLHPASCLSAUTONOMIC_GANGLIA1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPQLHPASCLSAUTONOMIC_GANGLIA1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPQLHPASCLSAUTONOMIC_GANGLIA1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPQLPRIPPRRAUTONOMIC_GANGLIA1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN500Y
PDE4DIPQLPRIPPRRAUTONOMIC_GANGLIA1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN500Y
PDE4DIPQLPRIPPRRAUTONOMIC_GANGLIA1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN500Y
PDE4DIPQWSPWLRLSAUTONOMIC_GANGLIA1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPQWSPWLRLSAUTONOMIC_GANGLIA1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPQWSPWLRLSAUTONOMIC_GANGLIA1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPRCCRSSWEKAUTONOMIC_GANGLIA1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYY4100N
PDE4DIPRCCRSSWEKAUTONOMIC_GANGLIA1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAY4100N
PDE4DIPRCCRSSWEKAUTONOMIC_GANGLIA1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASY4100N
PDE4DIPRGLRPNPTAAUTONOMIC_GANGLIA1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYN400N
PDE4DIPRGLRPNPTAAUTONOMIC_GANGLIA1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAN400N
PDE4DIPRGLRPNPTAAUTONOMIC_GANGLIA1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASN400N
PDE4DIPRHHCPQLHPAUTONOMIC_GANGLIA1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYN000N
PDE4DIPRHHCPQLHPAUTONOMIC_GANGLIA1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAN000N
PDE4DIPRHHCPQLHPAUTONOMIC_GANGLIA1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASN000N
PDE4DIPRHQWSPWLRAUTONOMIC_GANGLIA1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN100Y
PDE4DIPRHQWSPWLRAUTONOMIC_GANGLIA1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN100Y
PDE4DIPRHQWSPWLRAUTONOMIC_GANGLIA1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN100Y
PDE4DIPRIPPRRPTRAUTONOMIC_GANGLIA1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYY790N
PDE4DIPRIPPRRPTRAUTONOMIC_GANGLIA1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAY790N
PDE4DIPRIPPRRPTRAUTONOMIC_GANGLIA1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASY790N
PDE4DIPRLSRSYRCCAUTONOMIC_GANGLIA1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYY290N
PDE4DIPRLSRSYRCCAUTONOMIC_GANGLIA1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAY290N
PDE4DIPRLSRSYRCCAUTONOMIC_GANGLIA1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASY290N
PDE4DIPRPIQAFIFTAUTONOMIC_GANGLIA1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYN500N
PDE4DIPRPIQAFIFTAUTONOMIC_GANGLIA1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAN500N
PDE4DIPRPIQAFIFTAUTONOMIC_GANGLIA1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASN500N
PDE4DIPRPNPTATPSAUTONOMIC_GANGLIA1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN300N
PDE4DIPRPNPTATPSAUTONOMIC_GANGLIA1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN300N
PDE4DIPRPNPTATPSAUTONOMIC_GANGLIA1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN300N
PDE4DIPRPTRPIQAFAUTONOMIC_GANGLIA1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYY12100N
PDE4DIPRPTRPIQAFAUTONOMIC_GANGLIA1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAY12100N
PDE4DIPRPTRPIQAFAUTONOMIC_GANGLIA1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASY12100N
PDE4DIPRRPTRPIQAAUTONOMIC_GANGLIA1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN500N
PDE4DIPRRPTRPIQAAUTONOMIC_GANGLIA1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN500N
PDE4DIPRRPTRPIQAAUTONOMIC_GANGLIA1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN500N
PDE4DIPRSSWEKVPAAUTONOMIC_GANGLIA1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN200N
PDE4DIPRSSWEKVPAAUTONOMIC_GANGLIA1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN200N
PDE4DIPRSSWEKVPAAUTONOMIC_GANGLIA1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN200N
PDE4DIPRSYRCCRSSAUTONOMIC_GANGLIA1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN100N
PDE4DIPRSYRCCRSSAUTONOMIC_GANGLIA1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN100N
PDE4DIPRSYRCCRSSAUTONOMIC_GANGLIA1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN100N
PDE4DIPSACQLPRIPAUTONOMIC_GANGLIA1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPSACQLPRIPAUTONOMIC_GANGLIA1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPSACQLPRIPAUTONOMIC_GANGLIA1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPSAPLALSSLAUTONOMIC_GANGLIA1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYY15100N
PDE4DIPSAPLALSSLAUTONOMIC_GANGLIA1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAY15100N
PDE4DIPSAPLALSSLAUTONOMIC_GANGLIA1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASY15100N
PDE4DIPSASRGLRPNAUTONOMIC_GANGLIA1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN100Y
PDE4DIPSASRGLRPNAUTONOMIC_GANGLIA1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN100Y
PDE4DIPSASRGLRPNAUTONOMIC_GANGLIA1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN100Y
PDE4DIPSCLSAPLALAUTONOMIC_GANGLIA1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN1000N
PDE4DIPSCLSAPLALAUTONOMIC_GANGLIA1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN1000N
PDE4DIPSCLSAPLALAUTONOMIC_GANGLIA1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN1000N
PDE4DIPSLAAVRHQWAUTONOMIC_GANGLIA1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYN300N
PDE4DIPSLAAVRHQWAUTONOMIC_GANGLIA1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAN300N
PDE4DIPSLAAVRHQWAUTONOMIC_GANGLIA1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASN300N
PDE4DIPSPWLRLSRSAUTONOMIC_GANGLIA1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYN500Y
PDE4DIPSPWLRLSRSAUTONOMIC_GANGLIA1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAN500Y
PDE4DIPSPWLRLSRSAUTONOMIC_GANGLIA1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASN500Y
PDE4DIPSRGLRPNPTAUTONOMIC_GANGLIA1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN300Y
PDE4DIPSRGLRPNPTAUTONOMIC_GANGLIA1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN300Y
PDE4DIPSRGLRPNPTAUTONOMIC_GANGLIA1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN300Y
PDE4DIPSRSYRCCRSAUTONOMIC_GANGLIA1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN300N
PDE4DIPSRSYRCCRSAUTONOMIC_GANGLIA1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN300N
PDE4DIPSRSYRCCRSAUTONOMIC_GANGLIA1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN300N
PDE4DIPSSLAAVRHQAUTONOMIC_GANGLIA1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYN000Y
PDE4DIPSSLAAVRHQAUTONOMIC_GANGLIA1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAN000Y
PDE4DIPSSLAAVRHQAUTONOMIC_GANGLIA1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASN000Y
PDE4DIPSSTSASRGLAUTONOMIC_GANGLIA1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35KELLYN700N
PDE4DIPSSTSASRGLAUTONOMIC_GANGLIA1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35SIMAN700N
PDE4DIPSSTSASRGLAUTONOMIC_GANGLIA1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35SKNASN700N
PDE4DIPSSWEKVPALAUTONOMIC_GANGLIA1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYY1990N
PDE4DIPSSWEKVPALAUTONOMIC_GANGLIA1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAY1990N
PDE4DIPSSWEKVPALAUTONOMIC_GANGLIA1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASY1990N
PDE4DIPSTSASRGLRAUTONOMIC_GANGLIA1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35KELLYN400N
PDE4DIPSTSASRGLRAUTONOMIC_GANGLIA1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35SIMAN400N
PDE4DIPSTSASRGLRAUTONOMIC_GANGLIA1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35SKNASN400N
PDE4DIPSWEKVPALFAUTONOMIC_GANGLIA1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN300N
PDE4DIPSWEKVPALFAUTONOMIC_GANGLIA1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN300N
PDE4DIPSWEKVPALFAUTONOMIC_GANGLIA1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN300N
PDE4DIPSWLAFLRHHAUTONOMIC_GANGLIA1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN000N
PDE4DIPSWLAFLRHHAUTONOMIC_GANGLIA1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN000N
PDE4DIPSWLAFLRHHAUTONOMIC_GANGLIA1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN000N
PDE4DIPSYRCCRSSWAUTONOMIC_GANGLIA1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYY2100N
PDE4DIPSYRCCRSSWAUTONOMIC_GANGLIA1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAY2100N
PDE4DIPSYRCCRSSWAUTONOMIC_GANGLIA1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASY2100N
PDE4DIPTATPSACQLAUTONOMIC_GANGLIA1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYN1100N
PDE4DIPTATPSACQLAUTONOMIC_GANGLIA1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAN1100N
PDE4DIPTATPSACQLAUTONOMIC_GANGLIA1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASN1100N
PDE4DIPTPSACQLPRAUTONOMIC_GANGLIA1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN500N
PDE4DIPTPSACQLPRAUTONOMIC_GANGLIA1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN500N
PDE4DIPTPSACQLPRAUTONOMIC_GANGLIA1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN500N
PDE4DIPTPYPSWLAFAUTONOMIC_GANGLIA1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYY19100N
PDE4DIPTPYPSWLAFAUTONOMIC_GANGLIA1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAY19100N
PDE4DIPTPYPSWLAFAUTONOMIC_GANGLIA1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASY19100N
PDE4DIPTRPIQAFIFAUTONOMIC_GANGLIA1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN400N
PDE4DIPTRPIQAFIFAUTONOMIC_GANGLIA1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN400N
PDE4DIPTRPIQAFIFAUTONOMIC_GANGLIA1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN400N
PDE4DIPTSASRGLRPAUTONOMIC_GANGLIA1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYN000N
PDE4DIPTSASRGLRPAUTONOMIC_GANGLIA1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAN000N
PDE4DIPTSASRGLRPAUTONOMIC_GANGLIA1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASN000N
PDE4DIPVPALFLLLPAUTONOMIC_GANGLIA1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN200N
PDE4DIPVPALFLLLPAUTONOMIC_GANGLIA1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN200N
PDE4DIPVPALFLLLPAUTONOMIC_GANGLIA1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN200N
PDE4DIPVRHQWSPWLAUTONOMIC_GANGLIA1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYN905Y
PDE4DIPVRHQWSPWLAUTONOMIC_GANGLIA1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAN905Y
PDE4DIPVRHQWSPWLAUTONOMIC_GANGLIA1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASN905Y
PDE4DIPWEKVPALFLAUTONOMIC_GANGLIA1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYY12125N
PDE4DIPWEKVPALFLAUTONOMIC_GANGLIA1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAY12125N
PDE4DIPWEKVPALFLAUTONOMIC_GANGLIA1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASY12125N
PDE4DIPWLAFLRHHCAUTONOMIC_GANGLIA1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35KELLYY41017N
PDE4DIPWLAFLRHHCAUTONOMIC_GANGLIA1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SIMAY41017N
PDE4DIPWLAFLRHHCAUTONOMIC_GANGLIA1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKNASY41017N
PDE4DIPWLRLSRSYRAUTONOMIC_GANGLIA1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYY71012N
PDE4DIPWLRLSRSYRAUTONOMIC_GANGLIA1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAY71012N
PDE4DIPWLRLSRSYRAUTONOMIC_GANGLIA1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASY71012N
PDE4DIPWSPWLRLSRAUTONOMIC_GANGLIA1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35KELLYN605Y
PDE4DIPWSPWLRLSRAUTONOMIC_GANGLIA1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SIMAN605Y
PDE4DIPWSPWLRLSRAUTONOMIC_GANGLIA1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKNASN605Y
PDE4DIPYPSWLAFLRAUTONOMIC_GANGLIA1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN702N
PDE4DIPYPSWLAFLRAUTONOMIC_GANGLIA1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN702N
PDE4DIPYPSWLAFLRAUTONOMIC_GANGLIA1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN702N
PDE4DIPYRCCRSSWEAUTONOMIC_GANGLIA1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35KELLYN305N
PDE4DIPYRCCRSSWEAUTONOMIC_GANGLIA1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SIMAN305N
PDE4DIPYRCCRSSWEAUTONOMIC_GANGLIA1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKNASN305N
PDE4DIPAQMEEAGFSAUTONOMIC_GANGLIA1032p.I1034Mc.3102T>GMissense_Mutation10.11KELLYN000N
PDE4DIPASTNLEVKSAUTONOMIC_GANGLIA2328p.R2329Sc.6987G>CMissense_Mutation10.11NB1N000N
PDE4DIPDVLKKASTNAUTONOMIC_GANGLIA2323p.R2329Sc.6987G>CMissense_Mutation10.11NB1N000N
PDE4DIPELKAQMEEAAUTONOMIC_GANGLIA1029p.I1034Mc.3102T>GMissense_Mutation10.11KELLYN200N
PDE4DIPELKELKAQMAUTONOMIC_GANGLIA1026p.I1034Mc.3102T>GMissense_Mutation10.11KELLYN300N
PDE4DIPHDVLKKASTAUTONOMIC_GANGLIA2322p.R2329Sc.6987G>CMissense_Mutation10.11NB1N300N
PDE4DIPKAQMEEAGFAUTONOMIC_GANGLIA1031p.I1034Mc.3102T>GMissense_Mutation10.11KELLYN400N
PDE4DIPKASTNLEVKAUTONOMIC_GANGLIA2327p.R2329Sc.6987G>CMissense_Mutation10.11NB1N300N
PDE4DIPKELKAQMEEAUTONOMIC_GANGLIA1028p.I1034Mc.3102T>GMissense_Mutation10.11KELLYN000N
PDE4DIPKKASTNLEVAUTONOMIC_GANGLIA2326p.R2329Sc.6987G>CMissense_Mutation10.11NB1N300N
PDE4DIPLKAQMEEAGAUTONOMIC_GANGLIA1030p.I1034Mc.3102T>GMissense_Mutation10.11KELLYN000N
PDE4DIPLKELKAQMEAUTONOMIC_GANGLIA1027p.I1034Mc.3102T>GMissense_Mutation10.11KELLYN000N
PDE4DIPLKKASTNLEAUTONOMIC_GANGLIA2325p.R2329Sc.6987G>CMissense_Mutation10.11NB1N007N
PDE4DIPMEEAGFSSVAUTONOMIC_GANGLIA1034p.I1034Mc.3102T>GMissense_Mutation10.11KELLYY8100N
PDE4DIPQMEEAGFSSAUTONOMIC_GANGLIA1033p.I1034Mc.3102T>GMissense_Mutation10.11KELLYN100N
