Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_25774 details
Primary information
SALIDSAL_25774
Biomarker nameCASP1
Biomarker TypeDiagnostic
Sampling MethodAbout 8 controls, 14 patients confirmed to have sleep apnea, and 18 patients that were suspected to have sleep apnea during their initial screen but did not exhibit sleep apnea during their overnight assessment (sleepy) were evaluated for salivary transcript levels
Collection MethodBriefly, saliva was obtained when subjects chewed on a salivette
Analysis MethodqPCR
Collection SiteWhole Saliva
Disease CategorySleep Disorder
Disease/ConditionExcessive Daytime Sleepiness
Disease SubtypeSleep apnea
Fold Change/ Concentration5.36 +- 2.07
Up/DownregulatedUpregulated
ExosomalNA
OrganismHomo sapiens
PMID25873764
Year of Publication2015
Biomarker IDCASP1
Biomarker CategoryGene
SequenceATGGCCGACAAGGTCCTGAAGGAGAAGAGAAAGCTGTTTATCCGTTCCATGGGTGAAGGTACAATAAATGGCTTACTGGATGAATTATTACAGACAAGGGTGCTGAACAAGGAAGAGATGGAGAAAGTAAAACGTGAAAATGCTACAGTTATGGATAAGACCCGAGCTTTGATTGACTCCGTTATTCCGAAAGGGGCACAGGCATGCCAAATTTGCATCACATACATTTGTGAAGAAGACAGTTACCTGGCAGGGACGCTGGGACTCTCAGCAGATTTATCCAATAATGGACAAGTCAAGCCGCACACGTCTTGCTCTCATTATCTGCAATGA
Title of studyExcessive daytime sleepiness is associated with changes in salivary inflammatory genes transcripts
Abstract of studyExcessive daytime sleepiness (EDS) is a ubiquitous problem that affects public health and safety. A test that can reliably identify individuals that suffer from EDS is needed. In contrast to other methods, salivary biomarkers are an objective, inexpensive, and noninvasive method to identify individuals with inadequate sleep. Although we have previously shown that inflammatory genes are elevated in saliva samples taken from sleep deprived individuals, it is unclear if inflammatory genes will be elevated in clinical populations with EDS. In this study, salivary samples from individuals with sleep apnea were evaluated using the Taqman low density inflammation array. Transcript levels for 3 genes, including prostaglandin-endoperoxide synthase 2 (PTGS2), were elevated in patients with sleep apnea. Interestingly, PTGS2 was also elevated in patients with EDS but who did not have sleep apnea. These data demonstrate the feasibility of using salivary transcript levels to identify individuals that self-report excessive daytime sleepiness.