Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_25291 details
Primary information
SALIDSAL_25291
Biomarker nameTNFSF6
Biomarker TypeDiagnostic
Sampling MethodNine patients with SS, recruited from Haukeland University Hospital, and 10 healthy subjects participated in the study
Collection MethodTotal cellular RNA was extracted using TRIzol LS reagent
Analysis MethodRT-PCR
Collection SiteWhole Saliva
Disease CategoryAutoimmune Disorder
Disease/ConditionSjogren's Syndrome
Disease SubtypeNA
Fold Change/ Concentration8.8
Up/DownregulatedUpregulated
ExosomalNA
OrganismHomo sapiens
PMID12528117
Year of Publication2003
Biomarker IDTNFSF6
Biomarker CategoryGene
SequenceATGCAGCAGCCCTTCAATTACCCATATCCCCAGATCTACTGGGTGGACAGCAGTGCCAGCTCTCCCTGGGCCCCTCCAGGCACAGTTCTTCCCTGTCCAACCTCTGTGCCCAGAAGGCCTGGTCAAAGGAGGCCACCACCACCACCGCCACCGCCACCACTACCACCTCCGCCGCCGCCGCCACCACTGCCTCCACTACCGCTGCCACCCCTGAAGAAGAGAGGGAACCACAGCACAGGCCTGTGTCTCCTTGTGATGTTTTTCATGGTTCTGGTTGCCTTGGTAGGATTGGGCCTGGGGATGTTTCAGCTCTTCCACCTACAGAAGGAGCTGGCAGAACTCCGAGAGTCTACCAGCCAGATGCACACAGCATCATCTTTGGAGAAGCAAATAGGCCACCCCAGTCCACCCCCTGAAAAAAAGGAGCTGAGGAAAGTGGCCCATTTAACAGGCAAGTCCAACTCAAGGTCCATGCCTCTGGAATGGGAAGACACCTATGGAATTGTCCTGCTTTCTGGAGTGAAGTATAAGAAGGGTGGCCTTGTGATCAATGAAACTGGGCTGTACTTTGTATATTCCAAAGTATACTTCCGGGGTCAATCTTGCAACAACCTGCCCCTGAGCCACAAGGTCTACATGAGGAACTCTAAGTATCCCCAGGATCTGGTGATGATGGAGGGGAAGATGATGAGCTACTGCACTACTGGGCAGATGTGGGCCCGCAGCAGCTACCTGGGGGCAGTGTTCAATCTTACCAGTGCTGATCATTTATATGTCAACGTATCTGAGCTCTCTCTGGTCAATTTTGAGGAATCTCAGACGTTTTTCGGCTTATATAAGCTCTAA
Title of studyIncreased salivary gland tissue expression of Fas, Fas ligand, cytotoxic T lymphocyte-associated antigen 4, and programmed cell death 1 in primary Sjögren's syndrome
Abstract of studyOBJECTIVE: To assess salivary gland tissues obtained from patients with primary Sjögren's syndrome (SS) for the gene expression profile of the candidate genes TNFRSF6 (Fas), TNFSF6 (FasL), SSA1 (Ro52 alpha and the splice variant Ro52 beta), SSB (La), CTLA4, PDCD1 (PD-1), and ORM2, which were selected on the basis of their putative participation in salivary gland inflammation.METHODS: Quantitative real-time reverse transcriptase-polymerase chain reaction (RT-PCR) was used to examine the expression of messenger RNA (mRNA). Tissue localization of the expressed proteins was detected by immunohistochemistry.RESULTS: Expression of mRNA was increased for Fas (5.1-fold; P < 0.001), FasL (8.8-fold; P < 0.05), cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) (11.2-fold; P < 0.01), programmed cell death 1 (PD-1) (15.2-fold; P < 0.05), Ro52 alpha (3.0-fold; P < 0.01), La (2.3-fold; P < 0.05), and orosomucoid 2 (ORM2) (4.4-fold; P < 0.05) in patients compared with controls when GAPDH was used as endogenous standard in duplex runs. In single runs using 2 other endogenous standards (18S and beta-actin), statistically significant differences between patients and controls were confirmed for expression of Fas, FasL, CTLA-4, and PD-1, but this difference was not observed for Ro52 alpha, La, and ORM2. Expression of Ro52 beta mRNA was similar in patients and controls.CONCLUSION: The present study demonstrates a substantial increase in expression of the negative regulator molecules PD-1 and CTLA-4 and the apoptotic signal molecules Fas and FasL in patients with primary SS compared with controls, which corresponded to the immunomorphologic pattern. The results strongly indicate that these molecules have central roles in the inflammatory process in the salivary glands of patients with primary SS.