PDE4DIPSTNLEVKSLAUTONOMIC_GANGLIA2329p.R2329Sc.6987G>CMissense_Mutation10.11NB1Y5110N
PDE4DIPTHDVLKKASAUTONOMIC_GANGLIA2321p.R2329Sc.6987G>CMissense_Mutation10.11NB1N100N
PDE4DIPVLKKASTNLAUTONOMIC_GANGLIA2324p.R2329Sc.6987G>CMissense_Mutation10.11NB1Y8120N
PDE4DIPASLSPSSVNAUTONOMIC_GANGLIA2083p.I2090Vc.6267_6268CA>TGMissense_Mutation10.22MHHNB11N000N
PDE4DIPKASLSPSSVAUTONOMIC_GANGLIA2082p.I2090Vc.6267_6268CA>TGMissense_Mutation10.22MHHNB11N600N
PDE4DIPLSPSSVNQNAUTONOMIC_GANGLIA2085p.I2090Vc.6267_6268CA>TGMissense_Mutation10.22MHHNB11N100N
PDE4DIPPSSVNQNFPAUTONOMIC_GANGLIA2087p.I2090Vc.6267_6268CA>TGMissense_Mutation10.22MHHNB11N000N
PDE4DIPSLSPSSVNQAUTONOMIC_GANGLIA2084p.I2090Vc.6267_6268CA>TGMissense_Mutation10.22MHHNB11N000N
PDE4DIPSPSSVNQNFAUTONOMIC_GANGLIA2086p.I2090Vc.6267_6268CA>TGMissense_Mutation10.22MHHNB11Y1290N
PDE4DIPSSVNQNFPAAUTONOMIC_GANGLIA2088p.I2090Vc.6267_6268CA>TGMissense_Mutation10.22MHHNB11N300N
PDE4DIPSVNQNFPASAUTONOMIC_GANGLIA2089p.I2090Vc.6267_6268CA>TGMissense_Mutation10.22MHHNB11N100N
PDE4DIPVNQNFPASTAUTONOMIC_GANGLIA2090p.I2090Vc.6267_6268CA>TGMissense_Mutation10.22MHHNB11N000N
PIK3C2GCSWGSIGKHAUTONOMIC_GANGLIA124p.P129delc.384_386delCCCIn_Frame_Del447.23CHP212N000N
PIK3C2GCSWGSIGKHAUTONOMIC_GANGLIA124p.P129delc.384_386delCCCIn_Frame_Del447.23KPNRTBM1N000N
PIK3C2GCSWGSIGKHAUTONOMIC_GANGLIA124p.P129delc.384_386delCCCIn_Frame_Del447.23KPNSI9SN000N
PIK3C2GCSWGSIGKHAUTONOMIC_GANGLIA124p.P129delc.384_386delCCCIn_Frame_Del447.23SHSY5YN000N
PIK3C2GCSWGSIGKHAUTONOMIC_GANGLIA124p.P129delc.384_386delCCCIn_Frame_Del447.23SKNASN000N
PIK3C2GCSWGSIGKHAUTONOMIC_GANGLIA124p.P129delc.384_386delCCCIn_Frame_Del447.23SKNDZN000N
PIK3C2GCSWGSIGKHAUTONOMIC_GANGLIA124p.P129delc.384_386delCCCIn_Frame_Del447.23SKNSHN000N
PIK3C2GECSWGSIGKAUTONOMIC_GANGLIA123p.P129delc.384_386delCCCIn_Frame_Del347.23CHP212N100N
PIK3C2GECSWGSIGKAUTONOMIC_GANGLIA123p.P129delc.384_386delCCCIn_Frame_Del347.23KPNRTBM1N100N
PIK3C2GECSWGSIGKAUTONOMIC_GANGLIA123p.P129delc.384_386delCCCIn_Frame_Del347.23KPNSI9SN100N
PIK3C2GECSWGSIGKAUTONOMIC_GANGLIA123p.P129delc.384_386delCCCIn_Frame_Del347.23SHSY5YN100N
PIK3C2GECSWGSIGKAUTONOMIC_GANGLIA123p.P129delc.384_386delCCCIn_Frame_Del347.23SKNASN100N
PIK3C2GECSWGSIGKAUTONOMIC_GANGLIA123p.P129delc.384_386delCCCIn_Frame_Del347.23SKNDZN100N
PIK3C2GECSWGSIGKAUTONOMIC_GANGLIA123p.P129delc.384_386delCCCIn_Frame_Del347.23SKNSHN100N
PIK3C2GGSIGKHHGAAUTONOMIC_GANGLIA127p.P129delc.384_386delCCCIn_Frame_Del247.23CHP212N300N
PIK3C2GGSIGKHHGAAUTONOMIC_GANGLIA127p.P129delc.384_386delCCCIn_Frame_Del247.23KPNRTBM1N300N
PIK3C2GGSIGKHHGAAUTONOMIC_GANGLIA127p.P129delc.384_386delCCCIn_Frame_Del247.23KPNSI9SN300N
PIK3C2GGSIGKHHGAAUTONOMIC_GANGLIA127p.P129delc.384_386delCCCIn_Frame_Del247.23SHSY5YN300N
PIK3C2GGSIGKHHGAAUTONOMIC_GANGLIA127p.P129delc.384_386delCCCIn_Frame_Del247.23SKNASN300N
PIK3C2GGSIGKHHGAAUTONOMIC_GANGLIA127p.P129delc.384_386delCCCIn_Frame_Del247.23SKNDZN300N
PIK3C2GGSIGKHHGAAUTONOMIC_GANGLIA127p.P129delc.384_386delCCCIn_Frame_Del247.23SKNSHN300N
PIK3C2GKECSWGSIGAUTONOMIC_GANGLIA122p.P129delc.384_386delCCCIn_Frame_Del247.23CHP212N000N
PIK3C2GKECSWGSIGAUTONOMIC_GANGLIA122p.P129delc.384_386delCCCIn_Frame_Del247.23KPNRTBM1N000N
PIK3C2GKECSWGSIGAUTONOMIC_GANGLIA122p.P129delc.384_386delCCCIn_Frame_Del247.23KPNSI9SN000N
PIK3C2GKECSWGSIGAUTONOMIC_GANGLIA122p.P129delc.384_386delCCCIn_Frame_Del247.23SHSY5YN000N
PIK3C2GKECSWGSIGAUTONOMIC_GANGLIA122p.P129delc.384_386delCCCIn_Frame_Del247.23SKNASN000N
PIK3C2GKECSWGSIGAUTONOMIC_GANGLIA122p.P129delc.384_386delCCCIn_Frame_Del247.23SKNDZN000N
PIK3C2GKECSWGSIGAUTONOMIC_GANGLIA122p.P129delc.384_386delCCCIn_Frame_Del247.23SKNSHN000N
PIK3C2GNKECSWGSIAUTONOMIC_GANGLIA121p.P129delc.384_386delCCCIn_Frame_Del147.23CHP212N100N
PIK3C2GNKECSWGSIAUTONOMIC_GANGLIA121p.P129delc.384_386delCCCIn_Frame_Del147.23KPNRTBM1N100N
PIK3C2GNKECSWGSIAUTONOMIC_GANGLIA121p.P129delc.384_386delCCCIn_Frame_Del147.23KPNSI9SN100N
PIK3C2GNKECSWGSIAUTONOMIC_GANGLIA121p.P129delc.384_386delCCCIn_Frame_Del147.23SHSY5YN100N
PIK3C2GNKECSWGSIAUTONOMIC_GANGLIA121p.P129delc.384_386delCCCIn_Frame_Del147.23SKNASN100N
PIK3C2GNKECSWGSIAUTONOMIC_GANGLIA121p.P129delc.384_386delCCCIn_Frame_Del147.23SKNDZN100N
PIK3C2GNKECSWGSIAUTONOMIC_GANGLIA121p.P129delc.384_386delCCCIn_Frame_Del147.23SKNSHN100N
PIK3C2GSIGKHHGADAUTONOMIC_GANGLIA128p.P129delc.384_386delCCCIn_Frame_Del147.23CHP212N000N
PIK3C2GSIGKHHGADAUTONOMIC_GANGLIA128p.P129delc.384_386delCCCIn_Frame_Del147.23KPNRTBM1N000N
PIK3C2GSIGKHHGADAUTONOMIC_GANGLIA128p.P129delc.384_386delCCCIn_Frame_Del147.23KPNSI9SN000N
PIK3C2GSIGKHHGADAUTONOMIC_GANGLIA128p.P129delc.384_386delCCCIn_Frame_Del147.23SHSY5YN000N
PIK3C2GSIGKHHGADAUTONOMIC_GANGLIA128p.P129delc.384_386delCCCIn_Frame_Del147.23SKNASN000N
PIK3C2GSIGKHHGADAUTONOMIC_GANGLIA128p.P129delc.384_386delCCCIn_Frame_Del147.23SKNDZN000N
PIK3C2GSIGKHHGADAUTONOMIC_GANGLIA128p.P129delc.384_386delCCCIn_Frame_Del147.23SKNSHN000N
PIK3C2GSWGSIGKHHAUTONOMIC_GANGLIA125p.P129delc.384_386delCCCIn_Frame_Del447.23CHP212N000N
PIK3C2GSWGSIGKHHAUTONOMIC_GANGLIA125p.P129delc.384_386delCCCIn_Frame_Del447.23KPNRTBM1N000N
PIK3C2GSWGSIGKHHAUTONOMIC_GANGLIA125p.P129delc.384_386delCCCIn_Frame_Del447.23KPNSI9SN000N
PIK3C2GSWGSIGKHHAUTONOMIC_GANGLIA125p.P129delc.384_386delCCCIn_Frame_Del447.23SHSY5YN000N
PIK3C2GSWGSIGKHHAUTONOMIC_GANGLIA125p.P129delc.384_386delCCCIn_Frame_Del447.23SKNASN000N
PIK3C2GSWGSIGKHHAUTONOMIC_GANGLIA125p.P129delc.384_386delCCCIn_Frame_Del447.23SKNDZN000N
PIK3C2GSWGSIGKHHAUTONOMIC_GANGLIA125p.P129delc.384_386delCCCIn_Frame_Del447.23SKNSHN000N
PIK3C2GWGSIGKHHGAUTONOMIC_GANGLIA126p.P129delc.384_386delCCCIn_Frame_Del347.23CHP212N107Y
PIK3C2GWGSIGKHHGAUTONOMIC_GANGLIA126p.P129delc.384_386delCCCIn_Frame_Del347.23KPNRTBM1N107Y
PIK3C2GWGSIGKHHGAUTONOMIC_GANGLIA126p.P129delc.384_386delCCCIn_Frame_Del347.23KPNSI9SN107Y
PIK3C2GWGSIGKHHGAUTONOMIC_GANGLIA126p.P129delc.384_386delCCCIn_Frame_Del347.23SHSY5YN107Y
PIK3C2GWGSIGKHHGAUTONOMIC_GANGLIA126p.P129delc.384_386delCCCIn_Frame_Del347.23SKNASN107Y
PIK3C2GWGSIGKHHGAUTONOMIC_GANGLIA126p.P129delc.384_386delCCCIn_Frame_Del347.23SKNDZN107Y
PIK3C2GWGSIGKHHGAUTONOMIC_GANGLIA126p.P129delc.384_386delCCCIn_Frame_Del347.23SKNSHN107Y
PRKDCAGHAMLAGPAUTONOMIC_GANGLIA1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N000N
PRKDCAGHAMLAGPAUTONOMIC_GANGLIA1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N000N
PRKDCAGHAMLAGPAUTONOMIC_GANGLIA1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN000N
PRKDCAGHAMLAGPAUTONOMIC_GANGLIA1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N000N
PRKDCAGHAMLAGPAUTONOMIC_GANGLIA1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN000N
PRKDCAGHAMLAGPAUTONOMIC_GANGLIA1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN000N
PRKDCAGHAMLAGPAUTONOMIC_GANGLIA1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N000N
PRKDCAGHAMLAGPAUTONOMIC_GANGLIA1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N000N
PRKDCAGHAMLAGPAUTONOMIC_GANGLIA1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N000N
PRKDCAGHAMLAGPAUTONOMIC_GANGLIA1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN000N
PRKDCAGHAMLAGPAUTONOMIC_GANGLIA1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN000N
PRKDCAGHAMLAGPAUTONOMIC_GANGLIA1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN000N
PRKDCAGHAMLAGPAUTONOMIC_GANGLIA1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN000N
PRKDCAGHAMLAGPAUTONOMIC_GANGLIA1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN000N
PRKDCAGHAMLAGPAUTONOMIC_GANGLIA1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN000N
PRKDCAGPAPGRVGAUTONOMIC_GANGLIA1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N100N
PRKDCAGPAPGRVGAUTONOMIC_GANGLIA1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N100N
PRKDCAGPAPGRVGAUTONOMIC_GANGLIA1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN100N
PRKDCAGPAPGRVGAUTONOMIC_GANGLIA1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N100N
PRKDCAGPAPGRVGAUTONOMIC_GANGLIA1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN100N
PRKDCAGPAPGRVGAUTONOMIC_GANGLIA1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN100N
PRKDCAGPAPGRVGAUTONOMIC_GANGLIA1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N100N
PRKDCAGPAPGRVGAUTONOMIC_GANGLIA1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N100N
PRKDCAGPAPGRVGAUTONOMIC_GANGLIA1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N100N
PRKDCAGPAPGRVGAUTONOMIC_GANGLIA1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN100N
PRKDCAGPAPGRVGAUTONOMIC_GANGLIA1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN100N
PRKDCAGPAPGRVGAUTONOMIC_GANGLIA1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN100N
PRKDCAGPAPGRVGAUTONOMIC_GANGLIA1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN100N
PRKDCAGPAPGRVGAUTONOMIC_GANGLIA1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN100N
PRKDCAGPAPGRVGAUTONOMIC_GANGLIA1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN100N
PRKDCAIQPAGHAMAUTONOMIC_GANGLIA1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212Y290N
PRKDCAIQPAGHAMAUTONOMIC_GANGLIA1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32Y290N
PRKDCAIQPAGHAMAUTONOMIC_GANGLIA1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYY290N
PRKDCAIQPAGHAMAUTONOMIC_GANGLIA1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1Y290N
PRKDCAIQPAGHAMAUTONOMIC_GANGLIA1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SY290N
PRKDCAIQPAGHAMAUTONOMIC_GANGLIA1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNY290N
PRKDCAIQPAGHAMAUTONOMIC_GANGLIA1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11Y290N
PRKDCAIQPAGHAMAUTONOMIC_GANGLIA1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1Y290N
PRKDCAIQPAGHAMAUTONOMIC_GANGLIA1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6Y290N
PRKDCAIQPAGHAMAUTONOMIC_GANGLIA1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YY290N
PRKDCAIQPAGHAMAUTONOMIC_GANGLIA1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAY290N
PRKDCAIQPAGHAMAUTONOMIC_GANGLIA1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASY290N
PRKDCAIQPAGHAMAUTONOMIC_GANGLIA1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZY290N
PRKDCAIQPAGHAMAUTONOMIC_GANGLIA1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIY290N
PRKDCAIQPAGHAMAUTONOMIC_GANGLIA1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHY290N
PRKDCAMLAGPAPGAUTONOMIC_GANGLIA1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N000N
PRKDCAMLAGPAPGAUTONOMIC_GANGLIA1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N000N
PRKDCAMLAGPAPGAUTONOMIC_GANGLIA1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN000N
PRKDCAMLAGPAPGAUTONOMIC_GANGLIA1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N000N
PRKDCAMLAGPAPGAUTONOMIC_GANGLIA1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN000N
PRKDCAMLAGPAPGAUTONOMIC_GANGLIA1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN000N
PRKDCAMLAGPAPGAUTONOMIC_GANGLIA1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N000N
PRKDCAMLAGPAPGAUTONOMIC_GANGLIA1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N000N
PRKDCAMLAGPAPGAUTONOMIC_GANGLIA1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N000N
PRKDCAMLAGPAPGAUTONOMIC_GANGLIA1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN000N
PRKDCAMLAGPAPGAUTONOMIC_GANGLIA1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN000N
PRKDCAMLAGPAPGAUTONOMIC_GANGLIA1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN000N
PRKDCAMLAGPAPGAUTONOMIC_GANGLIA1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN000N
PRKDCAMLAGPAPGAUTONOMIC_GANGLIA1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN000N
PRKDCAMLAGPAPGAUTONOMIC_GANGLIA1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN000N
PRKDCAPGRVGVLQAUTONOMIC_GANGLIA1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N000N
PRKDCAPGRVGVLQAUTONOMIC_GANGLIA1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N000N
PRKDCAPGRVGVLQAUTONOMIC_GANGLIA1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN000N
PRKDCAPGRVGVLQAUTONOMIC_GANGLIA1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N000N
PRKDCAPGRVGVLQAUTONOMIC_GANGLIA1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN000N
PRKDCAPGRVGVLQAUTONOMIC_GANGLIA1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN000N
PRKDCAPGRVGVLQAUTONOMIC_GANGLIA1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N000N
PRKDCAPGRVGVLQAUTONOMIC_GANGLIA1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N000N
PRKDCAPGRVGVLQAUTONOMIC_GANGLIA1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N000N
PRKDCAPGRVGVLQAUTONOMIC_GANGLIA1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN000N
PRKDCAPGRVGVLQAUTONOMIC_GANGLIA1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN000N
PRKDCAPGRVGVLQAUTONOMIC_GANGLIA1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN000N
PRKDCAPGRVGVLQAUTONOMIC_GANGLIA1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN000N
PRKDCAPGRVGVLQAUTONOMIC_GANGLIA1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN000N
PRKDCAPGRVGVLQAUTONOMIC_GANGLIA1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN000N
PRKDCAQPTLLYPSAUTONOMIC_GANGLIA1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48CHP212N000Y
PRKDCAQPTLLYPSAUTONOMIC_GANGLIA1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48IMR32N000Y
PRKDCAQPTLLYPSAUTONOMIC_GANGLIA1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48KELLYN000Y
PRKDCAQPTLLYPSAUTONOMIC_GANGLIA1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48KPNRTBM1N000Y
