| Primary information |
|---|
| SALID | SAL_25302 |
| Biomarker name | EGR1 |
| Biomarker Type | Diagnostic |
| Sampling Method | Study locations are areas known to be contaminated with arsenic as a result of tin-mining three decades ago. Healthy, nonsmokers pregnant women were recruited as study subjects. |
| Collection Method | DNA isolation from saliva samples was carried out using the PrepIT-L2P kit (DNA Genotek Inc., Canada) |
| Analysis Method | Pyrosequencing |
| Collection Site | Whole Saliva |
| Disease Category | Chemical Exposure |
| Disease/Condition | Prenatal arsenic exposure |
| Disease Subtype | NA |
| Fold Change/ Concentration | NA |
| Up/Downregulated | Upregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 28025110 |
| Year of Publication | 2017 |
| Biomarker ID | EGR1 |
| Biomarker Category | Gene |
| Sequence | ATGGCCGCGGCCAAGGCCGAGATGCAGCTGATGTCCCCGCTGCAGATCTCTGACCCGTTCGGATCCTTTCCTCACTCGCCCACCATGGACAACTACCCTAAGCTGGAGGAGATGATGCTGCTGAGCAACGGGGCTCCCCAGTTCCTCGGCGCCGCCGGGGCCCCAGAGGGCAGCGGCAGCAACAGCAGCAGCAGCAGCAGCGGGGGCGGTGGAGGCGGCGGGGGCGGCAGCAACAGCAGCAGCAGCAGCAGCACCTTCAACCCTCAGGCGGACACGGGCGAGCAGCCCTACGAGCACCTGACCGCAGAGTCTTTTCCTGACATCTCTCTGAACAACGAGAAGGTGCTGGTGGAGACCAGTTACCCCAGCCAAACCACTCGACTGCCCCCCATCACCTATACTGGCCGCTTTTCCCTGGAGAGCCGCACCCAGCAGCCTTCGCTAACCCCTCTGTCTACTATTAAGGCCTTTGCCACTCAGTCGGGCTCCCAGGACCTGAAGGCCCTCAATACCAGCTACCAGTCCCAGCTCATCAAACCCAGCCGCATGCGCAAGTACCCCAACCGGCCCAGCAAGACGCCCCCCCACGAACGCCCTTACGCTTGCCCAGTGGAGTCCTGTGATCGCCGCTTCTCCCGCTCCGACGAGCTCACCCGCCACATCCGCATCCACACAGGCCAGAAGCCCTTCCAGTGCCGCATCTGCATGCGCAACTTCAGCCGCAGCGACCACCTCACCACCCACATCCGCACCCACACAGGCGAAAAGCCCTTCGCCTGCGACATCTGTGGAAGAAAGTTTGCCAGGAGCGATGAACGCAAGAGGCATACCAAGATCCACTTGCGGCAGAAGGACAAGAAAGCAGACAAAAGTGTTGTGGCCTCTTCGGCCACCTCCTCTCTCTCTTCCTACCCGTCCCCGGTTGCTACCTCTTACCCGTCCCCGGTTACTACCTCTTATCCATCCCCGGCCACCACCTCATACCCATCCCCTGTGCCCACCTCCTTCTCCTCTCCCGGCTCCTCGACCTACCCATCCCCTGTGCACAGTGGCTTCCCCTCCCCGTCGGTGGCCACCACGTACTCCTCTGTTCCCCCTGCTTTCCCGGCCCAGGTCAGCAGCTTCCCTTCCTCAGCTGTCACCAACTCCTTCAGCGCCTCCACAGGGCTTTCGGACATGACAGCAACCTTTTCTCCCAGGACAATTGAAATTTGCTAA |
| Title of study | Hypomethylation of inflammatory genes (COX2, EGR1, and SOCS3) and increased urinary 8-nitroguanine in arsenic-exposed newborns and children |
| Abstract of study | Early-life exposure to arsenic increases risk of developing a variety of non-malignant and malignant diseases. Arsenic-induced carcinogenesis may be mediated through epigenetic mechanisms and pathways leading to inflammation. Our previous study reported that prenatal arsenic exposure leads to increased mRNA expression of several genes related to inflammation, including COX2, EGR1, and SOCS3. This study aimed to investigate the effects of arsenic exposure on promoter DNA methylation and mRNA expression of these inflammatory genes (COX2, EGR1, and SOCS3), as well as the generation of 8-nitroguanine, which is a mutagenic DNA lesion involved in inflammation-related carcinogenesis. Prenatally arsenic-exposed newborns had promoter hypomethylation of COX2, EGR1, and SOCS3 in cord blood lymphocytes (p<0.01). A follow-up study in these prenatally arsenic-exposed children showed a significant hypomethylation of these genes in salivary DNA (p<0.01). In vitro experiments confirmed that arsenite treatment at short-term high doses (10-100μM) and long-term low doses (0.5-1μM) in human lymphoblasts (RPMI 1788) caused promoter hypomethylation of these genes, which was in concordance with an increase in their mRNA expression. Additionally, the level of urinary 8-nitroguanine was significantly higher (p<0.01) in exposed newborns and children, by 1.4- and 1.8-fold, respectively. Arsenic accumulation in toenails was negatively correlated with hypomethylation of these genes and positively correlated with levels of 8-nitroguanine. These results indicated that early-life exposure to arsenic causes hypomethylation of COX2, EGR1, and SOCS3, increases mRNA expression of these genes, and increases 8-nitroguanine formation. These effects may be linked to mechanisms of arsenic-induced inflammation and cancer development later in life. |