Primary information |
---|
SALID | SAL_25773 |
Biomarker name | B2M |
Biomarker Type | Diagnostic |
Sampling Method | About 8 controls, 14 patients confirmed to have sleep apnea, and 18 patients that were suspected to have sleep apnea during their initial screen but did not exhibit sleep apnea during their overnight assessment (sleepy) were evaluated for salivary transcript levels |
Collection Method | Briefly, saliva was obtained when subjects chewed on a salivette |
Analysis Method | qPCR |
Collection Site | Whole Saliva |
Disease Category | Sleep Disorder |
Disease/Condition | Excessive Daytime Sleepiness |
Disease Subtype | Sleep apnea |
Fold Change/ Concentration | 3.33 +- 1.34 |
Up/Downregulated | Upregulated |
Exosomal | NA |
Organism | Homo sapiens |
PMID | 25873764 |
Year of Publication | 2015 |
Biomarker ID | B2M |
Biomarker Category | Gene |
Sequence | ATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCTCGCGCTACTCTCTCTTTCTGGCCTGGAGGCTATCCAGCGTACTCCAAAGATTCAGGTTTACTCACGTCATCCAGCAGAGAATGGAAAGTCAAATTTCCTGAATTGCTATGTGTCTGGGTTTCATCCATCCGACATTGAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTTGTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTACACTGAATTCACCCCCACTGAAAAAGATGAGTATGCCTGCCGTGTGAACCATGTGACTTTGTCACAGCCCAAGATAGTTAAGTGGGATCGAGACATGTAAGCAGCATCATGGAGGTTTGAAGATGCCGCATTTGGATTGGATGAATTCCAAATTCTGCTTGCTTGCTTTTTAATATTGATATGCTTATACACTTACACTTTATGCACAAAATGTAGGGTTATAATAATGTTAACATGGACATGATCTTCTTTATAATTCTACTTTGAGTGCTGTCTCCATGTTTGATGTATCTGAGCAGGTTGCTCCACAGGTAGCTCTAGGAGGGCTGGCAACTTAGAGGTGGGGAGCAGAGAATTCTCTTATCCAACATCAACATCTTGGTCAGATTTGAACTCTTCAATCTCTTGCACTCAAAGCTTGTTAAGATAGTTAAGCGTGCATAAGTTAACTTCCAATTTACATACTCTGCTTAGAATTTGGGGGAAAATTTAGAAATATAATTGACAGGATTATTGGAAATTTGTTATAATGAATGAAACATTTTGTCATATAAGATTCATATTTACTTCTTATACATTTGATAAAGTAAGGCATGGTTGTGGTTAATCTGGTTTATTTTTGTTCCACAAGTTAAATAAATCATAAAACTTGA |
Title of study | Excessive daytime sleepiness is associated with changes in salivary inflammatory genes transcripts |
Abstract of study | Excessive daytime sleepiness (EDS) is a ubiquitous problem that affects public health and safety. A test that can reliably identify individuals that suffer from EDS is needed. In contrast to other methods, salivary biomarkers are an objective, inexpensive, and noninvasive method to identify individuals with inadequate sleep. Although we have previously shown that inflammatory genes are elevated in saliva samples taken from sleep deprived individuals, it is unclear if inflammatory genes will be elevated in clinical populations with EDS. In this study, salivary samples from individuals with sleep apnea were evaluated using the Taqman low density inflammation array. Transcript levels for 3 genes, including prostaglandin-endoperoxide synthase 2 (PTGS2), were elevated in patients with sleep apnea. Interestingly, PTGS2 was also elevated in patients with EDS but who did not have sleep apnea. These data demonstrate the feasibility of using salivary transcript levels to identify individuals that self-report excessive daytime sleepiness. |