PRKDCAQPTLLYPSAUTONOMIC_GANGLIA1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48KPNSI9SN000Y
PRKDCAQPTLLYPSAUTONOMIC_GANGLIA1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48KPNYNN000Y
PRKDCAQPTLLYPSAUTONOMIC_GANGLIA1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48MHHNB11N000Y
PRKDCAQPTLLYPSAUTONOMIC_GANGLIA1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48NB1N000Y
PRKDCAQPTLLYPSAUTONOMIC_GANGLIA1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48NH6N000Y
PRKDCAQPTLLYPSAUTONOMIC_GANGLIA1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SHSY5YN000Y
PRKDCAQPTLLYPSAUTONOMIC_GANGLIA1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SIMAN000Y
PRKDCAQPTLLYPSAUTONOMIC_GANGLIA1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SKNASN000Y
PRKDCAQPTLLYPSAUTONOMIC_GANGLIA1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SKNDZN000Y
PRKDCAQPTLLYPSAUTONOMIC_GANGLIA1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SKNFIN000Y
PRKDCAQPTLLYPSAUTONOMIC_GANGLIA1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SKNSHN000Y
PRKDCCRSAPGPRYAUTONOMIC_GANGLIA1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N300N
PRKDCCRSAPGPRYAUTONOMIC_GANGLIA1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N300N
PRKDCCRSAPGPRYAUTONOMIC_GANGLIA1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN300N
PRKDCCRSAPGPRYAUTONOMIC_GANGLIA1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N300N
PRKDCCRSAPGPRYAUTONOMIC_GANGLIA1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN300N
PRKDCCRSAPGPRYAUTONOMIC_GANGLIA1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN300N
PRKDCCRSAPGPRYAUTONOMIC_GANGLIA1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N300N
PRKDCCRSAPGPRYAUTONOMIC_GANGLIA1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N300N
PRKDCCRSAPGPRYAUTONOMIC_GANGLIA1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N300N
PRKDCCRSAPGPRYAUTONOMIC_GANGLIA1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN300N
PRKDCCRSAPGPRYAUTONOMIC_GANGLIA1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN300N
PRKDCCRSAPGPRYAUTONOMIC_GANGLIA1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN300N
PRKDCCRSAPGPRYAUTONOMIC_GANGLIA1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN300N
PRKDCCRSAPGPRYAUTONOMIC_GANGLIA1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN300N
PRKDCCRSAPGPRYAUTONOMIC_GANGLIA1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN300N
PRKDCENCRSAPGPAUTONOMIC_GANGLIA1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48CHP212N000N
PRKDCENCRSAPGPAUTONOMIC_GANGLIA1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48IMR32N000N
PRKDCENCRSAPGPAUTONOMIC_GANGLIA1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KELLYN000N
PRKDCENCRSAPGPAUTONOMIC_GANGLIA1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KPNRTBM1N000N
PRKDCENCRSAPGPAUTONOMIC_GANGLIA1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KPNSI9SN000N
PRKDCENCRSAPGPAUTONOMIC_GANGLIA1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KPNYNN000N
PRKDCENCRSAPGPAUTONOMIC_GANGLIA1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48MHHNB11N000N
PRKDCENCRSAPGPAUTONOMIC_GANGLIA1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48NB1N000N
PRKDCENCRSAPGPAUTONOMIC_GANGLIA1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48NH6N000N
PRKDCENCRSAPGPAUTONOMIC_GANGLIA1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SHSY5YN000N
PRKDCENCRSAPGPAUTONOMIC_GANGLIA1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SIMAN000N
PRKDCENCRSAPGPAUTONOMIC_GANGLIA1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNASN000N
PRKDCENCRSAPGPAUTONOMIC_GANGLIA1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNDZN000N
PRKDCENCRSAPGPAUTONOMIC_GANGLIA1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNFIN000N
PRKDCENCRSAPGPAUTONOMIC_GANGLIA1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNSHN000N
PRKDCGAIQPAGHAAUTONOMIC_GANGLIA1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N400N
PRKDCGAIQPAGHAAUTONOMIC_GANGLIA1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N400N
PRKDCGAIQPAGHAAUTONOMIC_GANGLIA1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN400N
PRKDCGAIQPAGHAAUTONOMIC_GANGLIA1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N400N
PRKDCGAIQPAGHAAUTONOMIC_GANGLIA1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN400N
PRKDCGAIQPAGHAAUTONOMIC_GANGLIA1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN400N
PRKDCGAIQPAGHAAUTONOMIC_GANGLIA1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N400N
PRKDCGAIQPAGHAAUTONOMIC_GANGLIA1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N400N
PRKDCGAIQPAGHAAUTONOMIC_GANGLIA1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N400N
PRKDCGAIQPAGHAAUTONOMIC_GANGLIA1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN400N
PRKDCGAIQPAGHAAUTONOMIC_GANGLIA1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN400N
PRKDCGAIQPAGHAAUTONOMIC_GANGLIA1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN400N
PRKDCGAIQPAGHAAUTONOMIC_GANGLIA1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN400N
PRKDCGAIQPAGHAAUTONOMIC_GANGLIA1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN400N
PRKDCGAIQPAGHAAUTONOMIC_GANGLIA1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN400N
PRKDCGHAMLAGPAAUTONOMIC_GANGLIA1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N100N
PRKDCGHAMLAGPAAUTONOMIC_GANGLIA1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N100N
PRKDCGHAMLAGPAAUTONOMIC_GANGLIA1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN100N
PRKDCGHAMLAGPAAUTONOMIC_GANGLIA1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N100N
PRKDCGHAMLAGPAAUTONOMIC_GANGLIA1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN100N
PRKDCGHAMLAGPAAUTONOMIC_GANGLIA1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN100N
PRKDCGHAMLAGPAAUTONOMIC_GANGLIA1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N100N
PRKDCGHAMLAGPAAUTONOMIC_GANGLIA1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N100N
PRKDCGHAMLAGPAAUTONOMIC_GANGLIA1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N100N
PRKDCGHAMLAGPAAUTONOMIC_GANGLIA1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN100N
PRKDCGHAMLAGPAAUTONOMIC_GANGLIA1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN100N
PRKDCGHAMLAGPAAUTONOMIC_GANGLIA1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN100N
PRKDCGHAMLAGPAAUTONOMIC_GANGLIA1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN100N
PRKDCGHAMLAGPAAUTONOMIC_GANGLIA1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN100N
PRKDCGHAMLAGPAAUTONOMIC_GANGLIA1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN100N
PRKDCGPAPGRVGVAUTONOMIC_GANGLIA1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212Y13150N
PRKDCGPAPGRVGVAUTONOMIC_GANGLIA1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32Y13150N
PRKDCGPAPGRVGVAUTONOMIC_GANGLIA1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYY13150N
PRKDCGPAPGRVGVAUTONOMIC_GANGLIA1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1Y13150N
PRKDCGPAPGRVGVAUTONOMIC_GANGLIA1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SY13150N
PRKDCGPAPGRVGVAUTONOMIC_GANGLIA1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNY13150N
PRKDCGPAPGRVGVAUTONOMIC_GANGLIA1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11Y13150N
PRKDCGPAPGRVGVAUTONOMIC_GANGLIA1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1Y13150N
PRKDCGPAPGRVGVAUTONOMIC_GANGLIA1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6Y13150N
PRKDCGPAPGRVGVAUTONOMIC_GANGLIA1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YY13150N
PRKDCGPAPGRVGVAUTONOMIC_GANGLIA1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAY13150N
PRKDCGPAPGRVGVAUTONOMIC_GANGLIA1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASY13150N
PRKDCGPAPGRVGVAUTONOMIC_GANGLIA1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZY13150N
PRKDCGPAPGRVGVAUTONOMIC_GANGLIA1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIY13150N
PRKDCGPAPGRVGVAUTONOMIC_GANGLIA1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHY13150N
PRKDCGRVGVLQHVAUTONOMIC_GANGLIA1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212Y490N
PRKDCGRVGVLQHVAUTONOMIC_GANGLIA1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32Y490N
PRKDCGRVGVLQHVAUTONOMIC_GANGLIA1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYY490N
PRKDCGRVGVLQHVAUTONOMIC_GANGLIA1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1Y490N
PRKDCGRVGVLQHVAUTONOMIC_GANGLIA1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SY490N
PRKDCGRVGVLQHVAUTONOMIC_GANGLIA1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNY490N
PRKDCGRVGVLQHVAUTONOMIC_GANGLIA1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11Y490N
PRKDCGRVGVLQHVAUTONOMIC_GANGLIA1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1Y490N
PRKDCGRVGVLQHVAUTONOMIC_GANGLIA1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6Y490N
PRKDCGRVGVLQHVAUTONOMIC_GANGLIA1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YY490N
PRKDCGRVGVLQHVAUTONOMIC_GANGLIA1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAY490N
PRKDCGRVGVLQHVAUTONOMIC_GANGLIA1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASY490N
PRKDCGRVGVLQHVAUTONOMIC_GANGLIA1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZY490N
PRKDCGRVGVLQHVAUTONOMIC_GANGLIA1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIY490N
PRKDCGRVGVLQHVAUTONOMIC_GANGLIA1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHY490N
PRKDCGVLQHVHWRAUTONOMIC_GANGLIA1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212Y690N
PRKDCGVLQHVHWRAUTONOMIC_GANGLIA1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32Y690N
PRKDCGVLQHVHWRAUTONOMIC_GANGLIA1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYY690N
PRKDCGVLQHVHWRAUTONOMIC_GANGLIA1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1Y690N
PRKDCGVLQHVHWRAUTONOMIC_GANGLIA1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SY690N
PRKDCGVLQHVHWRAUTONOMIC_GANGLIA1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNY690N
PRKDCGVLQHVHWRAUTONOMIC_GANGLIA1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11Y690N
PRKDCGVLQHVHWRAUTONOMIC_GANGLIA1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1Y690N
PRKDCGVLQHVHWRAUTONOMIC_GANGLIA1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6Y690N
PRKDCGVLQHVHWRAUTONOMIC_GANGLIA1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YY690N
PRKDCGVLQHVHWRAUTONOMIC_GANGLIA1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAY690N
PRKDCGVLQHVHWRAUTONOMIC_GANGLIA1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASY690N
PRKDCGVLQHVHWRAUTONOMIC_GANGLIA1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZY690N
PRKDCGVLQHVHWRAUTONOMIC_GANGLIA1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIY690N
PRKDCGVLQHVHWRAUTONOMIC_GANGLIA1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHY690N
PRKDCHAMLAGPAPAUTONOMIC_GANGLIA1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N000N
PRKDCHAMLAGPAPAUTONOMIC_GANGLIA1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N000N
PRKDCHAMLAGPAPAUTONOMIC_GANGLIA1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN000N
PRKDCHAMLAGPAPAUTONOMIC_GANGLIA1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N000N
PRKDCHAMLAGPAPAUTONOMIC_GANGLIA1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN000N
PRKDCHAMLAGPAPAUTONOMIC_GANGLIA1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN000N
PRKDCHAMLAGPAPAUTONOMIC_GANGLIA1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N000N
PRKDCHAMLAGPAPAUTONOMIC_GANGLIA1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N000N
PRKDCHAMLAGPAPAUTONOMIC_GANGLIA1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N000N
PRKDCHAMLAGPAPAUTONOMIC_GANGLIA1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN000N
PRKDCHAMLAGPAPAUTONOMIC_GANGLIA1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN000N
PRKDCHAMLAGPAPAUTONOMIC_GANGLIA1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN000N
PRKDCHAMLAGPAPAUTONOMIC_GANGLIA1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN000N
PRKDCHAMLAGPAPAUTONOMIC_GANGLIA1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN000N
PRKDCHAMLAGPAPAUTONOMIC_GANGLIA1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN000N
PRKDCHVHWRENCRAUTONOMIC_GANGLIA1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48CHP212Y690N
PRKDCHVHWRENCRAUTONOMIC_GANGLIA1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48IMR32Y690N
PRKDCHVHWRENCRAUTONOMIC_GANGLIA1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48KELLYY690N
PRKDCHVHWRENCRAUTONOMIC_GANGLIA1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48KPNRTBM1Y690N
PRKDCHVHWRENCRAUTONOMIC_GANGLIA1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48KPNSI9SY690N
PRKDCHVHWRENCRAUTONOMIC_GANGLIA1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48KPNYNY690N
PRKDCHVHWRENCRAUTONOMIC_GANGLIA1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48MHHNB11Y690N
PRKDCHVHWRENCRAUTONOMIC_GANGLIA1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48NB1Y690N
PRKDCHVHWRENCRAUTONOMIC_GANGLIA1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48NH6Y690N
PRKDCHVHWRENCRAUTONOMIC_GANGLIA1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SHSY5YY690N
PRKDCHVHWRENCRAUTONOMIC_GANGLIA1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SIMAY690N
PRKDCHVHWRENCRAUTONOMIC_GANGLIA1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKNASY690N
PRKDCHVHWRENCRAUTONOMIC_GANGLIA1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKNDZY690N
