| Primary information |
|---|
| SALID | SAL_24879 |
| Biomarker name | hsa-let-7a-5p |
| Biomarker Type | Diagnostic |
| Sampling Method | The test group for this study consisted of 4 patients who were diagnosed with AP, and the control group consisted of 4 patients with healthy periodontia. |
| Collection Method | 2-3 mL of unstimulated whole saliva was collected in plastic tubes from each subject in the control and test groups. The whole saliva samples were stored at -70degreeC until use. |
| Analysis Method | PCR |
| Collection Site | Saliva |
| Disease Category | Dental Disorder |
| Disease/Condition | Aggressive Periodontitis |
| Disease Subtype | NA |
| Fold Change/ Concentration | _3.81 |
| Up/Downregulated | Downregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 33124206 |
| Year of Publication | 2020 |
| Biomarker ID | hsa-let-7a-5p |
| Biomarker Category | miRNA |
| Sequence | UGAGGUAGUAGGUUGUAUAGUU |
| Title of study | Differential expression of microRNAs in the saliva of patients with aggressive periodontitis: a pilot study of potential biomarkers for aggressive periodontitis |
| Abstract of study | PURPOSE: The aim of this study was to compare microRNA (miRNA) gene expression in saliva using miRNA polymerase chain reaction (PCR) arrays in healthy and aggressive periodontitis (AP) patients.METHODS: PCR arrays of 84 miRNAs related to the human inflammatory response and autoimmunity from the saliva samples of 4 patients with AP and 4 healthy controls were performed. The functions and diseases related to the miRNAs were obtained using TAM 2.0. Experimentally validated targets of differentially expressed miRNAs were obtained from mirTarBase. Gene ontology terms and pathways were analyzed using ConsensusPathDB.RESULTS: Four downregulated miRNAs (hsa-let-7a-5p, hsa-let-7f-5p, hsa-miR-181b-5p, and hsa-miR-23b-3p) were identified in patients with AP. These miRNAs are associated with cell death and innate immunity, and they target genes associated with osteoclast development and function.CONCLUSIONS: This study is the first analysis of miRNAs in the saliva of patients with AP. Identifying discriminatory human salivary miRNA biomarkers reflective of periodontal disease in a non-invasive screening assay is crucial for the development of salivary diagnostics. These data provide a first step towards the discovery of key salivary miRNA biomarkers for AP. |