| Primary information |
|---|
| SALID | SAL_25311 |
| Biomarker name | PCNA |
| Biomarker Type | Diagnostic |
| Sampling Method | From representative blocks of each case, 3-ÔøΩm thick sections were used for the immunohistochemical studies with antibodies |
| Collection Method | Six tumors arose in the parotid gland, one in the accessory parotid gland, one in the submaxillary gland and two in the minor salivary gland of the palate |
| Analysis Method | Immunohistochemistry |
| Collection Site | Whole Saliva |
| Disease Category | Cancer |
| Disease/Condition | carcinoma ex pleomorphic adenoma |
| Disease Subtype | NA |
| Fold Change/ Concentration | NA |
| Up/Downregulated | Upregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 17310348 |
| Year of Publication | 2007 |
| Biomarker ID | PCNA |
| Biomarker Category | Gene |
| Sequence | GGATGGCCGGAGCTGGCGCCCTGGTTCTGGAGGTAACCGGTTACTGAGGGCGAGAAGCGCCACCCGGAGGCTCTAGCCTGACAAATGCTTGCTGACCTGGGCCAGAGCTCTTCCCTTACGCAAGTCTCAGCCGGTCGTCGCGACGTTCGCCCGCTCGCTCTGAGGCTCCTGAAGCCGAAACCAGCTAGACTTTCCTCCTTCCCGCCTGCCTGTAGCGGCGTTGTTGCCACTCCGCCACCATGTTCGAGGCGCGCCTGGTCCAGGGCTCCATCCTCAAGAAGGTGTTGGAGGCACTCAAGGACCTCATCAACGAGGCCTGCTGGGATATTAGCTCCAGCGGTGTAAACCTGCAGAGCATGGACTCGTCCCACGTCTCTTTGGTGCAGCTCACCCTGCGGTCTGAGGGCTTCGACACCTACCGCTGCGACCGCAACCTGGCCATGGGCGTGAACCTCACCAGTATGTCCAAAATACTAAAATGCGCCGGCAATGAAGATATCATTACACTAAGGGCCGAAGATAACGCGGATACCTTGGCGCTAGTATTTGAAGCACCAAACCAGGAGAAAGTTTCAGACTATGAAATGAAGTTGATGGATTTAGATGTTGAACAACTTGGAATTCCAGAACAGGAGTACAGCTGTGTAGTAAAGATGCCTTCTGGTGAATTTGCACGTATATGCCGAGATCTCAGCCATATTGGAGATGCTGTTGTAATTTCCTGTGCAAAAGACGGAGTGAAATTTTCTGCAAGTGGAGAACTTGGAAATGGAAACATTAAATTGTCACAGACAAGTAATGTCGATAAAGAGGAGGAAGCTGTTACCATAGAGATGAATGAACCAGTTCAACTAACTTTTGCACTGAGGTACCTGAACTTCTTTACAAAAGCCACTCCACTCTCTTCAACGGTGACACTCAGTATGTCTGCAGATGTACCCCTTGTTGTAGAGTATAAAATTGCGGATATGGGACACTTAAAATACTACTTGGCTCCCAAGATCGAGGATGAAGAAGGATCTTAGGCATTCTTAAAATTCAAGAAAATAAAACTAAGCTCTTTGAGAACTGCTTCTAAGATGCCAGCATATACTGAAGTCTTTTCTGTCACCAAATTTGTACCTCTAAGTACATATGTAGATATTGTTTTCTGTAAATAACCTATTTTTTTCTCTATTCTCTGCAATTTGTTTAAAGAATAAAGTCCAAAGTCAGATCTGGTCTAGTTAACCTAGAAGTATTTTTGTCTCTTAGAAATACTTGTGATTTTTATAATACAAAAGGGTCTTGACTCTAAATGCAGTTTTAAGAATTGTTTTTGAATTTAAATAAAGTTACTTGAATTTCAAACATCA |
| Title of study | Carcinoma ex pleomorphic adenoma of the salivary gland: an immunohistochemical study |
| Abstract of study | The proliferative activity of the tumor cells and the expression of tumor-associated genes and sex steroid hormone receptors were investigated immunohistochemically in ten cases of carcinoma ex pleomorphic adenoma (Ca-ex-PA) of the salivary glands. These were analyzed in benign and malignant components separately, and then were compared with ten cases of the other malignant tumors [adenocarcinomas, not otherwise specified (ACN) and salivary duct carcinomas (SDC)] and ten cases of pleomorphic adenomas (PA). The results obtained in this study were as follows: (1) malignant component of Ca-ex-PA showed a higher incidence of PCNA and Ki67 than benign component of Ca-ex-PA. A significant difference between benign component of Ca-ex-PA and PA was not observed. (2) A significant difference in the incidence of p53, c-erbB-2, EGFR overexpression was observed only between malignant component of Ca-ex-PA and benign component of Ca-ex-PA. (3) The incidence of PCNA, Ki67, p53, c-erbB-2 overexpression in malignant component of Ca-ex-PA showed the highest data among the four groups. These results suggest that Ca-ex-PA acquired the particular biological behavior in contrast to the other salivary neoplasms in the long-standing process while PA undergoes malignant transformation. |