PRKDCHVHWRENCRAUTONOMIC_GANGLIA1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKNFIY690N
PRKDCHVHWRENCRAUTONOMIC_GANGLIA1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKNSHY690N
PRKDCHWRENCRSAAUTONOMIC_GANGLIA1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48CHP212N100N
PRKDCHWRENCRSAAUTONOMIC_GANGLIA1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48IMR32N100N
PRKDCHWRENCRSAAUTONOMIC_GANGLIA1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48KELLYN100N
PRKDCHWRENCRSAAUTONOMIC_GANGLIA1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48KPNRTBM1N100N
PRKDCHWRENCRSAAUTONOMIC_GANGLIA1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48KPNSI9SN100N
PRKDCHWRENCRSAAUTONOMIC_GANGLIA1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48KPNYNN100N
PRKDCHWRENCRSAAUTONOMIC_GANGLIA1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48MHHNB11N100N
PRKDCHWRENCRSAAUTONOMIC_GANGLIA1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48NB1N100N
PRKDCHWRENCRSAAUTONOMIC_GANGLIA1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48NH6N100N
PRKDCHWRENCRSAAUTONOMIC_GANGLIA1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SHSY5YN100N
PRKDCHWRENCRSAAUTONOMIC_GANGLIA1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SIMAN100N
PRKDCHWRENCRSAAUTONOMIC_GANGLIA1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKNASN100N
PRKDCHWRENCRSAAUTONOMIC_GANGLIA1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKNDZN100N
PRKDCHWRENCRSAAUTONOMIC_GANGLIA1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKNFIN100N
PRKDCHWRENCRSAAUTONOMIC_GANGLIA1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKNSHN100N
PRKDCIQPAGHAMLAUTONOMIC_GANGLIA1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N1400N
PRKDCIQPAGHAMLAUTONOMIC_GANGLIA1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N1400N
PRKDCIQPAGHAMLAUTONOMIC_GANGLIA1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN1400N
PRKDCIQPAGHAMLAUTONOMIC_GANGLIA1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N1400N
PRKDCIQPAGHAMLAUTONOMIC_GANGLIA1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN1400N
PRKDCIQPAGHAMLAUTONOMIC_GANGLIA1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN1400N
PRKDCIQPAGHAMLAUTONOMIC_GANGLIA1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N1400N
PRKDCIQPAGHAMLAUTONOMIC_GANGLIA1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N1400N
PRKDCIQPAGHAMLAUTONOMIC_GANGLIA1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N1400N
PRKDCIQPAGHAMLAUTONOMIC_GANGLIA1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN1400N
PRKDCIQPAGHAMLAUTONOMIC_GANGLIA1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN1400N
PRKDCIQPAGHAMLAUTONOMIC_GANGLIA1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN1400N
PRKDCIQPAGHAMLAUTONOMIC_GANGLIA1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN1400N
PRKDCIQPAGHAMLAUTONOMIC_GANGLIA1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN1400N
PRKDCIQPAGHAMLAUTONOMIC_GANGLIA1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN1400N
PRKDCLAGPAPGRVAUTONOMIC_GANGLIA1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48CHP212N500N
PRKDCLAGPAPGRVAUTONOMIC_GANGLIA1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48IMR32N500N
PRKDCLAGPAPGRVAUTONOMIC_GANGLIA1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KELLYN500N
PRKDCLAGPAPGRVAUTONOMIC_GANGLIA1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KPNRTBM1N500N
PRKDCLAGPAPGRVAUTONOMIC_GANGLIA1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KPNSI9SN500N
PRKDCLAGPAPGRVAUTONOMIC_GANGLIA1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KPNYNN500N
PRKDCLAGPAPGRVAUTONOMIC_GANGLIA1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48MHHNB11N500N
PRKDCLAGPAPGRVAUTONOMIC_GANGLIA1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48NB1N500N
PRKDCLAGPAPGRVAUTONOMIC_GANGLIA1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48NH6N500N
PRKDCLAGPAPGRVAUTONOMIC_GANGLIA1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SHSY5YN500N
PRKDCLAGPAPGRVAUTONOMIC_GANGLIA1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SIMAN500N
PRKDCLAGPAPGRVAUTONOMIC_GANGLIA1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNASN500N
PRKDCLAGPAPGRVAUTONOMIC_GANGLIA1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNDZN500N
PRKDCLAGPAPGRVAUTONOMIC_GANGLIA1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNFIN500N
PRKDCLAGPAPGRVAUTONOMIC_GANGLIA1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNSHN500N
PRKDCLAQPTLLYPAUTONOMIC_GANGLIA1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48CHP212N000N
PRKDCLAQPTLLYPAUTONOMIC_GANGLIA1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48IMR32N000N
PRKDCLAQPTLLYPAUTONOMIC_GANGLIA1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48KELLYN000N
PRKDCLAQPTLLYPAUTONOMIC_GANGLIA1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48KPNRTBM1N000N
PRKDCLAQPTLLYPAUTONOMIC_GANGLIA1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48KPNSI9SN000N
PRKDCLAQPTLLYPAUTONOMIC_GANGLIA1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48KPNYNN000N
PRKDCLAQPTLLYPAUTONOMIC_GANGLIA1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48MHHNB11N000N
PRKDCLAQPTLLYPAUTONOMIC_GANGLIA1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48NB1N000N
PRKDCLAQPTLLYPAUTONOMIC_GANGLIA1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48NH6N000N
PRKDCLAQPTLLYPAUTONOMIC_GANGLIA1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SHSY5YN000N
PRKDCLAQPTLLYPAUTONOMIC_GANGLIA1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SIMAN000N
PRKDCLAQPTLLYPAUTONOMIC_GANGLIA1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SKNASN000N
PRKDCLAQPTLLYPAUTONOMIC_GANGLIA1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SKNDZN000N
PRKDCLAQPTLLYPAUTONOMIC_GANGLIA1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SKNFIN000N
PRKDCLAQPTLLYPAUTONOMIC_GANGLIA1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SKNSHN000N
PRKDCLLYPSGAIQAUTONOMIC_GANGLIA1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N100N
PRKDCLLYPSGAIQAUTONOMIC_GANGLIA1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N100N
PRKDCLLYPSGAIQAUTONOMIC_GANGLIA1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN100N
PRKDCLLYPSGAIQAUTONOMIC_GANGLIA1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N100N
PRKDCLLYPSGAIQAUTONOMIC_GANGLIA1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN100N
PRKDCLLYPSGAIQAUTONOMIC_GANGLIA1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN100N
PRKDCLLYPSGAIQAUTONOMIC_GANGLIA1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N100N
PRKDCLLYPSGAIQAUTONOMIC_GANGLIA1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N100N
PRKDCLLYPSGAIQAUTONOMIC_GANGLIA1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N100N
PRKDCLLYPSGAIQAUTONOMIC_GANGLIA1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN100N
PRKDCLLYPSGAIQAUTONOMIC_GANGLIA1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN100N
PRKDCLLYPSGAIQAUTONOMIC_GANGLIA1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN100N
PRKDCLLYPSGAIQAUTONOMIC_GANGLIA1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN100N
PRKDCLLYPSGAIQAUTONOMIC_GANGLIA1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN100N
PRKDCLLYPSGAIQAUTONOMIC_GANGLIA1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN100N
PRKDCLQHVHWRENAUTONOMIC_GANGLIA1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N000N
PRKDCLQHVHWRENAUTONOMIC_GANGLIA1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N000N
PRKDCLQHVHWRENAUTONOMIC_GANGLIA1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN000N
PRKDCLQHVHWRENAUTONOMIC_GANGLIA1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N000N
PRKDCLQHVHWRENAUTONOMIC_GANGLIA1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN000N
PRKDCLQHVHWRENAUTONOMIC_GANGLIA1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN000N
PRKDCLQHVHWRENAUTONOMIC_GANGLIA1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N000N
PRKDCLQHVHWRENAUTONOMIC_GANGLIA1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N000N
PRKDCLQHVHWRENAUTONOMIC_GANGLIA1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N000N
PRKDCLQHVHWRENAUTONOMIC_GANGLIA1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN000N
PRKDCLQHVHWRENAUTONOMIC_GANGLIA1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN000N
PRKDCLQHVHWRENAUTONOMIC_GANGLIA1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN000N
PRKDCLQHVHWRENAUTONOMIC_GANGLIA1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN000N
PRKDCLQHVHWRENAUTONOMIC_GANGLIA1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN000N
PRKDCLQHVHWRENAUTONOMIC_GANGLIA1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN000N
PRKDCLYPSGAIQPAUTONOMIC_GANGLIA1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N000N
PRKDCLYPSGAIQPAUTONOMIC_GANGLIA1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N000N
PRKDCLYPSGAIQPAUTONOMIC_GANGLIA1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN000N
PRKDCLYPSGAIQPAUTONOMIC_GANGLIA1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N000N
PRKDCLYPSGAIQPAUTONOMIC_GANGLIA1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN000N
PRKDCLYPSGAIQPAUTONOMIC_GANGLIA1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN000N
PRKDCLYPSGAIQPAUTONOMIC_GANGLIA1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N000N
PRKDCLYPSGAIQPAUTONOMIC_GANGLIA1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N000N
PRKDCLYPSGAIQPAUTONOMIC_GANGLIA1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N000N
PRKDCLYPSGAIQPAUTONOMIC_GANGLIA1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN000N
PRKDCLYPSGAIQPAUTONOMIC_GANGLIA1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN000N
PRKDCLYPSGAIQPAUTONOMIC_GANGLIA1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN000N
PRKDCLYPSGAIQPAUTONOMIC_GANGLIA1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN000N
PRKDCLYPSGAIQPAUTONOMIC_GANGLIA1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN000N
PRKDCLYPSGAIQPAUTONOMIC_GANGLIA1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN000N
PRKDCMLAGPAPGRAUTONOMIC_GANGLIA1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N500N
PRKDCMLAGPAPGRAUTONOMIC_GANGLIA1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N500N
PRKDCMLAGPAPGRAUTONOMIC_GANGLIA1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN500N
PRKDCMLAGPAPGRAUTONOMIC_GANGLIA1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N500N
PRKDCMLAGPAPGRAUTONOMIC_GANGLIA1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN500N
PRKDCMLAGPAPGRAUTONOMIC_GANGLIA1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN500N
PRKDCMLAGPAPGRAUTONOMIC_GANGLIA1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N500N
PRKDCMLAGPAPGRAUTONOMIC_GANGLIA1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N500N
PRKDCMLAGPAPGRAUTONOMIC_GANGLIA1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N500N
PRKDCMLAGPAPGRAUTONOMIC_GANGLIA1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN500N
PRKDCMLAGPAPGRAUTONOMIC_GANGLIA1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN500N
PRKDCMLAGPAPGRAUTONOMIC_GANGLIA1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN500N
PRKDCMLAGPAPGRAUTONOMIC_GANGLIA1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN500N
PRKDCMLAGPAPGRAUTONOMIC_GANGLIA1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN500N
PRKDCMLAGPAPGRAUTONOMIC_GANGLIA1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN500N
PRKDCNCRSAPGPRAUTONOMIC_GANGLIA1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N300N
PRKDCNCRSAPGPRAUTONOMIC_GANGLIA1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N300N
PRKDCNCRSAPGPRAUTONOMIC_GANGLIA1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN300N
PRKDCNCRSAPGPRAUTONOMIC_GANGLIA1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N300N
PRKDCNCRSAPGPRAUTONOMIC_GANGLIA1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN300N
PRKDCNCRSAPGPRAUTONOMIC_GANGLIA1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN300N
PRKDCNCRSAPGPRAUTONOMIC_GANGLIA1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N300N
PRKDCNCRSAPGPRAUTONOMIC_GANGLIA1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N300N
PRKDCNCRSAPGPRAUTONOMIC_GANGLIA1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N300N
PRKDCNCRSAPGPRAUTONOMIC_GANGLIA1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN300N
PRKDCNCRSAPGPRAUTONOMIC_GANGLIA1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN300N
PRKDCNCRSAPGPRAUTONOMIC_GANGLIA1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN300N
PRKDCNCRSAPGPRAUTONOMIC_GANGLIA1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN300N
PRKDCNCRSAPGPRAUTONOMIC_GANGLIA1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN300N
PRKDCNCRSAPGPRAUTONOMIC_GANGLIA1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN300N
PRKDCPAGHAMLAGAUTONOMIC_GANGLIA1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N000N
PRKDCPAGHAMLAGAUTONOMIC_GANGLIA1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N000N
PRKDCPAGHAMLAGAUTONOMIC_GANGLIA1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN000N
PRKDCPAGHAMLAGAUTONOMIC_GANGLIA1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N000N
PRKDCPAGHAMLAGAUTONOMIC_GANGLIA1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN000N
PRKDCPAGHAMLAGAUTONOMIC_GANGLIA1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN000N
PRKDCPAGHAMLAGAUTONOMIC_GANGLIA1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N000N
PRKDCPAGHAMLAGAUTONOMIC_GANGLIA1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N000N
