Primary information |
---|
SALID | SAL_25368 |
Biomarker name | HER2/neu |
Biomarker Type | Diagnostic |
Sampling Method | PatientsÕ tissue blocks were obtained from archived material at The University of Texas MD Anderson Cancer Center |
Collection Method | Each tissue microarray (TMA) was created by using two 1.0-mm diameter cores taken from each case and was used for immunohistochemical analyses. T |
Analysis Method | IHC |
Collection Site | Whole Saliva |
Disease Category | Cancer |
Disease/Condition | salivary gland neoplasm |
Disease Subtype | Salivary Duct Carcinoma (SDC) |
Fold Change/ Concentration | 0.431 |
Up/Downregulated | Upregulated |
Exosomal | NA |
Organism | Homo sapiens |
PMID | 30390196 |
Year of Publication | 2018 |
Biomarker ID | HER2/neu |
Biomarker Category | Gene |
Sequence | ACCCACTCGTGAGTCCAACGGTCTTTTCTGCAGAAAGGAGGACTTTCCTTTCAGGGGTCTTTCTGGGGCTCTTACTATAAAAGGGGACCAACTCTCCCTTTGTCATATCTTGTTTCTGATGACAAAAAATAACACATTGTTAAAATTGTAAAATTAAAACATGAAATATAAATTA |
Title of study | Expression of PTEN, Androgen Receptor, HER2/neu, Cytokeratin 5/6, Estrogen Receptor-Beta, HMGA2, and PLAG1 in Salivary Duct Carcinoma |
Abstract of study | Salivary duct carcinoma (SDC) is an aggressive neoplasm that resembles high-grade invasive ductal carcinoma of the breast. It can develop de novo or from the malignant transformation of pleomorphic adenoma (PA). We performed immunohistochemical stains for phosphatase and tensin homologue [PTEN androgen receptor (AR)], HER2/neu, cytokeratin 5/6, estrogen receptor-beta, high-mobility group AT-hook 2 (HMGA2), and pleomorphic adenoma gene 1 (PLAG1) on tissue microarray samples of 75 SDCs and 31 adenocarcinomas, not otherwise specified (NOS). Our data showed the following in SDC samples: loss of PTEN was found in 17 of 60 (28.3%); AR was expressed in 43 of 62 (69.4%); HER2/neu was overexpressed in 25 of 58 (43.1%); cytokeratin 5/6 was expressed in 14 of 54 (25.9%); estrogen receptor-beta was expressed in 37 of 56 (66.1%); HMGA2 was expressed in 29 of 63 (46.0%); and PLAG1 was expressed in 0 of 62 (0%). In addition, there was no statistically significant difference in the age at onset between patients with HMGA2-positive SDCs (range 32-85 years; mean: 64.3 years; median: 64.5 years) and those with HMGA2-negative SDCs (range 41-79 years; mean: 62.5 years; median: 64.5 years). There was also no statistically significant difference in overall survival between patients with HMGA2-positive and HMGA2-negative SDCs (follow-up period range 3-201 months; mean: 49.8 months; median: 30 months). Among 10 patients with a definite PA component (SDC ex-PA), 6 were positive and 4 were negative for HMGA2. Our data were consistent with previous findings that AR and estrogen receptor-beta are expressed in most SDCs, whereas HER2/neu overexpression and loss of PTEN are expressed in a subset of SDCs. In our cohort of patients, HMGA2 was expressed in approximately half of SDCs. HMGA2 and PTEN are promising therapeutic targets for salivary gland tumors. |