Primary information |
---|
SALID | SAL_25361 |
Biomarker name | IL-6 |
Biomarker Type | Diagnostic |
Sampling Method | 31 children suffering with pyelonephritis. A control group of nine children with no common health disorders was also included |
Collection Method | NA |
Analysis Method | qRT-PCR |
Collection Site | Whole Saliva |
Disease Category | Healthy |
Disease/Condition | Healthy |
Disease Subtype | NA |
Fold Change/ Concentration | NA |
Up/Downregulated | NA |
Exosomal | NA |
Organism | Homo sapiens |
PMID | 31881666 |
Year of Publication | 2019 |
Biomarker ID | IL6 |
Biomarker Category | Gene |
Sequence | ATTCTGCCCTCGAGCCCACCGGGAACGAAAGAGAAGCTCTATCTCCCCTCCAGGAGCCCAGCTATGAACTCCTTCTCCACAAGCGCCTTCGGTCCAGTTGCCTTCTCCCTGGGGCTGCTCCTGGTGTTGCCTGCTGCCTTCCCTGCCCCAGTACCCCCAGGAGAAGATTCCAAAGATGTAGCCGCCCCACACAGACAGCCACTCACCTCTTCAGAACGAATTGACAAACAAATTCGGTACATCCTCGACGGCATCTCAGCCCTGAGAAAGGAGACATGTAACAAGAGTAACATGTGTGAAAGCAGCAAAGAGGCACTGGCAGAAAACAACCTGAACCTTCCAAAGATGGCTGAAAAAGATGGATGCTTCCAATCTGGATTCAATGAGGAGACTTGCCTGGTGAAAATCATCACTGGTCTTTTGGAGTTTGAGGTATACCTAGAGTACCTCCAGAACAGATTTGAGAGTAGTGAGGAACAAGCCAGAGCTGTGCAGATGAGTACAAAAGTCCTGATCCAGTTCCTGCAGAAAAAGGCAAAGAATCTAGATGCAATAACCACCCCTGACCCAACCACAAATGCCAGCCTGCTGACGAAGCTGCAGGCACAGAACCAGTGGCTGCAGGACATGACAACTCATCTCATTCTGCGCAGCTTTAAGGAGTTCCTGCAGTCCAGCCTGAGGGCTCTTCGGCAAATGTAGCATGGGCACCTCAGATTGTTGTTGTTAATGGGCATTCCTTCTTCTGGTCAGAAACCTGTCCACTGGGCACAGAACTTATGTTGTTCTCTATGGAGAACTAAAAGTATGAGCGTTAGGACACTATTTTAATTATTTTTAATTTATTAATATTTAAATATGTGAAGCTGAGTTAATTTATGTAAGTCATATTTATATTTTTAAGAAGTACCACTTGAAACATTTTATGTATTAGTTTTGAAATAATAATGGAAAGTGGCTATGCAGTTTGAATATCCTTTGTTTCAGAGCCAGATCATTTCTTGGAAAGTGTAGGCTTACCTCAAATAAATGGCTAACTTATACATATTTTTAAAGAAATATTTATATTGTATTTATATAATGTATAAATGGTTTTTATACCAATAAATGGCATTTTAAAAAATTCA |
Title of study | Association of mRNA Levels of IL6, MMP-8, GSS in Saliva and Pyelonephritis in Children |
Abstract of study | Nowadays, saliva is a subject of growing scientific interest because of its definite advantages as diagnostic medium. The aim of our study was to investigate the diagnostic potential and reliability of messenger RNAs (mRNAs) of selected genes-interleukin-6 (IL-6), matrix metalloproteinase-8 (MMP-8) and glutathione synthetase (GSS)-as salivary markers in children with diagnosed pyelonephritis and to correlate their levels with typical urine para-clinical indicators of the disease. Analysis of the mRNA levels for IL-6, MMP-8 and GSS in 28 children hospitalized with the diagnosis of pyelonephritis was conducted applying the method of quantitative reverse transcription polymerase chain reaction (RT-qPCR). In the study group (n = 28), IL-6 mRNA levels demonstrated 64-fold increase (p < 0.001). MMP-8 and GSS mRNA levels were increased in 12 samples in patients with pyelonephritis 3.27 (p < 0.01) and 1.94 (p < 0.001) times, respectively. We found a strong and significant correlation (p < 0.001) between the investigated mRNA for IL-6 and MMP-8, IL-6 and GSS, MMP-8 and GSS. Moderate degree of correlation was established between IL-6 and the typical para-clinical indicator of leucocytes (0.43, p < 0.05) and between GSS and leucocytes (0.54, p < 0.01). Salivary IL-6, MMP-8 and GSS mRNA levels in combination with urine test analysis could be useful diagnostic tool for the very distributed disorder of pyelonephritis in childhood. |