PRKDCPAGHAMLAGAUTONOMIC_GANGLIA1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N000N
PRKDCPAGHAMLAGAUTONOMIC_GANGLIA1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN000N
PRKDCPAGHAMLAGAUTONOMIC_GANGLIA1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN000N
PRKDCPAGHAMLAGAUTONOMIC_GANGLIA1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN000N
PRKDCPAGHAMLAGAUTONOMIC_GANGLIA1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN000N
PRKDCPAGHAMLAGAUTONOMIC_GANGLIA1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN000N
PRKDCPAGHAMLAGAUTONOMIC_GANGLIA1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN000N
PRKDCPAPGRVGVLAUTONOMIC_GANGLIA1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N400N
PRKDCPAPGRVGVLAUTONOMIC_GANGLIA1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N400N
PRKDCPAPGRVGVLAUTONOMIC_GANGLIA1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN400N
PRKDCPAPGRVGVLAUTONOMIC_GANGLIA1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N400N
PRKDCPAPGRVGVLAUTONOMIC_GANGLIA1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN400N
PRKDCPAPGRVGVLAUTONOMIC_GANGLIA1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN400N
PRKDCPAPGRVGVLAUTONOMIC_GANGLIA1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N400N
PRKDCPAPGRVGVLAUTONOMIC_GANGLIA1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N400N
PRKDCPAPGRVGVLAUTONOMIC_GANGLIA1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N400N
PRKDCPAPGRVGVLAUTONOMIC_GANGLIA1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN400N
PRKDCPAPGRVGVLAUTONOMIC_GANGLIA1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN400N
PRKDCPAPGRVGVLAUTONOMIC_GANGLIA1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN400N
PRKDCPAPGRVGVLAUTONOMIC_GANGLIA1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN400N
PRKDCPAPGRVGVLAUTONOMIC_GANGLIA1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN400N
PRKDCPAPGRVGVLAUTONOMIC_GANGLIA1259p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN400N
PRKDCPGRVGVLQHAUTONOMIC_GANGLIA1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N000N
PRKDCPGRVGVLQHAUTONOMIC_GANGLIA1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N000N
PRKDCPGRVGVLQHAUTONOMIC_GANGLIA1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN000N
PRKDCPGRVGVLQHAUTONOMIC_GANGLIA1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N000N
PRKDCPGRVGVLQHAUTONOMIC_GANGLIA1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN000N
PRKDCPGRVGVLQHAUTONOMIC_GANGLIA1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN000N
PRKDCPGRVGVLQHAUTONOMIC_GANGLIA1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N000N
PRKDCPGRVGVLQHAUTONOMIC_GANGLIA1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N000N
PRKDCPGRVGVLQHAUTONOMIC_GANGLIA1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N000N
PRKDCPGRVGVLQHAUTONOMIC_GANGLIA1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN000N
PRKDCPGRVGVLQHAUTONOMIC_GANGLIA1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN000N
PRKDCPGRVGVLQHAUTONOMIC_GANGLIA1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN000N
PRKDCPGRVGVLQHAUTONOMIC_GANGLIA1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN000N
PRKDCPGRVGVLQHAUTONOMIC_GANGLIA1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN000N
PRKDCPGRVGVLQHAUTONOMIC_GANGLIA1261p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN000N
PRKDCPSGAIQPAGAUTONOMIC_GANGLIA1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N000N
PRKDCPSGAIQPAGAUTONOMIC_GANGLIA1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N000N
PRKDCPSGAIQPAGAUTONOMIC_GANGLIA1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN000N
PRKDCPSGAIQPAGAUTONOMIC_GANGLIA1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N000N
PRKDCPSGAIQPAGAUTONOMIC_GANGLIA1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN000N
PRKDCPSGAIQPAGAUTONOMIC_GANGLIA1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN000N
PRKDCPSGAIQPAGAUTONOMIC_GANGLIA1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N000N
PRKDCPSGAIQPAGAUTONOMIC_GANGLIA1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N000N
PRKDCPSGAIQPAGAUTONOMIC_GANGLIA1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N000N
PRKDCPSGAIQPAGAUTONOMIC_GANGLIA1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN000N
PRKDCPSGAIQPAGAUTONOMIC_GANGLIA1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN000N
PRKDCPSGAIQPAGAUTONOMIC_GANGLIA1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN000N
PRKDCPSGAIQPAGAUTONOMIC_GANGLIA1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN000N
PRKDCPSGAIQPAGAUTONOMIC_GANGLIA1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN000N
PRKDCPSGAIQPAGAUTONOMIC_GANGLIA1244p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN000N
PRKDCPTLLYPSGAAUTONOMIC_GANGLIA1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48CHP212N100N
PRKDCPTLLYPSGAAUTONOMIC_GANGLIA1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48IMR32N100N
PRKDCPTLLYPSGAAUTONOMIC_GANGLIA1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48KELLYN100N
PRKDCPTLLYPSGAAUTONOMIC_GANGLIA1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48KPNRTBM1N100N
PRKDCPTLLYPSGAAUTONOMIC_GANGLIA1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48KPNSI9SN100N
PRKDCPTLLYPSGAAUTONOMIC_GANGLIA1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48KPNYNN100N
PRKDCPTLLYPSGAAUTONOMIC_GANGLIA1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48MHHNB11N100N
PRKDCPTLLYPSGAAUTONOMIC_GANGLIA1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48NB1N100N
PRKDCPTLLYPSGAAUTONOMIC_GANGLIA1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48NH6N100N
PRKDCPTLLYPSGAAUTONOMIC_GANGLIA1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48SHSY5YN100N
PRKDCPTLLYPSGAAUTONOMIC_GANGLIA1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48SIMAN100N
PRKDCPTLLYPSGAAUTONOMIC_GANGLIA1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48SKNASN100N
PRKDCPTLLYPSGAAUTONOMIC_GANGLIA1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48SKNDZN100N
PRKDCPTLLYPSGAAUTONOMIC_GANGLIA1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48SKNFIN100N
PRKDCPTLLYPSGAAUTONOMIC_GANGLIA1239p.L1244fsc.3730_3731insCFrame_Shift_Ins392.48SKNSHN100N
PRKDCQHVHWRENCAUTONOMIC_GANGLIA1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N100N
PRKDCQHVHWRENCAUTONOMIC_GANGLIA1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N100N
PRKDCQHVHWRENCAUTONOMIC_GANGLIA1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN100N
PRKDCQHVHWRENCAUTONOMIC_GANGLIA1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N100N
PRKDCQHVHWRENCAUTONOMIC_GANGLIA1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN100N
PRKDCQHVHWRENCAUTONOMIC_GANGLIA1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN100N
PRKDCQHVHWRENCAUTONOMIC_GANGLIA1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N100N
PRKDCQHVHWRENCAUTONOMIC_GANGLIA1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N100N
PRKDCQHVHWRENCAUTONOMIC_GANGLIA1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N100N
PRKDCQHVHWRENCAUTONOMIC_GANGLIA1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN100N
PRKDCQHVHWRENCAUTONOMIC_GANGLIA1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN100N
PRKDCQHVHWRENCAUTONOMIC_GANGLIA1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN100N
PRKDCQHVHWRENCAUTONOMIC_GANGLIA1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN100N
PRKDCQHVHWRENCAUTONOMIC_GANGLIA1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN100N
PRKDCQHVHWRENCAUTONOMIC_GANGLIA1268p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN100N
PRKDCQPAGHAMLAAUTONOMIC_GANGLIA1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N800N
PRKDCQPAGHAMLAAUTONOMIC_GANGLIA1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N800N
PRKDCQPAGHAMLAAUTONOMIC_GANGLIA1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN800N
PRKDCQPAGHAMLAAUTONOMIC_GANGLIA1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N800N
PRKDCQPAGHAMLAAUTONOMIC_GANGLIA1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN800N
PRKDCQPAGHAMLAAUTONOMIC_GANGLIA1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN800N
PRKDCQPAGHAMLAAUTONOMIC_GANGLIA1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N800N
PRKDCQPAGHAMLAAUTONOMIC_GANGLIA1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N800N
PRKDCQPAGHAMLAAUTONOMIC_GANGLIA1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N800N
PRKDCQPAGHAMLAAUTONOMIC_GANGLIA1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN800N
PRKDCQPAGHAMLAAUTONOMIC_GANGLIA1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN800N
PRKDCQPAGHAMLAAUTONOMIC_GANGLIA1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN800N
PRKDCQPAGHAMLAAUTONOMIC_GANGLIA1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN800N
PRKDCQPAGHAMLAAUTONOMIC_GANGLIA1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN800N
PRKDCQPAGHAMLAAUTONOMIC_GANGLIA1249p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN800N
PRKDCQPTLLYPSGAUTONOMIC_GANGLIA1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48CHP212N000N
PRKDCQPTLLYPSGAUTONOMIC_GANGLIA1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48IMR32N000N
PRKDCQPTLLYPSGAUTONOMIC_GANGLIA1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48KELLYN000N
PRKDCQPTLLYPSGAUTONOMIC_GANGLIA1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48KPNRTBM1N000N
PRKDCQPTLLYPSGAUTONOMIC_GANGLIA1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48KPNSI9SN000N
PRKDCQPTLLYPSGAUTONOMIC_GANGLIA1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48KPNYNN000N
PRKDCQPTLLYPSGAUTONOMIC_GANGLIA1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48MHHNB11N000N
PRKDCQPTLLYPSGAUTONOMIC_GANGLIA1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48NB1N000N
PRKDCQPTLLYPSGAUTONOMIC_GANGLIA1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48NH6N000N
PRKDCQPTLLYPSGAUTONOMIC_GANGLIA1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SHSY5YN000N
PRKDCQPTLLYPSGAUTONOMIC_GANGLIA1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SIMAN000N
PRKDCQPTLLYPSGAUTONOMIC_GANGLIA1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SKNASN000N
PRKDCQPTLLYPSGAUTONOMIC_GANGLIA1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SKNDZN000N
PRKDCQPTLLYPSGAUTONOMIC_GANGLIA1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SKNFIN000N
PRKDCQPTLLYPSGAUTONOMIC_GANGLIA1238p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SKNSHN000N
PRKDCRENCRSAPGAUTONOMIC_GANGLIA1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48CHP212N100N
PRKDCRENCRSAPGAUTONOMIC_GANGLIA1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48IMR32N100N
PRKDCRENCRSAPGAUTONOMIC_GANGLIA1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KELLYN100N
PRKDCRENCRSAPGAUTONOMIC_GANGLIA1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KPNRTBM1N100N
PRKDCRENCRSAPGAUTONOMIC_GANGLIA1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KPNSI9SN100N
PRKDCRENCRSAPGAUTONOMIC_GANGLIA1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KPNYNN100N
PRKDCRENCRSAPGAUTONOMIC_GANGLIA1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48MHHNB11N100N
PRKDCRENCRSAPGAUTONOMIC_GANGLIA1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48NB1N100N
PRKDCRENCRSAPGAUTONOMIC_GANGLIA1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48NH6N100N
PRKDCRENCRSAPGAUTONOMIC_GANGLIA1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SHSY5YN100N
PRKDCRENCRSAPGAUTONOMIC_GANGLIA1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SIMAN100N
PRKDCRENCRSAPGAUTONOMIC_GANGLIA1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNASN100N
PRKDCRENCRSAPGAUTONOMIC_GANGLIA1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNDZN100N
PRKDCRENCRSAPGAUTONOMIC_GANGLIA1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNFIN100N
PRKDCRENCRSAPGAUTONOMIC_GANGLIA1273p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNSHN100N
PRKDCRVGVLQHVHAUTONOMIC_GANGLIA1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N100N
PRKDCRVGVLQHVHAUTONOMIC_GANGLIA1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N100N
PRKDCRVGVLQHVHAUTONOMIC_GANGLIA1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN100N
PRKDCRVGVLQHVHAUTONOMIC_GANGLIA1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N100N
PRKDCRVGVLQHVHAUTONOMIC_GANGLIA1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN100N
PRKDCRVGVLQHVHAUTONOMIC_GANGLIA1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN100N
PRKDCRVGVLQHVHAUTONOMIC_GANGLIA1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N100N
PRKDCRVGVLQHVHAUTONOMIC_GANGLIA1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N100N
PRKDCRVGVLQHVHAUTONOMIC_GANGLIA1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N100N
PRKDCRVGVLQHVHAUTONOMIC_GANGLIA1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN100N
PRKDCRVGVLQHVHAUTONOMIC_GANGLIA1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN100N
PRKDCRVGVLQHVHAUTONOMIC_GANGLIA1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN100N
PRKDCRVGVLQHVHAUTONOMIC_GANGLIA1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN100N
PRKDCRVGVLQHVHAUTONOMIC_GANGLIA1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN100N
PRKDCRVGVLQHVHAUTONOMIC_GANGLIA1263p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN100N
PRKDCSGAIQPAGHAUTONOMIC_GANGLIA1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N000N
PRKDCSGAIQPAGHAUTONOMIC_GANGLIA1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N000N
