Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_25603 details
Primary information
SALIDSAL_25603
Biomarker namePSMB9
Biomarker TypeDiagnostic
Sampling MethodFifteen patients with pSS together with 12 non-pSS subjects for RNA sequencing were recruited
Collection MethodThese samples were processed by the local pathology departments using the approach of paraffin embedding, sectioning, and hematoxylin and eosin staining
Analysis Method RNA-seq
Collection SiteSaliva
Disease CategoryAutoimmune Disorder
Disease/ConditionSjogren's Syndrome
Disease SubtypePrimary Sjogren's syndrome
Fold Change/ Concentration1.463752398
Up/DownregulatedUpregulated
ExosomalNA
OrganismHomo sapiens
PMID31068931
Year of Publication2019
Biomarker IDPSMB9
Biomarker CategoryGene
SequenceATGCTGCGGGCGGGAGCACCAACCGGGGACTTACCCCGGGCGGGAGAAGTCCACACCGGGACCACCATCATGGCAGTGGAGTTTGACGGGGGCGTTGTGATGGGTTCTGATTCCCGAGTGTCTGCAGGCGAGGCGGTGGTGAACCGAGTGTTTGACAAGCTGTCCCCGCTGCACGAGCGCATCTACTGTGCACTCTCTGGTTCAGCTGCTGATGCCCAAGCCGTGGCCGACATGGCCGCCTACCAGCTGGAGCTCCATGGGATAGAACTGGAGGAACCTCCACTTGTTTTGGCTGCTGCAAATGTGGTGAGAAATATCAGCTATAAATATCGAGAGGACTTGTCTGCACATCTCATGGTAGCTGGCTGGGACCAACGTGAAGGAGGTCAGGTATATGGAACCCTGGGAGGAATGCTGACTCGACAGCCTTTTGCCATTGGTGGCTCCGGCAGCACCTTTATCTATGGTTATGTGGATGCAGCATATAAGCCAGGCATGTCTCCCGAGGAGTGCAGGCGCTTCACCACAGACGCTATTGCTCTGGCCATGAGCCGGGATGGCTCAAGCGGGGGTGTCATCTACCTGGTCACTATTACAGCTGCCGGTGTGGACCATCGAGTCATCTTGGGCAATGAACTGCCAAAATTCTATGATGAG
Title of studyElevated CCL19/CCR7 Expression During the Disease Process of Primary Sjögren's Syndrome
Abstract of studyPrimary Sjögren's syndrome (pSS) is a common chronic autoimmune disease characterized by a high prevalence of autoantibodies and lymphocyte-mediated exocrine gland damage. To enhance our understanding of the mechanisms underlying the progression of the disease and to discover potential biomarkers for the early diagnosis of pSS, we applied RNA sequencing to compare the gene expression patterns in minor salivary glands between pSS patients and non-pSS. A total of 293 differentially expressed genes (DEGs) were detected in pSS vs. non-pSS (FDR < 0.05, fold changes > 2). Of these DEGs, 285 (97.26%) were up-regulated, with most being involved in immune system activation, especially in the formation of the immunological synapse. Significantly elevated CCL19/CCR7 expression in the salivary gland was found to be related to anti-Sjögren's syndrome-related antigen A (SSA) antibody and IgG levels in pSS patients, which was further confirmed in a larger cohort. Up-regulated gene expression showed strong discriminatory accuracy in identifying pSS with area under the curve of 0.98 using receiver operating characteristic curve analysis. In conclusion, gene expression changes in pSS include strong markers of immunological activation and have good discriminatory power in identifying patients with pSS.