Primary information |
---|
SALID | SAL_25316 |
Biomarker name | PCNA |
Biomarker Type | Diagnostic |
Sampling Method | From representative blocks of each case, 3-ÔøΩm thick sections were used for the immunohistochemical studies with antibodies |
Collection Method | Six tumors arose in the parotid gland, one in the accessory parotid gland, one in the submaxillary gland and two in the minor salivary gland of the palate |
Analysis Method | Immunohistochemistry |
Collection Site | Whole Saliva |
Disease Category | Cancer |
Disease/Condition | adenocarcinoma |
Disease Subtype | NA |
Fold Change/ Concentration | NA |
Up/Downregulated | Upregulated |
Exosomal | NA |
Organism | Homo sapiens |
PMID | 17310348 |
Year of Publication | 2007 |
Biomarker ID | PCNA |
Biomarker Category | Gene |
Sequence | GGATGGCCGGAGCTGGCGCCCTGGTTCTGGAGGTAACCGGTTACTGAGGGCGAGAAGCGCCACCCGGAGGCTCTAGCCTGACAAATGCTTGCTGACCTGGGCCAGAGCTCTTCCCTTACGCAAGTCTCAGCCGGTCGTCGCGACGTTCGCCCGCTCGCTCTGAGGCTCCTGAAGCCGAAACCAGCTAGACTTTCCTCCTTCCCGCCTGCCTGTAGCGGCGTTGTTGCCACTCCGCCACCATGTTCGAGGCGCGCCTGGTCCAGGGCTCCATCCTCAAGAAGGTGTTGGAGGCACTCAAGGACCTCATCAACGAGGCCTGCTGGGATATTAGCTCCAGCGGTGTAAACCTGCAGAGCATGGACTCGTCCCACGTCTCTTTGGTGCAGCTCACCCTGCGGTCTGAGGGCTTCGACACCTACCGCTGCGACCGCAACCTGGCCATGGGCGTGAACCTCACCAGTATGTCCAAAATACTAAAATGCGCCGGCAATGAAGATATCATTACACTAAGGGCCGAAGATAACGCGGATACCTTGGCGCTAGTATTTGAAGCACCAAACCAGGAGAAAGTTTCAGACTATGAAATGAAGTTGATGGATTTAGATGTTGAACAACTTGGAATTCCAGAACAGGAGTACAGCTGTGTAGTAAAGATGCCTTCTGGTGAATTTGCACGTATATGCCGAGATCTCAGCCATATTGGAGATGCTGTTGTAATTTCCTGTGCAAAAGACGGAGTGAAATTTTCTGCAAGTGGAGAACTTGGAAATGGAAACATTAAATTGTCACAGACAAGTAATGTCGATAAAGAGGAGGAAGCTGTTACCATAGAGATGAATGAACCAGTTCAACTAACTTTTGCACTGAGGTACCTGAACTTCTTTACAAAAGCCACTCCACTCTCTTCAACGGTGACACTCAGTATGTCTGCAGATGTACCCCTTGTTGTAGAGTATAAAATTGCGGATATGGGACACTTAAAATACTACTTGGCTCCCAAGATCGAGGATGAAGAAGGATCTTAGGCATTCTTAAAATTCAAGAAAATAAAACTAAGCTCTTTGAGAACTGCTTCTAAGATGCCAGCATATACTGAAGTCTTTTCTGTCACCAAATTTGTACCTCTAAGTACATATGTAGATATTGTTTTCTGTAAATAACCTATTTTTTTCTCTATTCTCTGCAATTTGTTTAAAGAATAAAGTCCAAAGTCAGATCTGGTCTAGTTAACCTAGAAGTATTTTTGTCTCTTAGAAATACTTGTGATTTTTATAATACAAAAGGGTCTTGACTCTAAATGCAGTTTTAAGAATTGTTTTTGAATTTAAATAAAGTTACTTGAATTTCAAACATCA |
Title of study | Carcinoma ex pleomorphic adenoma of the salivary gland: an immunohistochemical study |
Abstract of study | The proliferative activity of the tumor cells and the expression of tumor-associated genes and sex steroid hormone receptors were investigated immunohistochemically in ten cases of carcinoma ex pleomorphic adenoma (Ca-ex-PA) of the salivary glands. These were analyzed in benign and malignant components separately, and then were compared with ten cases of the other malignant tumors [adenocarcinomas, not otherwise specified (ACN) and salivary duct carcinomas (SDC)] and ten cases of pleomorphic adenomas (PA). The results obtained in this study were as follows: (1) malignant component of Ca-ex-PA showed a higher incidence of PCNA and Ki67 than benign component of Ca-ex-PA. A significant difference between benign component of Ca-ex-PA and PA was not observed. (2) A significant difference in the incidence of p53, c-erbB-2, EGFR overexpression was observed only between malignant component of Ca-ex-PA and benign component of Ca-ex-PA. (3) The incidence of PCNA, Ki67, p53, c-erbB-2 overexpression in malignant component of Ca-ex-PA showed the highest data among the four groups. These results suggest that Ca-ex-PA acquired the particular biological behavior in contrast to the other salivary neoplasms in the long-standing process while PA undergoes malignant transformation. |