PRKDCSGAIQPAGHAUTONOMIC_GANGLIA1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN000N
PRKDCSGAIQPAGHAUTONOMIC_GANGLIA1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N000N
PRKDCSGAIQPAGHAUTONOMIC_GANGLIA1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN000N
PRKDCSGAIQPAGHAUTONOMIC_GANGLIA1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN000N
PRKDCSGAIQPAGHAUTONOMIC_GANGLIA1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N000N
PRKDCSGAIQPAGHAUTONOMIC_GANGLIA1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N000N
PRKDCSGAIQPAGHAUTONOMIC_GANGLIA1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N000N
PRKDCSGAIQPAGHAUTONOMIC_GANGLIA1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN000N
PRKDCSGAIQPAGHAUTONOMIC_GANGLIA1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN000N
PRKDCSGAIQPAGHAUTONOMIC_GANGLIA1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN000N
PRKDCSGAIQPAGHAUTONOMIC_GANGLIA1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN000N
PRKDCSGAIQPAGHAUTONOMIC_GANGLIA1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN000N
PRKDCSGAIQPAGHAUTONOMIC_GANGLIA1245p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN000N
PRKDCTLLYPSGAIAUTONOMIC_GANGLIA1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48CHP212N1000N
PRKDCTLLYPSGAIAUTONOMIC_GANGLIA1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48IMR32N1000N
PRKDCTLLYPSGAIAUTONOMIC_GANGLIA1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KELLYN1000N
PRKDCTLLYPSGAIAUTONOMIC_GANGLIA1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KPNRTBM1N1000N
PRKDCTLLYPSGAIAUTONOMIC_GANGLIA1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KPNSI9SN1000N
PRKDCTLLYPSGAIAUTONOMIC_GANGLIA1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KPNYNN1000N
PRKDCTLLYPSGAIAUTONOMIC_GANGLIA1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48MHHNB11N1000N
PRKDCTLLYPSGAIAUTONOMIC_GANGLIA1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48NB1N1000N
PRKDCTLLYPSGAIAUTONOMIC_GANGLIA1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48NH6N1000N
PRKDCTLLYPSGAIAUTONOMIC_GANGLIA1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SHSY5YN1000N
PRKDCTLLYPSGAIAUTONOMIC_GANGLIA1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SIMAN1000N
PRKDCTLLYPSGAIAUTONOMIC_GANGLIA1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNASN1000N
PRKDCTLLYPSGAIAUTONOMIC_GANGLIA1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNDZN1000N
PRKDCTLLYPSGAIAUTONOMIC_GANGLIA1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNFIN1000N
PRKDCTLLYPSGAIAUTONOMIC_GANGLIA1240p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNSHN1000N
PRKDCVGVLQHVHWAUTONOMIC_GANGLIA1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N400N
PRKDCVGVLQHVHWAUTONOMIC_GANGLIA1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N400N
PRKDCVGVLQHVHWAUTONOMIC_GANGLIA1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN400N
PRKDCVGVLQHVHWAUTONOMIC_GANGLIA1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N400N
PRKDCVGVLQHVHWAUTONOMIC_GANGLIA1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN400N
PRKDCVGVLQHVHWAUTONOMIC_GANGLIA1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN400N
PRKDCVGVLQHVHWAUTONOMIC_GANGLIA1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N400N
PRKDCVGVLQHVHWAUTONOMIC_GANGLIA1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N400N
PRKDCVGVLQHVHWAUTONOMIC_GANGLIA1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N400N
PRKDCVGVLQHVHWAUTONOMIC_GANGLIA1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN400N
PRKDCVGVLQHVHWAUTONOMIC_GANGLIA1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN400N
PRKDCVGVLQHVHWAUTONOMIC_GANGLIA1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN400N
PRKDCVGVLQHVHWAUTONOMIC_GANGLIA1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN400N
PRKDCVGVLQHVHWAUTONOMIC_GANGLIA1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN400N
PRKDCVGVLQHVHWAUTONOMIC_GANGLIA1264p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN400N
PRKDCVHWRENCRSAUTONOMIC_GANGLIA1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N106N
PRKDCVHWRENCRSAUTONOMIC_GANGLIA1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N106N
PRKDCVHWRENCRSAUTONOMIC_GANGLIA1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN106N
PRKDCVHWRENCRSAUTONOMIC_GANGLIA1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N106N
PRKDCVHWRENCRSAUTONOMIC_GANGLIA1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN106N
PRKDCVHWRENCRSAUTONOMIC_GANGLIA1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN106N
PRKDCVHWRENCRSAUTONOMIC_GANGLIA1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N106N
PRKDCVHWRENCRSAUTONOMIC_GANGLIA1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N106N
PRKDCVHWRENCRSAUTONOMIC_GANGLIA1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N106N
PRKDCVHWRENCRSAUTONOMIC_GANGLIA1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN106N
PRKDCVHWRENCRSAUTONOMIC_GANGLIA1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN106N
PRKDCVHWRENCRSAUTONOMIC_GANGLIA1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN106N
PRKDCVHWRENCRSAUTONOMIC_GANGLIA1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN106N
PRKDCVHWRENCRSAUTONOMIC_GANGLIA1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN106N
PRKDCVHWRENCRSAUTONOMIC_GANGLIA1270p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN106N
PRKDCVLQHVHWREAUTONOMIC_GANGLIA1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N001N
PRKDCVLQHVHWREAUTONOMIC_GANGLIA1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N001N
PRKDCVLQHVHWREAUTONOMIC_GANGLIA1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN001N
PRKDCVLQHVHWREAUTONOMIC_GANGLIA1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N001N
PRKDCVLQHVHWREAUTONOMIC_GANGLIA1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN001N
PRKDCVLQHVHWREAUTONOMIC_GANGLIA1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN001N
PRKDCVLQHVHWREAUTONOMIC_GANGLIA1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N001N
PRKDCVLQHVHWREAUTONOMIC_GANGLIA1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N001N
PRKDCVLQHVHWREAUTONOMIC_GANGLIA1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N001N
PRKDCVLQHVHWREAUTONOMIC_GANGLIA1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN001N
PRKDCVLQHVHWREAUTONOMIC_GANGLIA1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN001N
PRKDCVLQHVHWREAUTONOMIC_GANGLIA1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN001N
PRKDCVLQHVHWREAUTONOMIC_GANGLIA1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN001N
PRKDCVLQHVHWREAUTONOMIC_GANGLIA1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN001N
PRKDCVLQHVHWREAUTONOMIC_GANGLIA1266p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN001N
PRKDCWRENCRSAPAUTONOMIC_GANGLIA1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212N300N
PRKDCWRENCRSAPAUTONOMIC_GANGLIA1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32N300N
PRKDCWRENCRSAPAUTONOMIC_GANGLIA1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYN300N
PRKDCWRENCRSAPAUTONOMIC_GANGLIA1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1N300N
PRKDCWRENCRSAPAUTONOMIC_GANGLIA1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SN300N
PRKDCWRENCRSAPAUTONOMIC_GANGLIA1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNN300N
PRKDCWRENCRSAPAUTONOMIC_GANGLIA1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11N300N
PRKDCWRENCRSAPAUTONOMIC_GANGLIA1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1N300N
PRKDCWRENCRSAPAUTONOMIC_GANGLIA1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6N300N
PRKDCWRENCRSAPAUTONOMIC_GANGLIA1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YN300N
PRKDCWRENCRSAPAUTONOMIC_GANGLIA1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAN300N
PRKDCWRENCRSAPAUTONOMIC_GANGLIA1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASN300N
PRKDCWRENCRSAPAUTONOMIC_GANGLIA1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZN300N
PRKDCWRENCRSAPAUTONOMIC_GANGLIA1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIN300N
PRKDCWRENCRSAPAUTONOMIC_GANGLIA1272p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHN300N
PRKDCYPSGAIQPAAUTONOMIC_GANGLIA1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CHP212Y990N
PRKDCYPSGAIQPAAUTONOMIC_GANGLIA1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48IMR32Y990N
PRKDCYPSGAIQPAAUTONOMIC_GANGLIA1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KELLYY990N
PRKDCYPSGAIQPAAUTONOMIC_GANGLIA1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNRTBM1Y990N
PRKDCYPSGAIQPAAUTONOMIC_GANGLIA1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNSI9SY990N
PRKDCYPSGAIQPAAUTONOMIC_GANGLIA1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KPNYNY990N
PRKDCYPSGAIQPAAUTONOMIC_GANGLIA1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHNB11Y990N
PRKDCYPSGAIQPAAUTONOMIC_GANGLIA1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NB1Y990N
PRKDCYPSGAIQPAAUTONOMIC_GANGLIA1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48NH6Y990N
PRKDCYPSGAIQPAAUTONOMIC_GANGLIA1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SHSY5YY990N
PRKDCYPSGAIQPAAUTONOMIC_GANGLIA1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SIMAY990N
PRKDCYPSGAIQPAAUTONOMIC_GANGLIA1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNASY990N
PRKDCYPSGAIQPAAUTONOMIC_GANGLIA1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNDZY990N
PRKDCYPSGAIQPAAUTONOMIC_GANGLIA1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNFIY990N
PRKDCYPSGAIQPAAUTONOMIC_GANGLIA1243p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNSHY990N
PRKDCGPPQEEDSVAUTONOMIC_GANGLIA2109p.G2113delc.6338_6340delGAGIn_Frame_Del30.66KPNSI9SN1300N
PRKDCHRSLGPPQEAUTONOMIC_GANGLIA2105p.G2113delc.6338_6340delGAGIn_Frame_Del10.66KPNSI9SN100N
PRKDCLGPPQEEDSAUTONOMIC_GANGLIA2108p.G2113delc.6338_6340delGAGIn_Frame_Del30.66KPNSI9SN100N
PRKDCPPQEEDSVPAUTONOMIC_GANGLIA2110p.G2113delc.6338_6340delGAGIn_Frame_Del20.66KPNSI9SN000N
PRKDCPQEEDSVPRAUTONOMIC_GANGLIA2111p.G2113delc.6338_6340delGAGIn_Frame_Del20.66KPNSI9SN000N
PRKDCQEEDSVPRDAUTONOMIC_GANGLIA2112p.G2113delc.6338_6340delGAGIn_Frame_Del10.66KPNSI9SN000N
PRKDCRSLGPPQEEAUTONOMIC_GANGLIA2106p.G2113delc.6338_6340delGAGIn_Frame_Del10.66KPNSI9SN000N
PRKDCSLGPPQEEDAUTONOMIC_GANGLIA2107p.G2113delc.6338_6340delGAGIn_Frame_Del20.66KPNSI9SN000N
PRKDCACKQLYRAGAUTONOMIC_GANGLIA1454p.H1459Yc.4375C>TMissense_Mutation10.11SKNFIN000N
PRKDCCKQLYRAGLAUTONOMIC_GANGLIA1455p.H1459Yc.4375C>TMissense_Mutation10.11SKNFIN400N
PRKDCKQLYRAGLLAUTONOMIC_GANGLIA1456p.H1459Yc.4375C>TMissense_Mutation10.11SKNFIN1800N
PRKDCLYRAGLLHNAUTONOMIC_GANGLIA1458p.H1459Yc.4375C>TMissense_Mutation10.11SKNFIN103N
PRKDCQLYRAGLLHAUTONOMIC_GANGLIA1457p.H1459Yc.4375C>TMissense_Mutation10.11SKNFIN200N
PRKDCSACKQLYRAAUTONOMIC_GANGLIA1453p.H1459Yc.4375C>TMissense_Mutation10.11SKNFIN400N
PRKDCVSACKQLYRAUTONOMIC_GANGLIA1452p.H1459Yc.4375C>TMissense_Mutation10.11SKNFIY490N
PRKDCVVSACKQLYAUTONOMIC_GANGLIA1451p.H1459Yc.4375C>TMissense_Mutation10.11SKNFIN3017N
PRKDCYRAGLLHNIAUTONOMIC_GANGLIA1459p.H1459Yc.4375C>TMissense_Mutation10.11SKNFIY9126N
RB1FSKLPNDNIAUTONOMIC_GANGLIA473p.L477Pc.1430T>CMissense_Mutation10.11SKNASN900N
RB1IQNFSKLPNAUTONOMIC_GANGLIA470p.L477Pc.1430T>CMissense_Mutation10.11SKNASN0026N
RB1KLPNDNIFHAUTONOMIC_GANGLIA475p.L477Pc.1430T>CMissense_Mutation10.11SKNASN100N
RB1LPNDNIFHMAUTONOMIC_GANGLIA476p.L477Pc.1430T>CMissense_Mutation10.11SKNASY1294N
RB1NFSKLPNDNAUTONOMIC_GANGLIA472p.L477Pc.1430T>CMissense_Mutation10.11SKNASN000N
RB1PNDNIFHMSAUTONOMIC_GANGLIA477p.L477Pc.1430T>CMissense_Mutation10.11SKNASN000N
RB1QNFSKLPNDAUTONOMIC_GANGLIA471p.L477Pc.1430T>CMissense_Mutation10.11SKNASN000N
RB1SIQNFSKLPAUTONOMIC_GANGLIA469p.L477Pc.1430T>CMissense_Mutation10.11SKNASN000N
RB1SKLPNDNIFAUTONOMIC_GANGLIA474p.L477Pc.1430T>CMissense_Mutation10.11SKNASN500N
RECQL4ADMCTPTARAUTONOMIC_GANGLIA829p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N000N
RECQL4ADMCTPTARAUTONOMIC_GANGLIA829p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN000N
RECQL4ADMCTPTARAUTONOMIC_GANGLIA829p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN000N
RECQL4ADMCTPTARAUTONOMIC_GANGLIA829p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N000N
RECQL4ADMCTPTARAUTONOMIC_GANGLIA829p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN000N
RECQL4ADMCTPTARAUTONOMIC_GANGLIA829p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN000N
RECQL4ADMCTPTARAUTONOMIC_GANGLIA829p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN000N
RECQL4ADMCTPTARAUTONOMIC_GANGLIA829p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN000N
RECQL4ADMCTPTARAUTONOMIC_GANGLIA829p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN000N
RECQL4AFMQGQLGWAUTONOMIC_GANGLIA759p.R766fsc.2296_2296delCFrame_Shift_Del274.34CHP212N200N
RECQL4AFMQGQLGWAUTONOMIC_GANGLIA759p.R766fsc.2296_2296delCFrame_Shift_Del274.34KELLYN200N
RECQL4AFMQGQLGWAUTONOMIC_GANGLIA759p.R766fsc.2296_2296delCFrame_Shift_Del274.34KPNSI9SN200N
RECQL4AFMQGQLGWAUTONOMIC_GANGLIA759p.R766fsc.2296_2296delCFrame_Shift_Del274.34NH6N200N
RECQL4AFMQGQLGWAUTONOMIC_GANGLIA759p.R766fsc.2296_2296delCFrame_Shift_Del274.34SHSY5YN200N
RECQL4AFMQGQLGWAUTONOMIC_GANGLIA759p.R766fsc.2296_2296delCFrame_Shift_Del274.34SIMAN200N
RECQL4AFMQGQLGWAUTONOMIC_GANGLIA759p.R766fsc.2296_2296delCFrame_Shift_Del274.34SKNASN200N
RECQL4AFMQGQLGWAUTONOMIC_GANGLIA759p.R766fsc.2296_2296delCFrame_Shift_Del274.34SKNDZN200N
