Detailed description page of SalivaDB
| This page displays user query in tabular form. |
SAL_25459 details |
| Primary information | |
|---|---|
| SALID | SAL_25459 |
| Biomarker name | HEY1 |
| Biomarker Type | Diagnostic |
| Sampling Method | The protocol for studies involving human subjects was approved by the Colorado Multiple Institutional Review Board (COMIRB #08-0552) in accordance with the Belmont Report and U.S. Common Rule |
| Collection Method | NA |
| Analysis Method | RNA-seq |
| Collection Site | Whole Saliva |
| Disease Category | Cancer |
| Disease/Condition | Salivary gland Cancer |
| Disease Subtype | NA |
| Fold Change/ Concentration | 2.1 |
| Up/Downregulated | Upregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 29555661 |
| Year of Publication | 2018 |
| Biomarker ID | HEY1 |
| Biomarker Category | Gene |
| Sequence | CAGCCGAGAGCGGAGAGGCGCCGCTGTAGTTAACTCCTCCCTGCCCGCCGCGCCGACCCTCCCCAGGAACCCCCAGGGAGCCAGCATGAAGCGAGCTCACCCCGAGTACAGCTCCTCGGACAGCGAGCTGGACGAGACCATCGAGGTGGAGAAGGAGAGTGCGGACGAGAATGGAAACTTGAGTTCGGCTCTAGGTTCCATGTCCCCAACTACATCTTCCCAGATTTTGGCCAGAAAAAGACGGAGAGGAATAATTGAGAAGCGCCGACGAGACCGGATCAATAACAGTTTGTCTGAGCTGAGAAGGCTGGTACCCAGTGCTTTTGAGAAGCAGGGATCTGCTAAGCTAGAAAAAGCCGAGATCCTGCAGATGACCGTGGATCACCTGAAAATGCTGCATACGGCAGGAGGGAAAGGTTACTTTGACGCGCACGCCCTTGCTATGGACTATCGGAGTTTGGGATTTCGGGAATGCCTGGCAGAAGTTGCGCGTTATCTGAGCATCATTGAAGGACTAGATGCCTCTGACCCGCTTCGAGTTCGACTGGTTTCGCATCTCAACAACTACGCTTCCCAGCGGGAAGCCGCGAGCGGCGCCCACGCGGGCCTCGGACACATTCCCTGGGGGACCGTCTTCGGACATCACCCGCACATCGCGCACCCGCTGTTGCTGCCCCAGAACGGCCACGGGAACGCGGGCACCACGGCCTCACCCACGGAACCGCACCACCAGGGCAGGCTGGGCTCGGCACATCCGGAGGCGCCTGCTTTGCGAGCGCCCCCTAGCGGCAGCCTCGGACCGGTGCTCCCTGTGGTCACCTCCGCCTCCAAACTGTCGCCGCCTCTGCTCTCCTCAGTGGCCTCCCTGTCGGCCTTCCCCTTCTCTTTCGGCTCCTTCCACTTACTGTCTCCCAATGCACTGAGCCCTTCAGCACCCACGCAGGCTGCAAACCTTGGCAAGCCCTATAGACCTTGGGGGACGGAGATCGGAGCTTTTTAAAGAACTGATGTAGAATGAGGGAGGGGAAAGTTTAAAATCCCAGCTGGGCTGGACTGTTGCCAACATCACCTTAAAGTCGTCAGTAAAAGTAAAAAGGAAAAAGGTACACTTTCAGATAATTTTTTT |
| Title of study | Salivary Gland Cancer Patient-Derived Xenografts Enable Characterization of Cancer Stem Cells and New Gene Events Associated with Tumor Progression |
| Abstract of study | Purpose: Salivary gland cancers (SGC) frequently present with distant metastases many years after diagnosis, suggesting a cancer stem cell (CSC) subpopulation that initiates late recurrences; however, current models are limited both in their availability and suitability to characterize these rare cells.Experimental Design: Patient-derived xenografts (PDX) were generated by engrafting patient tissue onto nude mice from one acinic cell carcinoma (AciCC), four adenoid cystic carcinoma (ACC), and three mucoepidermoid carcinoma (MEC) cases, which were derived from successive relapses from the same MEC patient. Patient and PDX samples were analyzed by RNA-seq and Exome-seq. Sphere formation potential and in vivo tumorigenicity was assessed by sorting for Aldefluor (ALDH) activity and CD44-expressing subpopulations.Results: For successive MEC relapses we found a time-dependent increase in CSCs (ALDH+CD44high), increasing from 0.2% to 4.5% (P=0.033), but more importantly we observed an increase in individual CSC sphere formation and tumorigenic potential. A 50% increase in mutational burden was documented in subsequent MEC tumors, and this was associated with increased expression of tumor-promoting genes (MT1E, LGR5, and LEF1), decreased expression of tumor-suppressor genes (CDKN2B, SIK1, and TP53), and higher expression of CSC-related proteins such as SOX2, MYC, and ALDH1A1. Finally, genomic analyses identified a novel NFIB-MTFR2 fusion in an ACC tumor and confirmed previously reported fusions (NTRK3-ETV6 and MYB-NFIB)Conclusions: Sequential MEC PDX models preserved key patient features and enabled the identification of genetic events putatively contributing to increases in both CSC proportion and intrinsic tumorigenicity, which mirrored the patient's clinical course. Clin Cancer Res; 24(12); 2935-43. ©2018 AACR. |