Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_25286 details
Primary information
SALIDSAL_25286
Biomarker nameS100P
Biomarker TypeDiagnostic
Sampling MethodThirty-two patients with documented primary T1 or T2 OSCC were included in this study. All of the patients had recently received diagnoses of primary disease
Collection MethodUnstimulated saliva samples were collected between 9 a.m. and 10 a.m. with previously established protocols
Analysis MethodqPCR
Collection SiteWhole Saliva
Disease CategoryCancer
Disease/ConditionOral Cancer
Disease SubtypeNA
Fold Change/ Concentration4.88
Up/DownregulatedUpregulated
ExosomalNA
OrganismHomo sapiens
PMID21508360
Year of Publication2011
Biomarker IDS100P
Biomarker CategoryGene
SequenceACATTTTCTCGGCCCTGCCAGCCCCCAGGAGGAAGGTGGGTCTGAATCTAGCACCATGACGGAACTAGAGACAGCCATGGGCATGATCATAGACGTCTTTTCCCGATATTCGGGCAGCGAGGGCAGCACGCAGACCCTGACCAAGGGGGAGCTCAAGGTGCTGATGGAGAAGGAGCTACCAGGCTTCCTGCAGAGTGGAAAAGACAAGGATGCCGTGGATAAATTGCTCAAGGACCTGGACGCCAATGGAGATGCCCAGGTGGACTTCAGTGAGTTCATAGTGTTCGTGGCTGCAATCACGTCTGCCTGTCACAAGTACTTTGAGAAGGCAGGACTCAAATGATGCCCTGGAGATGTCACAGATTCCTGGCAGAGCCATGGTCCCAGGCTTCCCAAAAGTGTTTGTTGGCAATTATTCCCCTAGGCTGAGCCTGCTCATGTACCTCTGATTAATAAATGCTTATGAAATGA
Title of studyBody fluid biomarkers for early detection of head and neck squamous cell carcinomas
Abstract of studyAlong with advancements in treatment, early detection of primary tumor, and relapse seems to remain a key factor for improving the survival rate of patients with head and neck squamous cell carcinoma (HNSCC), in which a high proportion of patients are diagnosed at an advanced stage. Recent advancements in basic research of molecular biology have improved the understanding of the molecular process of HNSCC progression and have led to identification and characterization of numerous biomarkers. Biomarkers of HNSCC are expected to facilitate the early detection of primary, and relapsed tumors. In the present article, we review the recent discoveries of potential biomarkers for the early detection of HNSCC. Most of the promising biomarkers have some limitations in clinical diagnosis. However, salivary interleukin-8 and melanoma-associated gene showed good sensitivity, specificity, convenience, and standardization. As HNSCC is a life-threatening disease, large-scale clinical validation is necessary for these two markers.