RECQL4AFMQGQLGWAUTONOMIC_GANGLIA759p.R766fsc.2296_2296delCFrame_Shift_Del274.34SKNFIN200N
RECQL4AGPGVTGSLAUTONOMIC_GANGLIA803p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N1200N
RECQL4AGPGVTGSLAUTONOMIC_GANGLIA803p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN1200N
RECQL4AGPGVTGSLAUTONOMIC_GANGLIA803p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN1200N
RECQL4AGPGVTGSLAUTONOMIC_GANGLIA803p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N1200N
RECQL4AGPGVTGSLAUTONOMIC_GANGLIA803p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN1200N
RECQL4AGPGVTGSLAUTONOMIC_GANGLIA803p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN1200N
RECQL4AGPGVTGSLAUTONOMIC_GANGLIA803p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN1200N
RECQL4AGPGVTGSLAUTONOMIC_GANGLIA803p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN1200N
RECQL4AGPGVTGSLAUTONOMIC_GANGLIA803p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN1200N
RECQL4AKTCESCADAUTONOMIC_GANGLIA822p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N000N
RECQL4AKTCESCADAUTONOMIC_GANGLIA822p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN000N
RECQL4AKTCESCADAUTONOMIC_GANGLIA822p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN000N
RECQL4AKTCESCADAUTONOMIC_GANGLIA822p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N000N
RECQL4AKTCESCADAUTONOMIC_GANGLIA822p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN000N
RECQL4AKTCESCADAUTONOMIC_GANGLIA822p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN000N
RECQL4AKTCESCADAUTONOMIC_GANGLIA822p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN000N
RECQL4AKTCESCADAUTONOMIC_GANGLIA822p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN000N
RECQL4AKTCESCADAUTONOMIC_GANGLIA822p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN000N
RECQL4ASRATCRPWAUTONOMIC_GANGLIA794p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212Y3110N
RECQL4ASRATCRPWAUTONOMIC_GANGLIA794p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYY3110N
RECQL4ASRATCRPWAUTONOMIC_GANGLIA794p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SY3110N
RECQL4ASRATCRPWAUTONOMIC_GANGLIA794p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6Y3110N
RECQL4ASRATCRPWAUTONOMIC_GANGLIA794p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YY3110N
RECQL4ASRATCRPWAUTONOMIC_GANGLIA794p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAY3110N
RECQL4ASRATCRPWAUTONOMIC_GANGLIA794p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASY3110N
RECQL4ASRATCRPWAUTONOMIC_GANGLIA794p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZY3110N
RECQL4ASRATCRPWAUTONOMIC_GANGLIA794p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIY3110N
RECQL4ATCRPWAGPAUTONOMIC_GANGLIA797p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N000N
RECQL4ATCRPWAGPAUTONOMIC_GANGLIA797p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN000N
RECQL4ATCRPWAGPAUTONOMIC_GANGLIA797p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN000N
RECQL4ATCRPWAGPAUTONOMIC_GANGLIA797p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N000N
RECQL4ATCRPWAGPAUTONOMIC_GANGLIA797p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN000N
RECQL4ATCRPWAGPAUTONOMIC_GANGLIA797p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN000N
RECQL4ATCRPWAGPAUTONOMIC_GANGLIA797p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN000N
RECQL4ATCRPWAGPAUTONOMIC_GANGLIA797p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN000N
RECQL4ATCRPWAGPAUTONOMIC_GANGLIA797p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN000N
RECQL4ATSSCSPRAAUTONOMIC_GANGLIA814p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N100Y
RECQL4ATSSCSPRAAUTONOMIC_GANGLIA814p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN100Y
RECQL4ATSSCSPRAAUTONOMIC_GANGLIA814p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN100Y
RECQL4ATSSCSPRAAUTONOMIC_GANGLIA814p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N100Y
RECQL4ATSSCSPRAAUTONOMIC_GANGLIA814p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN100Y
RECQL4ATSSCSPRAAUTONOMIC_GANGLIA814p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN100Y
RECQL4ATSSCSPRAAUTONOMIC_GANGLIA814p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN100Y
RECQL4ATSSCSPRAAUTONOMIC_GANGLIA814p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN100Y
RECQL4ATSSCSPRAAUTONOMIC_GANGLIA814p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN100Y
RECQL4CADMCTPTAAUTONOMIC_GANGLIA828p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N300N
RECQL4CADMCTPTAAUTONOMIC_GANGLIA828p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN300N
RECQL4CADMCTPTAAUTONOMIC_GANGLIA828p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN300N
RECQL4CADMCTPTAAUTONOMIC_GANGLIA828p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N300N
RECQL4CADMCTPTAAUTONOMIC_GANGLIA828p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN300N
RECQL4CADMCTPTAAUTONOMIC_GANGLIA828p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN300N
RECQL4CADMCTPTAAUTONOMIC_GANGLIA828p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN300N
RECQL4CADMCTPTAAUTONOMIC_GANGLIA828p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN300N
RECQL4CADMCTPTAAUTONOMIC_GANGLIA828p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN300N
RECQL4CCIWGCPQAAUTONOMIC_GANGLIA786p.R766fsc.2296_2296delCFrame_Shift_Del674.34CHP212N100N
RECQL4CCIWGCPQAAUTONOMIC_GANGLIA786p.R766fsc.2296_2296delCFrame_Shift_Del674.34KELLYN100N
RECQL4CCIWGCPQAAUTONOMIC_GANGLIA786p.R766fsc.2296_2296delCFrame_Shift_Del674.34KPNSI9SN100N
RECQL4CCIWGCPQAAUTONOMIC_GANGLIA786p.R766fsc.2296_2296delCFrame_Shift_Del674.34NH6N100N
RECQL4CCIWGCPQAAUTONOMIC_GANGLIA786p.R766fsc.2296_2296delCFrame_Shift_Del674.34SHSY5YN100N
RECQL4CCIWGCPQAAUTONOMIC_GANGLIA786p.R766fsc.2296_2296delCFrame_Shift_Del674.34SIMAN100N
RECQL4CCIWGCPQAAUTONOMIC_GANGLIA786p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNASN100N
RECQL4CCIWGCPQAAUTONOMIC_GANGLIA786p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNDZN100N
RECQL4CCIWGCPQAAUTONOMIC_GANGLIA786p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNFIN100N
RECQL4CESCADMCTAUTONOMIC_GANGLIA825p.R766fsc.2296_2296delCFrame_Shift_Del674.34CHP212N500N
RECQL4CESCADMCTAUTONOMIC_GANGLIA825p.R766fsc.2296_2296delCFrame_Shift_Del674.34KELLYN500N
RECQL4CESCADMCTAUTONOMIC_GANGLIA825p.R766fsc.2296_2296delCFrame_Shift_Del674.34KPNSI9SN500N
RECQL4CESCADMCTAUTONOMIC_GANGLIA825p.R766fsc.2296_2296delCFrame_Shift_Del674.34NH6N500N
RECQL4CESCADMCTAUTONOMIC_GANGLIA825p.R766fsc.2296_2296delCFrame_Shift_Del674.34SHSY5YN500N
RECQL4CESCADMCTAUTONOMIC_GANGLIA825p.R766fsc.2296_2296delCFrame_Shift_Del674.34SIMAN500N
RECQL4CESCADMCTAUTONOMIC_GANGLIA825p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNASN500N
RECQL4CESCADMCTAUTONOMIC_GANGLIA825p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNDZN500N
RECQL4CESCADMCTAUTONOMIC_GANGLIA825p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNFIN500N
RECQL4CGLCCIWGCAUTONOMIC_GANGLIA783p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N100N
RECQL4CGLCCIWGCAUTONOMIC_GANGLIA783p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN100N
RECQL4CGLCCIWGCAUTONOMIC_GANGLIA783p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN100N
RECQL4CGLCCIWGCAUTONOMIC_GANGLIA783p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N100N
RECQL4CGLCCIWGCAUTONOMIC_GANGLIA783p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN100N
RECQL4CGLCCIWGCAUTONOMIC_GANGLIA783p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN100N
RECQL4CGLCCIWGCAUTONOMIC_GANGLIA783p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN100N
RECQL4CGLCCIWGCAUTONOMIC_GANGLIA783p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN100N
RECQL4CGLCCIWGCAUTONOMIC_GANGLIA783p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN100N
RECQL4CIWGCPQASAUTONOMIC_GANGLIA787p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N000N
RECQL4CIWGCPQASAUTONOMIC_GANGLIA787p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN000N
RECQL4CIWGCPQASAUTONOMIC_GANGLIA787p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN000N
RECQL4CIWGCPQASAUTONOMIC_GANGLIA787p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N000N
RECQL4CIWGCPQASAUTONOMIC_GANGLIA787p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN000N
RECQL4CIWGCPQASAUTONOMIC_GANGLIA787p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN000N
RECQL4CIWGCPQASAUTONOMIC_GANGLIA787p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN000N
RECQL4CIWGCPQASAUTONOMIC_GANGLIA787p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN000N
RECQL4CIWGCPQASAUTONOMIC_GANGLIA787p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN000N
RECQL4CPQASRATCAUTONOMIC_GANGLIA791p.R766fsc.2296_2296delCFrame_Shift_Del674.34CHP212N400Y
RECQL4CPQASRATCAUTONOMIC_GANGLIA791p.R766fsc.2296_2296delCFrame_Shift_Del674.34KELLYN400Y
RECQL4CPQASRATCAUTONOMIC_GANGLIA791p.R766fsc.2296_2296delCFrame_Shift_Del674.34KPNSI9SN400Y
RECQL4CPQASRATCAUTONOMIC_GANGLIA791p.R766fsc.2296_2296delCFrame_Shift_Del674.34NH6N400Y
RECQL4CPQASRATCAUTONOMIC_GANGLIA791p.R766fsc.2296_2296delCFrame_Shift_Del674.34SHSY5YN400Y
RECQL4CPQASRATCAUTONOMIC_GANGLIA791p.R766fsc.2296_2296delCFrame_Shift_Del674.34SIMAN400Y
RECQL4CPQASRATCAUTONOMIC_GANGLIA791p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNASN400Y
RECQL4CPQASRATCAUTONOMIC_GANGLIA791p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNDZN400Y
RECQL4CPQASRATCAUTONOMIC_GANGLIA791p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNFIN400Y
RECQL4CRPWAGPGVAUTONOMIC_GANGLIA799p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N400N
RECQL4CRPWAGPGVAUTONOMIC_GANGLIA799p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN400N
RECQL4CRPWAGPGVAUTONOMIC_GANGLIA799p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN400N
RECQL4CRPWAGPGVAUTONOMIC_GANGLIA799p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N400N
RECQL4CRPWAGPGVAUTONOMIC_GANGLIA799p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN400N
RECQL4CRPWAGPGVAUTONOMIC_GANGLIA799p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN400N
RECQL4CRPWAGPGVAUTONOMIC_GANGLIA799p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN400N
RECQL4CRPWAGPGVAUTONOMIC_GANGLIA799p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN400N
RECQL4CRPWAGPGVAUTONOMIC_GANGLIA799p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN400N
RECQL4CSPRAKTCEAUTONOMIC_GANGLIA818p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N000N
RECQL4CSPRAKTCEAUTONOMIC_GANGLIA818p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN000N
RECQL4CSPRAKTCEAUTONOMIC_GANGLIA818p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN000N
RECQL4CSPRAKTCEAUTONOMIC_GANGLIA818p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N000N
RECQL4CSPRAKTCEAUTONOMIC_GANGLIA818p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN000N
RECQL4CSPRAKTCEAUTONOMIC_GANGLIA818p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN000N
RECQL4CSPRAKTCEAUTONOMIC_GANGLIA818p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN000N
RECQL4CSPRAKTCEAUTONOMIC_GANGLIA818p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN000N
RECQL4CSPRAKTCEAUTONOMIC_GANGLIA818p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN000N
RECQL4CTPTARTSWAUTONOMIC_GANGLIA832p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N100N
RECQL4CTPTARTSWAUTONOMIC_GANGLIA832p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN100N
RECQL4CTPTARTSWAUTONOMIC_GANGLIA832p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN100N
RECQL4CTPTARTSWAUTONOMIC_GANGLIA832p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N100N
RECQL4CTPTARTSWAUTONOMIC_GANGLIA832p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN100N
RECQL4CTPTARTSWAUTONOMIC_GANGLIA832p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN100N
RECQL4CTPTARTSWAUTONOMIC_GANGLIA832p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN100N
RECQL4CTPTARTSWAUTONOMIC_GANGLIA832p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN100N
RECQL4CTPTARTSWAUTONOMIC_GANGLIA832p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN100N
RECQL4DMCTPTARTAUTONOMIC_GANGLIA830p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N200N
RECQL4DMCTPTARTAUTONOMIC_GANGLIA830p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN200N
RECQL4DMCTPTARTAUTONOMIC_GANGLIA830p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN200N
RECQL4DMCTPTARTAUTONOMIC_GANGLIA830p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N200N
RECQL4DMCTPTARTAUTONOMIC_GANGLIA830p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN200N
RECQL4DMCTPTARTAUTONOMIC_GANGLIA830p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN200N
RECQL4DMCTPTARTAUTONOMIC_GANGLIA830p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN200N
RECQL4DMCTPTARTAUTONOMIC_GANGLIA830p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN200N
RECQL4DMCTPTARTAUTONOMIC_GANGLIA830p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN200N
RECQL4ESCADMCTPAUTONOMIC_GANGLIA826p.R766fsc.2296_2296delCFrame_Shift_Del674.34CHP212N000N
RECQL4ESCADMCTPAUTONOMIC_GANGLIA826p.R766fsc.2296_2296delCFrame_Shift_Del674.34KELLYN000N
RECQL4ESCADMCTPAUTONOMIC_GANGLIA826p.R766fsc.2296_2296delCFrame_Shift_Del674.34KPNSI9SN000N
RECQL4ESCADMCTPAUTONOMIC_GANGLIA826p.R766fsc.2296_2296delCFrame_Shift_Del674.34NH6N000N
RECQL4ESCADMCTPAUTONOMIC_GANGLIA826p.R766fsc.2296_2296delCFrame_Shift_Del674.34SHSY5YN000N
RECQL4ESCADMCTPAUTONOMIC_GANGLIA826p.R766fsc.2296_2296delCFrame_Shift_Del674.34SIMAN000N
