Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_25201 details
Primary information
SALIDSAL_25201
Biomarker namehsa-miR-5699-3p
Biomarker TypeNA
Sampling MethodSaliva was obtained from male professional players in England's elite rugby union competition across two seasons (2017-2019).
Collection MethodSaliva (2 mL) was collected in by passive drool in Oragene-RNA RE-100 saliva self-collection kits (DNA Genotek) containing an RNA stabilising solution
Analysis MethodqRT-PCR
Collection SiteSaliva
Disease CategoryNeurological Disorder
Disease/ConditionConcussion
Disease SubtypeNA
Fold Change/ Concentration1.87678849
Up/DownregulatedUpregulated
ExosomalNA
OrganismHomo sapiens
PMID33757972
Year of Publication2021
Biomarker IDhsa-miR-5699-3p
Biomarker CategorymiRNA
SequenceUCCUGUCUUUCCUUGUUGGAGC
Title of studyUnique diagnostic signatures of concussion in the saliva of male athletes: the Study of Concussion in Rugby Union through MicroRNAs (SCRUM)
Abstract of studyOBJECTIVE: To investigate the role of salivary small non-coding RNAs (sncRNAs) in the diagnosis of sport-related concussion.METHODS: Saliva was obtained from male professional players in the top two tiers of England's elite rugby union competition across two seasons (2017-2019). Samples were collected preseason from 1028 players, and during standardised head injury assessments (HIAs) at three time points (in-game, post-game, and 36-48 hours post-game) from 156 of these. Samples were also collected from controls (102 uninjured players and 66 players sustaining a musculoskeletal injury). Diagnostic sncRNAs were identified with next generation sequencing and validated using quantitative PCR in 702 samples. A predictive logistic regression model was built on 2017-2018 data (training dataset) and prospectively validated the following season (test dataset).RESULTS: The HIA process confirmed concussion in 106 players (HIA+) and excluded this in 50 (HIA-). 32 sncRNAs were significantly differentially expressed across these two groups, with let-7f-5p showing the highest area under the curve (AUC) at 36-48 hours. Additionally, a combined panel of 14 sncRNAs (let-7a-5p, miR-143-3p, miR-103a-3p, miR-34b-3p, RNU6-7, RNU6-45, Snora57, snoU13.120, tRNA18Arg-CCT, U6-168, U6-428, U6-1249, Uco22cjg1,YRNA_255) could differentiate concussed subjects from all other groups, including players who were HIA- and controls, immediately after the game (AUC 0.91, 95% CI 0.81 to 1) and 36-48 hours later (AUC 0.94, 95% CI 0.86 to 1). When prospectively tested, the panel confirmed high predictive accuracy (AUC 0.96, 95% CI 0.92 to 1 post-game and AUC 0.93, 95% CI 0.86 to 1 at 36-48 hours).CONCLUSIONS: SCRUM, a large prospective observational study of non-invasive concussion biomarkers, has identified unique signatures of concussion in saliva of male athletes diagnosed with concussion.