| Primary information |
|---|
| SALID | SAL_25684 |
| Biomarker name | TIMP-1 |
| Biomarker Type | Diagnostic |
| Sampling Method | In 29 patients (65% women and 35% men, median age 55+-3 years), pleomorphic adenoma in PG was detected. Adenoid cystic carcinoma (ACC) was diagnosticated in 24 patients (17% women and 83% men; median age 55.8+-1.2 years). |
| Collection Method | NA |
| Analysis Method | ELISA |
| Collection Site | Saliva |
| Disease Category | Cancer |
| Disease/Condition | Head and neck Cancer |
| Disease Subtype | Benign Parotid Gland Tumors |
| Fold Change/ Concentration | NA |
| Up/Downregulated | NA |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 30617705 |
| Year of Publication | 2018 |
| Biomarker ID | TIMP1 |
| Biomarker Category | Gene |
| Sequence | GCCATCGCCGCAGATCCAGCGCCCAGAGAGACACCAGAGAACCCACCATGGCCCCCTTTGAGCCCCTGGCTTCTGGCATCCTGTTGTTGCTGTGGCTGATAGCCCCCAGCAGGGCCTGCACCTGTGTCCCACCCCACCCACAGACGGCCTTCTGCAATTCCGACCTCGTCATCAGGGCCAAGTTCGTGGGGACACCAGAAGTCAACCAGACCACCTTATACCAGCGTTATGAGATCAAGATGACCAAGATGTATAAAGGGTTCCAAGCCTTAGGGGATGCCGCTGACATCCGGTTCGTCTACACCCCCGCCATGGAGAGTGTCTGCGGATACTTCCACAGGTCCCACAACCGCAGCGAGGAGTTTCTCATTGCTGGAAAACTGCAGGATGGACTCTTGCACATCACTACCTGCAGTTTTGTGGCTCCCTGGAACAGCCTGAGCTTAGCTCAGCGCCGGGGCTTCACCAAGACCTACACTGTTGGCTGTGAGGAATGCACAGTGTTTCCCTGTTTATCCATCCCCTGCAAACTGCAGAGTGGCACTCATTGCTTGTGGACGGACCAGCTCCTCCAAGGCTCTGAAAAGGGCTTCCAGTCCCGTCACCTTGCCTGCCTGCCTCGGGAGCCAGGGCTGTGCACCTGGCAGTCCCTGCGGTCCCAGATAGCCTGAATCCTGCCCGGAGTGGAAGCTGAAGCCTGCACAGTGTCCACCCTGTTCCCACTCCCATCTTTCTTCCGGACAATGAAATAAAGAGTTACCACCCAGCA |
| Title of study | Comparative Role of Matrixins in Diagnostics of Parotid Gland Tumors |
| Abstract of study | The benign and malignant neoplasms in parotid gland have similar clinical presentations despite different tumor growth rates. The study compared the clinical and morphological data as well as the results of ELISA for MMP-2, MMP-8, MMP-9, TIMP-1, and TIMP-2 in salivary fluid yielded during primary examination of the patients with pleomorphic adenoma and adenocarcinoma of parotid gland. The examined biomarkers detected in salivary fluid in patients with various cancer types differed significantly (p≤0.05). The correlations between clinical identification of adenoma or adenocarcinoma, on the one hand, and the levels of MMP-8, TIMP-1, and TIMP-2, on the other hand, makes it possible to use the latter as biomarkers for early detection and comprehensive noninvasive differential diagnostics of these neoplasms. |