| Primary information |
|---|
| SALID | SAL_25271 |
| Biomarker name | HSPC016 |
| Biomarker Type | Diagnostic |
| Sampling Method | Thirty-two patients with documented primary T1 or T2 OSCC were included in this study. All of the patients had recently received diagnoses of primary disease |
| Collection Method | Unstimulated saliva samples were collected between 9 a.m. and 10 a.m. with previously established protocols |
| Analysis Method | Microarray |
| Collection Site | Whole Saliva |
| Disease Category | Cancer |
| Disease/Condition | Oral Cancer |
| Disease Subtype | NA |
| Fold Change/ Concentration | >3 |
| Up/Downregulated | Upregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 21508360 |
| Year of Publication | 2011 |
| Biomarker ID | HSPC016 |
| Biomarker Category | Gene |
| Sequence | GTCCGGTGGCAGGGTCTGGGGAAGCGGCGGCAGGCGCCATGTCCGGCCGCGAAGGTGGCAAGAAGAAGCCACTGAAACAGCCCAAGAAGCAGGCCAAGGAGATGGACGAGGAAGATAAGGCTTTCAAGCAGAAACAAAAAGAGGAGCAGAAGAAACTCGAGGAGCTAAAAGCGAAGGCCGCGGGGAAGGGGCCCTTGGCCACAGGTGGAATTAAGAAATCTGGCAAAAAGTAAGCTGTTCCTTGTGCCTGAGGAGATGGTGACCCTTTATTTCATCTGTATTTAAACCTCTCTATTCCCTGCCATAACATCTTTTGCCACGTATAGCTGGAATTAAGTGTTGTCTTGGAGCTGTTGTACATTTAAGAATAAACTTTTGTAAAAA |
| Title of study | Body fluid biomarkers for early detection of head and neck squamous cell carcinomas |
| Abstract of study | Along with advancements in treatment, early detection of primary tumor, and relapse seems to remain a key factor for improving the survival rate of patients with head and neck squamous cell carcinoma (HNSCC), in which a high proportion of patients are diagnosed at an advanced stage. Recent advancements in basic research of molecular biology have improved the understanding of the molecular process of HNSCC progression and have led to identification and characterization of numerous biomarkers. Biomarkers of HNSCC are expected to facilitate the early detection of primary, and relapsed tumors. In the present article, we review the recent discoveries of potential biomarkers for the early detection of HNSCC. Most of the promising biomarkers have some limitations in clinical diagnosis. However, salivary interleukin-8 and melanoma-associated gene showed good sensitivity, specificity, convenience, and standardization. As HNSCC is a life-threatening disease, large-scale clinical validation is necessary for these two markers. |