Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_25701 details
Primary information
SALIDSAL_25701
Biomarker nameTRBV5-6
Biomarker TypeDiagnostic
Sampling MethodPatients who had been diagnosed with SS in the Rheumatology Clinic of Severance Hospital and presented to the Oral Medicine Clinic in Yonsei Dental Hospital participated in this study
Collection MethodUnsimulated saliva. Patients placed their tongue to the upper incisors and spit gently in a beaker. Saliva was collected for 15 min, and then the amount of saliva in the unstimulated condition
Analysis MethodSequencing
Collection SiteSaliva
Disease CategoryAutoimmune Disorder
Disease/ConditionSjogren's Syndrome
Disease SubtypeNA
Fold Change/ ConcentrationNA
Up/DownregulatedUpregulated
ExosomalNA
OrganismHomo sapiens
PMID31349012
Year of Publication2019
Biomarker IDTRBV5-6
Biomarker CategoryGene
SequenceGACGCTGGAGTCACCCAAAGTCCCACACACCTGATCAAAACGAGAGGACAGCAAGTGACTCTGAGATGCTCTCCTAAGTCTGGGCATGACACTGTGTCCTGGTACCAACAGGCCCTGGGTCAGGGGCCCCAGTTTATCTTTCAGTATTATGAGGAGGAAGAGAGACAGAGAGGCAACTTCCCTGATCGATTCTCAGGTCACCAGTTCCCTAACTATAGCTCTGAGCTGAATGTGAACGCCTTGTGGCTGGGGGACTCGGCCCTCTATCTCTGTGCCAGCAGCTTGG
Title of studyVariants at potential loci associated with Sjogren's syndrome in Koreans: A genetic association study
Abstract of studySjogren's syndrome (SS), a chronic autoimmune disease, typically causes or involves inflammation in the salivary and lacrimal glands. Although recent genetic association studies have contributed to the discovery of SS susceptible genes, few studies have reported on the Korean population. Here, we did a genetic association study of SS in Korean patients using whole-exome sequencing data of 15 patients and 100 healthy controls. In addition to confirming previously described SS susceptibility loci MSH5 (p = 1.67 × 10-5) and RELN (p = 4.91 × 10-6), we also validated PRAMEF13 (p = 2.28 × 10-5), TARBP1 (p = 1.87 × 10-5), UGT2B28 (p = 1.33 × 10-5), TRBV5-6 (p = 2.27 × 10-5) and NAPB (p = 3.73 × 10-5) as novel susceptibility loci for SS. Furthermore, we identified UGT2B28, TARBP1 and PRAMEF13 as associated with human immune function. These findings may provide useful insight into to the pathways and pathogenesis contributing to SS susceptibility in the Korean population.