| Primary information |
|---|
| SALID | SAL_25365 |
| Biomarker name | mammaglobin |
| Biomarker Type | Diagnostic |
| Sampling Method | Retrospective study of 111 salivary gland carcinomas revealed 37 cases with secretory features and growth pattern resembling secretory carcinoma of breast |
| Collection Method | The criteria included a microcystic, macrocystic and papillary growth patterns, light pink to colloidlike homogenous intraluminal and intracytoplasmic secretions, neoplastic cells with eosinophilic and bubbly cytoplasm |
| Analysis Method | RT-PCR |
| Collection Site | Whole Saliva |
| Disease Category | Cancer |
| Disease/Condition | salivary gland tumor |
| Disease Subtype | Mammary analogue secretory carcinoma (MASC) |
| Fold Change/ Concentration | NA |
| Up/Downregulated | C0-expression Upregulatedregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 28781197 |
| Year of Publication | 2017 |
| Biomarker ID | SCGB2A2 |
| Biomarker Category | Gene |
| Sequence | ACAGCGGCTTCCTTGATCCTTGCCACCCGCGACTGAACACCGACAGCAGCAGCCTCACCATGAAGTTGCTGATGGTCCTCATGCTGGCGGCCCTCTCCCAGCACTGCTACGCAGGCTCTGGCTGCCCCTTATTGGAGAATGTGATTTCCAAGACAATCAATCCACAAGTGTCTAAGACTGAATACAAAGAACTTCTTCAAGAGTTCATAGACGACAATGCCACTACAAATGCCATAGATGAATTGAAGGAATGTTTTCTTAACCAAACGGATGAAACTCTGAGCAATGTTGAGGTGTTTATGCAATTAATATATGACAGCAGTCTTTGTGATTTATTTTAACTTTCTGCAAGACCTTTGGCTCACAGAACTGCAGGGTATGGTGAGAAACCAACTACGGATTGCTGCAAACCACACCTTCTCTTTCTTATGTCTTTTTACTACAAACTACAAGACAATTGTTGAAACCTGCTATACATGTTTATTTTAATAAATTGATGGCAAAAA |
| Title of study | Clinicopathologic and molecular characterization of mammary analogue secretory carcinoma of salivary gland origin |
| Abstract of study | BACKGROUND: Mammary analogue secretory carcinoma (MASC) is a newly recognized salivary gland tumor that harbors a characteristic balanced chromosomal translocation t (12; 15) (p13; q25) resulting in an ETV6-NTRK3 fusion gene.METHODS: Retrospective study of 111 salivary gland carcinomas revealed 37 cases with secretory features and growth patterns resembling secretory carcinoma of breast. These 37 cases were originally diagnosed as acinic cell carcinoma, adenocarcinoma not otherwise specified and cystadenocarcinoma. Positive immunostaining for S-100 protein and mammaglobin, followed by detection of ETV6 gene rearrangement by FISH and/or ETV6-NTRK3 fusion transcript by RT-PCR were used to identify MASCs.RESULTS: In the cohort of 37 salivary carcinomas with secretory features we have identified 10 cases of MASC. All 10 MASCs were positive for mammaglobin, S-100 protein and SOX10, while staining for DOG1 and p63 protein were mostly absent. In 7/10 cases, both FISH and RT-PCR were positive while three remaining cases showed break of ETV6 gene by FISH analysis and the RT-PCR was negative. Clinical follow-up data were obtained in 6 out of 10 patients with MASC. In 3 patients cervical lymph node metastases developed, one patient with high grade transformed MASC died with multiple distant bone metastases, and local recurrence was observed in three patients.CONCLUSION: Our clinicopathological data are in keeping with previous studies; in most cases, MASC is a low-grade malignancy with overall favorable prognosis. In rare cases, however, MASC with high-grade transformation may behave aggressively, and these patients could benefit from targeted biological treatment using tyrosine kinase inhibitors. |