| Primary information |
|---|
| SALID | SAL_25529 |
| Biomarker name | CDC2 |
| Biomarker Type | NA |
| Sampling Method | A total of 54 subjects including for saliva sampling, 23 controls with no history of head traumas, 16 patients enrolled from an outpatient concussion clinic, and 15 patients from the emergency department who had sustained a head trauma within 24 hr. |
| Collection Method | Subjects were directed to orally rinse with cup of water before saliva collection. Subjects were directed to spit saliva into the test tube every 60 s. At least 5 ml of saliva was collected |
| Analysis Method | RT-PCR |
| Collection Site | Saliva |
| Disease Category | Healthy |
| Disease/Condition | NA |
| Disease Subtype | NA |
| Fold Change/ Concentration | NA |
| Up/Downregulated | NA |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 30644102 |
| Year of Publication | 2018 |
| Biomarker ID | CDC2 |
| Biomarker Category | Gene |
| Sequence | CTATACACTCCTAACCCTAAGTATTAGAAGTGAAAGTAATGGAATCTCGATGTAAACACAATATCACTTTTTTGATGAGCTATTTTGAGTATAATAAATTTGAACTGTGCCAATGCTGGGAGAAAAAATTTAAAAGAAGAACGGAGCGAACAGTAGCTTCCTCGTCCGCTGACTAGAAACAGTAGGACGACACTCTCCCGACTGGAGGAGAGCGCTTGCTCGCACTCAGTTGGCGCCCGCCCTCCTGCTTTTTCTCTAGCCGCCCTTTCCTCTTTCTTTCGCGCTCTAGCCACCCGGGAAGGCCTGCCCAGCGTAGCTGGGCTCTGATTGGCTGCTTTGAAAGTCTACGGGCTACCCGATTGGTGAATCCGGGGCCCTTTAGCGCGGTGAGTTTGAAACTGCTCGCACTTGGCTTCAAAGCTGGCTCTTGGAAATTGAGCGGAGAGCGACGCGTTGTTGTAGCTGCCGCTGCGCCGCCGCGGAATAATAAGCCGGGTACAGTGGCTGGGGTCAGGGTCGTGTCTAGGGGACGGCCGAGGCGTCGGAGGGCGAGTATGAGGAACGGGGTCCTCTAAGAAGGCCGGCTAGGACCTCAGGGCT |
| Title of study | Potential biomarkers to detect traumatic brain injury by the profiling of salivary extracellular vesicles |
| Abstract of study | Traumatic brain injury (TBI) is a common cause of death and acquired disability in adults and children. Identifying biomarkers for mild TBI (mTBI) that can predict functional impairments on neuropsychiatric and neurocognitive testing after head trauma is yet to be firmly established. Extracellular vesicles (EVs) are known to traffic from the brain to the oral cavity and can be detected in saliva. We hypothesize the genetic profile of salivary EVs in patients who have suffered head trauma will differ from normal healthy controls, thus constituting a unique expression signature for mTBI. We enrolled a total of 54 subjects including for saliva sampling, 23 controls with no history of head traumas, 16 patients enrolled from an outpatient concussion clinic, and 15 patients from the emergency department who had sustained a head trauma within 24 hr. We performed real-time PCR of the salivary EVs of the 54 subjects profiling 96 genes from the TaqMan Human Alzheimer's disease array. Real-time PCR analysis revealed 57 (15 genes, p < 0.05) upregulated genes in emergency department patients and 56 (14 genes, p < 0.05) upregulated genes in concussion clinic patients when compared with controls. Three genes were upregulated in both the emergency department patients and concussion clinic patients: CDC2, CSNK1A1, and CTSD ( p < 0.05). Our results demonstrate that salivary EVs gene expression can serve as a viable source of biomarkers for mTBI. This study shows multiple Alzheimer's disease genes present after an mTBI. |