RECQL4ESCADMCTPAUTONOMIC_GANGLIA826p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNASN000N
RECQL4ESCADMCTPAUTONOMIC_GANGLIA826p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNDZN000N
RECQL4ESCADMCTPAUTONOMIC_GANGLIA826p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNFIN000N
RECQL4FMQGQLGWWAUTONOMIC_GANGLIA760p.R766fsc.2296_2296delCFrame_Shift_Del374.34CHP212N500N
RECQL4FMQGQLGWWAUTONOMIC_GANGLIA760p.R766fsc.2296_2296delCFrame_Shift_Del374.34KELLYN500N
RECQL4FMQGQLGWWAUTONOMIC_GANGLIA760p.R766fsc.2296_2296delCFrame_Shift_Del374.34KPNSI9SN500N
RECQL4FMQGQLGWWAUTONOMIC_GANGLIA760p.R766fsc.2296_2296delCFrame_Shift_Del374.34NH6N500N
RECQL4FMQGQLGWWAUTONOMIC_GANGLIA760p.R766fsc.2296_2296delCFrame_Shift_Del374.34SHSY5YN500N
RECQL4FMQGQLGWWAUTONOMIC_GANGLIA760p.R766fsc.2296_2296delCFrame_Shift_Del374.34SIMAN500N
RECQL4FMQGQLGWWAUTONOMIC_GANGLIA760p.R766fsc.2296_2296delCFrame_Shift_Del374.34SKNASN500N
RECQL4FMQGQLGWWAUTONOMIC_GANGLIA760p.R766fsc.2296_2296delCFrame_Shift_Del374.34SKNDZN500N
RECQL4FMQGQLGWWAUTONOMIC_GANGLIA760p.R766fsc.2296_2296delCFrame_Shift_Del374.34SKNFIN500N
RECQL4GCPQASRATAUTONOMIC_GANGLIA790p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N100N
RECQL4GCPQASRATAUTONOMIC_GANGLIA790p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN100N
RECQL4GCPQASRATAUTONOMIC_GANGLIA790p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN100N
RECQL4GCPQASRATAUTONOMIC_GANGLIA790p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N100N
RECQL4GCPQASRATAUTONOMIC_GANGLIA790p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN100N
RECQL4GCPQASRATAUTONOMIC_GANGLIA790p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN100N
RECQL4GCPQASRATAUTONOMIC_GANGLIA790p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN100N
RECQL4GCPQASRATAUTONOMIC_GANGLIA790p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN100N
RECQL4GCPQASRATAUTONOMIC_GANGLIA790p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN100N
RECQL4GLCCIWGCPAUTONOMIC_GANGLIA784p.R766fsc.2296_2296delCFrame_Shift_Del674.34CHP212N100N
RECQL4GLCCIWGCPAUTONOMIC_GANGLIA784p.R766fsc.2296_2296delCFrame_Shift_Del674.34KELLYN100N
RECQL4GLCCIWGCPAUTONOMIC_GANGLIA784p.R766fsc.2296_2296delCFrame_Shift_Del674.34KPNSI9SN100N
RECQL4GLCCIWGCPAUTONOMIC_GANGLIA784p.R766fsc.2296_2296delCFrame_Shift_Del674.34NH6N100N
RECQL4GLCCIWGCPAUTONOMIC_GANGLIA784p.R766fsc.2296_2296delCFrame_Shift_Del674.34SHSY5YN100N
RECQL4GLCCIWGCPAUTONOMIC_GANGLIA784p.R766fsc.2296_2296delCFrame_Shift_Del674.34SIMAN100N
RECQL4GLCCIWGCPAUTONOMIC_GANGLIA784p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNASN100N
RECQL4GLCCIWGCPAUTONOMIC_GANGLIA784p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNDZN100N
RECQL4GLCCIWGCPAUTONOMIC_GANGLIA784p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNFIN100N
RECQL4GPGVTGSLPAUTONOMIC_GANGLIA804p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N000N
RECQL4GPGVTGSLPAUTONOMIC_GANGLIA804p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN000N
RECQL4GPGVTGSLPAUTONOMIC_GANGLIA804p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN000N
RECQL4GPGVTGSLPAUTONOMIC_GANGLIA804p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N000N
RECQL4GPGVTGSLPAUTONOMIC_GANGLIA804p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN000N
RECQL4GPGVTGSLPAUTONOMIC_GANGLIA804p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN000N
RECQL4GPGVTGSLPAUTONOMIC_GANGLIA804p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN000N
RECQL4GPGVTGSLPAUTONOMIC_GANGLIA804p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN000N
RECQL4GPGVTGSLPAUTONOMIC_GANGLIA804p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN000N
RECQL4GQLGWWWPRAUTONOMIC_GANGLIA763p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N700N
RECQL4GQLGWWWPRAUTONOMIC_GANGLIA763p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN700N
RECQL4GQLGWWWPRAUTONOMIC_GANGLIA763p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN700N
RECQL4GQLGWWWPRAUTONOMIC_GANGLIA763p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N700N
RECQL4GQLGWWWPRAUTONOMIC_GANGLIA763p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN700N
RECQL4GQLGWWWPRAUTONOMIC_GANGLIA763p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN700N
RECQL4GQLGWWWPRAUTONOMIC_GANGLIA763p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN700N
RECQL4GQLGWWWPRAUTONOMIC_GANGLIA763p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN700N
RECQL4GQLGWWWPRAUTONOMIC_GANGLIA763p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN700N
RECQL4GQMCGLCCIAUTONOMIC_GANGLIA780p.R766fsc.2296_2296delCFrame_Shift_Del674.34CHP212N1000N
RECQL4GQMCGLCCIAUTONOMIC_GANGLIA780p.R766fsc.2296_2296delCFrame_Shift_Del674.34KELLYN1000N
RECQL4GQMCGLCCIAUTONOMIC_GANGLIA780p.R766fsc.2296_2296delCFrame_Shift_Del674.34KPNSI9SN1000N
RECQL4GQMCGLCCIAUTONOMIC_GANGLIA780p.R766fsc.2296_2296delCFrame_Shift_Del674.34NH6N1000N
RECQL4GQMCGLCCIAUTONOMIC_GANGLIA780p.R766fsc.2296_2296delCFrame_Shift_Del674.34SHSY5YN1000N
RECQL4GQMCGLCCIAUTONOMIC_GANGLIA780p.R766fsc.2296_2296delCFrame_Shift_Del674.34SIMAN1000N
RECQL4GQMCGLCCIAUTONOMIC_GANGLIA780p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNASN1000N
RECQL4GQMCGLCCIAUTONOMIC_GANGLIA780p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNDZN1000N
RECQL4GQMCGLCCIAUTONOMIC_GANGLIA780p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNFIN1000N
RECQL4GSLPTATSSAUTONOMIC_GANGLIA809p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N000N
RECQL4GSLPTATSSAUTONOMIC_GANGLIA809p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN000N
RECQL4GSLPTATSSAUTONOMIC_GANGLIA809p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN000N
RECQL4GSLPTATSSAUTONOMIC_GANGLIA809p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N000N
RECQL4GSLPTATSSAUTONOMIC_GANGLIA809p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN000N
RECQL4GSLPTATSSAUTONOMIC_GANGLIA809p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN000N
RECQL4GSLPTATSSAUTONOMIC_GANGLIA809p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN000N
RECQL4GSLPTATSSAUTONOMIC_GANGLIA809p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN000N
RECQL4GSLPTATSSAUTONOMIC_GANGLIA809p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN000N
RECQL4GVTGSLPTAAUTONOMIC_GANGLIA806p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N100N
RECQL4GVTGSLPTAAUTONOMIC_GANGLIA806p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN100N
RECQL4GVTGSLPTAAUTONOMIC_GANGLIA806p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN100N
RECQL4GVTGSLPTAAUTONOMIC_GANGLIA806p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N100N
RECQL4GVTGSLPTAAUTONOMIC_GANGLIA806p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN100N
RECQL4GVTGSLPTAAUTONOMIC_GANGLIA806p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN100N
RECQL4GVTGSLPTAAUTONOMIC_GANGLIA806p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN100N
RECQL4GVTGSLPTAAUTONOMIC_GANGLIA806p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN100N
RECQL4GVTGSLPTAAUTONOMIC_GANGLIA806p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN100N
RECQL4GWGWTGQMCAUTONOMIC_GANGLIA775p.R766fsc.2296_2296delCFrame_Shift_Del674.34CHP212N000N
RECQL4GWGWTGQMCAUTONOMIC_GANGLIA775p.R766fsc.2296_2296delCFrame_Shift_Del674.34KELLYN000N
RECQL4GWGWTGQMCAUTONOMIC_GANGLIA775p.R766fsc.2296_2296delCFrame_Shift_Del674.34KPNSI9SN000N
RECQL4GWGWTGQMCAUTONOMIC_GANGLIA775p.R766fsc.2296_2296delCFrame_Shift_Del674.34NH6N000N
RECQL4GWGWTGQMCAUTONOMIC_GANGLIA775p.R766fsc.2296_2296delCFrame_Shift_Del674.34SHSY5YN000N
RECQL4GWGWTGQMCAUTONOMIC_GANGLIA775p.R766fsc.2296_2296delCFrame_Shift_Del674.34SIMAN000N
RECQL4GWGWTGQMCAUTONOMIC_GANGLIA775p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNASN000N
RECQL4GWGWTGQMCAUTONOMIC_GANGLIA775p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNDZN000N
RECQL4GWGWTGQMCAUTONOMIC_GANGLIA775p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNFIN000N
RECQL4GWTGQMCGLAUTONOMIC_GANGLIA777p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N400N
RECQL4GWTGQMCGLAUTONOMIC_GANGLIA777p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN400N
RECQL4GWTGQMCGLAUTONOMIC_GANGLIA777p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN400N
RECQL4GWTGQMCGLAUTONOMIC_GANGLIA777p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N400N
RECQL4GWTGQMCGLAUTONOMIC_GANGLIA777p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN400N
RECQL4GWTGQMCGLAUTONOMIC_GANGLIA777p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN400N
RECQL4GWTGQMCGLAUTONOMIC_GANGLIA777p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN400N
RECQL4GWTGQMCGLAUTONOMIC_GANGLIA777p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN400N
RECQL4GWTGQMCGLAUTONOMIC_GANGLIA777p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN400N
RECQL4GWWWPRWPLAUTONOMIC_GANGLIA766p.R766fsc.2296_2296delCFrame_Shift_Del674.34CHP212Y8120N
RECQL4GWWWPRWPLAUTONOMIC_GANGLIA766p.R766fsc.2296_2296delCFrame_Shift_Del674.34KELLYY8120N
RECQL4GWWWPRWPLAUTONOMIC_GANGLIA766p.R766fsc.2296_2296delCFrame_Shift_Del674.34KPNSI9SY8120N
RECQL4GWWWPRWPLAUTONOMIC_GANGLIA766p.R766fsc.2296_2296delCFrame_Shift_Del674.34NH6Y8120N
RECQL4GWWWPRWPLAUTONOMIC_GANGLIA766p.R766fsc.2296_2296delCFrame_Shift_Del674.34SHSY5YY8120N
RECQL4GWWWPRWPLAUTONOMIC_GANGLIA766p.R766fsc.2296_2296delCFrame_Shift_Del674.34SIMAY8120N
RECQL4GWWWPRWPLAUTONOMIC_GANGLIA766p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNASY8120N
RECQL4GWWWPRWPLAUTONOMIC_GANGLIA766p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNDZY8120N
RECQL4GWWWPRWPLAUTONOMIC_GANGLIA766p.R766fsc.2296_2296delCFrame_Shift_Del674.34SKNFIY8120N
RECQL4IWGCPQASRAUTONOMIC_GANGLIA788p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N100N
RECQL4IWGCPQASRAUTONOMIC_GANGLIA788p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN100N
RECQL4IWGCPQASRAUTONOMIC_GANGLIA788p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN100N
RECQL4IWGCPQASRAUTONOMIC_GANGLIA788p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N100N
RECQL4IWGCPQASRAUTONOMIC_GANGLIA788p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN100N
RECQL4IWGCPQASRAUTONOMIC_GANGLIA788p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN100N
RECQL4IWGCPQASRAUTONOMIC_GANGLIA788p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN100N
RECQL4IWGCPQASRAUTONOMIC_GANGLIA788p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN100N
RECQL4IWGCPQASRAUTONOMIC_GANGLIA788p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN100N
RECQL4KTCESCADMAUTONOMIC_GANGLIA823p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212Y490N
RECQL4KTCESCADMAUTONOMIC_GANGLIA823p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYY490N
RECQL4KTCESCADMAUTONOMIC_GANGLIA823p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SY490N
RECQL4KTCESCADMAUTONOMIC_GANGLIA823p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6Y490N
RECQL4KTCESCADMAUTONOMIC_GANGLIA823p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YY490N
RECQL4KTCESCADMAUTONOMIC_GANGLIA823p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAY490N
RECQL4KTCESCADMAUTONOMIC_GANGLIA823p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASY490N
RECQL4KTCESCADMAUTONOMIC_GANGLIA823p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZY490N
RECQL4KTCESCADMAUTONOMIC_GANGLIA823p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIY490N
RECQL4LCCIWGCPQAUTONOMIC_GANGLIA785p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N000N
RECQL4LCCIWGCPQAUTONOMIC_GANGLIA785p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN000N
RECQL4LCCIWGCPQAUTONOMIC_GANGLIA785p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN000N
RECQL4LCCIWGCPQAUTONOMIC_GANGLIA785p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N000N
RECQL4LCCIWGCPQAUTONOMIC_GANGLIA785p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN000N
RECQL4LCCIWGCPQAUTONOMIC_GANGLIA785p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN000N
RECQL4LCCIWGCPQAUTONOMIC_GANGLIA785p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN000N
RECQL4LCCIWGCPQAUTONOMIC_GANGLIA785p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN000N
RECQL4LCCIWGCPQAUTONOMIC_GANGLIA785p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN000N
RECQL4LGWGWTGQMAUTONOMIC_GANGLIA774p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N1001N
RECQL4LGWGWTGQMAUTONOMIC_GANGLIA774p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN1001N
RECQL4LGWGWTGQMAUTONOMIC_GANGLIA774p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN1001N
RECQL4LGWGWTGQMAUTONOMIC_GANGLIA774p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N1001N
RECQL4LGWGWTGQMAUTONOMIC_GANGLIA774p.R766fsc.2296_2296delCFrame_Shift_Del574.34SHSY5YN1001N
RECQL4LGWGWTGQMAUTONOMIC_GANGLIA774p.R766fsc.2296_2296delCFrame_Shift_Del574.34SIMAN1001N
RECQL4LGWGWTGQMAUTONOMIC_GANGLIA774p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNASN1001N
RECQL4LGWGWTGQMAUTONOMIC_GANGLIA774p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNDZN1001N
RECQL4LGWGWTGQMAUTONOMIC_GANGLIA774p.R766fsc.2296_2296delCFrame_Shift_Del574.34SKNFIN1001N
RECQL4LGWWWPRWPAUTONOMIC_GANGLIA765p.R766fsc.2296_2296delCFrame_Shift_Del574.34CHP212N004N
RECQL4LGWWWPRWPAUTONOMIC_GANGLIA765p.R766fsc.2296_2296delCFrame_Shift_Del574.34KELLYN004N
RECQL4LGWWWPRWPAUTONOMIC_GANGLIA765p.R766fsc.2296_2296delCFrame_Shift_Del574.34KPNSI9SN004N
RECQL4LGWWWPRWPAUTONOMIC_GANGLIA765p.R766fsc.2296_2296delCFrame_Shift_Del574.34NH6N004N
RECQL4LGWWWPRWP