Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_25368 details
Primary information
SALIDSAL_25368
Biomarker nameHER2/neu
Biomarker TypeDiagnostic
Sampling MethodPatientsÕ tissue blocks were obtained from archived material at The University of Texas MD Anderson Cancer Center
Collection MethodEach tissue microarray (TMA) was created by using two 1.0-mm diameter cores taken from each case and was used for immunohistochemical analyses. T
Analysis MethodIHC
Collection SiteWhole Saliva
Disease CategoryCancer
Disease/Conditionsalivary gland neoplasm
Disease SubtypeSalivary Duct Carcinoma (SDC)
Fold Change/ Concentration0.431
Up/DownregulatedUpregulated
ExosomalNA
OrganismHomo sapiens
PMID30390196
Year of Publication2018
Biomarker IDHER2/neu
Biomarker CategoryGene
SequenceACCCACTCGTGAGTCCAACGGTCTTTTCTGCAGAAAGGAGGACTTTCCTTTCAGGGGTCTTTCTGGGGCTCTTACTATAAAAGGGGACCAACTCTCCCTTTGTCATATCTTGTTTCTGATGACAAAAAATAACACATTGTTAAAATTGTAAAATTAAAACATGAAATATAAATTA
Title of studyExpression of PTEN, Androgen Receptor, HER2/neu, Cytokeratin 5/6, Estrogen Receptor-Beta, HMGA2, and PLAG1 in Salivary Duct Carcinoma
Abstract of studySalivary duct carcinoma (SDC) is an aggressive neoplasm that resembles high-grade invasive ductal carcinoma of the breast. It can develop de novo or from the malignant transformation of pleomorphic adenoma (PA). We performed immunohistochemical stains for phosphatase and tensin homologue [PTEN androgen receptor (AR)], HER2/neu, cytokeratin 5/6, estrogen receptor-beta, high-mobility group AT-hook 2 (HMGA2), and pleomorphic adenoma gene 1 (PLAG1) on tissue microarray samples of 75 SDCs and 31 adenocarcinomas, not otherwise specified (NOS). Our data showed the following in SDC samples: loss of PTEN was found in 17 of 60 (28.3%); AR was expressed in 43 of 62 (69.4%); HER2/neu was overexpressed in 25 of 58 (43.1%); cytokeratin 5/6 was expressed in 14 of 54 (25.9%); estrogen receptor-beta was expressed in 37 of 56 (66.1%); HMGA2 was expressed in 29 of 63 (46.0%); and PLAG1 was expressed in 0 of 62 (0%). In addition, there was no statistically significant difference in the age at onset between patients with HMGA2-positive SDCs (range 32-85 years; mean: 64.3 years; median: 64.5 years) and those with HMGA2-negative SDCs (range 41-79 years; mean: 62.5 years; median: 64.5 years). There was also no statistically significant difference in overall survival between patients with HMGA2-positive and HMGA2-negative SDCs (follow-up period range 3-201 months; mean: 49.8 months; median: 30 months). Among 10 patients with a definite PA component (SDC ex-PA), 6 were positive and 4 were negative for HMGA2. Our data were consistent with previous findings that AR and estrogen receptor-beta are expressed in most SDCs, whereas HER2/neu overexpression and loss of PTEN are expressed in a subset of SDCs. In our cohort of patients, HMGA2 was expressed in approximately half of SDCs. HMGA2 and PTEN are promising therapeutic targets for salivary gland tumors.