Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_25304 details
Primary information
SALIDSAL_25304
Biomarker nameEGFR
Biomarker TypeDiagnostic
Sampling MethodNA
Collection MethodNA
Analysis MethodPCR
Collection SiteWhole Saliva
Disease CategoryCancer
Disease/ConditionHead and neck tumor
Disease SubtypeNA
Fold Change/ ConcentrationNA
Up/DownregulatedUpregulated
ExosomalNA
OrganismHomo sapiens
PMID20237991
Year of Publication2010
Biomarker IDEGFR
Biomarker CategoryGene
SequenceAGACGTCCGGGCAGCCCCCGGCGCAGCGCGGCCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCCCGACGCGGCCGAGGCGGCCGGAGTCCCGAGCTAGCCCCGGCGGCCGCCGCCGCCCAGACCGGACGACAGGCCACCTCGTCGGCGTCCGCCCGAGTCCCCGCCTCGCCGCCAACGCCACAACCACCGCGCACGGCCCCCTGACTCCGTCCAGTATTGATCGGGAGAGCCGGAGCGAGCTCTTCGGGGAGCAGCGATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCCTGGCGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGAAAAGAAAGTTTGCCAAGGCACGAGTAACAAGCTCACGCAGTTGGGCACTTTTGAAGATCATTTTCTCAGCCTCCAGAGGATGTTCAATAACTGTGAGGTGGTCCTTGGGAATTTGGAAATTACCTATGTGCAGAGGAATTATGATCTTTCCTTCTTAAAGACCATCCAGGAGGTGGCTGGTTATGTCCTCATTGCCCTCAACACAGTGGAGCGAATTCCTTTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAGAGCATCCAGTGGCGGGACATAGTCAGCAGTGACTTTCTCAGCAACATGTCGATGGACTTCCAGAACCACCTGGGCAGCTGCCAAAAGTGTGATCCAAGCTGTCCCAATGGGAGCTGCTGGGGTGCAGGAGAGGAGAACTGCCAGAAACTGACCAAAATCATCTGTGCCCAGCAGTGCTCCGGGCGCTGCCGTGGCAAGTCCCCCAGTGACTGCTGCCACAACCAGTGTGCTGCAGGCTGCACAGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAATTCCGAGACGAAGCCACGTGCAAGGACACCTGCCCCCCACTCATGCTCTACAACCCCACCACGTACCAGATGGATGTGAACCCCGAGGGCAAATACAGCTTTGGTGCCACCTGCGTGAAGAAGTGTCCCCGTAATTATGTGGTGACAGATCACGGCTCGTGCGTCCGAGCCTGTGGGGCCGACAGCTATGAGATGGAGGAAGACGGCGTCCGCAAGTGTAAGAAGTGCGAAGGGCCTTGCCGCAAAGTGTGTAACGGAATAGGTATTGGTGAATTTAAAGACTCACTCTCCATAAATGCTACGAATATTAAACACTTCAAAAACTGCACCTCCATCAGTGGCGATCTCCACATCCTGCCGGTGGCATTTAGGGGTGACTCCTTCACACATACTCCTCCTCTGGATCCACAGGAACTGGATATTCTGAAAACCGTAAAGGAAATCACAGGTTTGAGCTGAATTATCACATGAATATAAATGGGAAATCAGTGTTTTAGAGAGAGAACTTTTCGACATATTTCCTGTTCCCTTGGAATAAAAACATTTCTTCTGAAA
Title of studyIntegration of biomarkers including molecular targeted therapies in head and neck cancer
Abstract of studyHead and neck tumors comprise a wide spectrum of heterogeneous neoplasms for which biomarkers are needed to aid in earlier diagnosis, risk assessment and therapy response. The search for biomarkers includes evaluation of tumor tissues and surrogate materials by molecular, genomic and phenotypic means. Ideal biomarkers should be accurate and easy to perform, highly specific, objective, quantitative, and cost effective. Because of the heterogeneity of head and neck tumors, the integration of multiple selected markers in association with the histopathologic features is advocated for risk assessment. For targeted therapy, however, a single key molecule must be identified. Key molecules and pathways for targeted therapy include growth factor receptors, MAPk/ERk pathway, angiogenesis, and epithelial to mesenchymal transition. Over-expression and mutations of genes in these pathways including EGFR, VEGF, HER2, BRAF and RET, contribute to tumorigenesis in head and neck cancers from squamous carcinomas, to salivary adenocarcinomas and thyroid carcinomas, both follicular and c-cell derived. Monoclonal antibodies to the EGFR receptor and oral tyrosine kinase inhibitors are currently being studied in multiple phase II and III clinical trials to determine their efficacy in head and neck cancers and correlative studies for biomarkers are on-going.