Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_25331 details
Primary information
SALIDSAL_25331
Biomarker nameEWSR1-ATF1
Biomarker TypeDiagnostic
Sampling MethodA 49-year-old man had circumscribed solid mass 2.9 cm in size located closely adjacent to the right sublingual gland. The mass was clinically diagnosed as a right sublingual gland tumor classified as cT2N0M0: cStage II
Collection MethodNA
Analysis MethodRT-PCR
Collection SiteWhole Saliva
Disease CategoryCancer
Disease/ConditionNeoplasm of the salivary gland
Disease SubtypeClear cell sarcoma
Fold Change/ ConcentrationNA
Up/DownregulatedNA
ExosomalNA
OrganismHomo sapiens
PMID28412212
Year of Publication2017
Biomarker IDEWSR1ATF1
Biomarker CategoryGene
SequenceCGCTGGAGAGCGAGGTGGCTTCAATAAGCCTGGTGAAAAATTTTGAAAGACTTATCTTCTGAAGATACACGGGGCAGAAAAGGAGACGGAGAAAATTCTGGAGTTTCTGCTGCTGTCACTTCTATGTCTGTTCCAACTCCCATCTATCAGACTAGCAGCGGACAGTACA
Title of studyMucoepidermoid carcinoma with extensive spindled morphology and melanocytic marker expression
Abstract of studyMucoepidermoid carcinoma (MEC) is the most common malignant neoplasm of the salivary gland. Albeit common, histologic variants have rarely been noted in MEC. Here, we report a 49-year-old man with a sublingual gland tumor. Histologically, the tumor was composed of spindle cells arranged in interlacing fascicules or globular nests. A few bland small glands containing mucous cells were also scattered. The spindle tumor cells completely lacked immunoreactivity for cytokeratin, and exhibited immunoreactivity for vimentin, S-100, HMB-45, Melan A, and SOX10. The tumor was initially suspected to be clear cell sarcoma, malignant melanoma, or perivascular epithelioid cell tumor with a few entrapped nonneoplastic duct epitheliums. However, reverse-transcription polymerase chain reaction revealed the CRTC3-MAML2 fusion gene product diagnostic of MEC. In fact, a very minor component of the epithelial cells was reminiscent of conventional MEC, whereas major spindled tumor cells possessed markedly altered differentiation. This is the first case report of MEC with extensive spindled morphology and melanocytic marker expression.