| Primary information |
|---|
| SALID | SAL_24875 |
| Biomarker name | hsa-miR-28-3p |
| Biomarker Type | Diagnostic |
| Sampling Method | This study involved two analysis groups: (1) a case-control comparison between 13 former professional American football athletes and 18 age/gender-matched controls (ages 46-89 years); and (2) a cross-sectional study of 310 individuals (ages 7 to 39 years) |
| Collection Method | Saliva was collected from each participant in a non-fasting state after oral tap-water rinse, using OraCollect Swabs |
| Analysis Method | NA |
| Collection Site | Saliva |
| Disease Category | Neurological Disorder |
| Disease/Condition | Cumulative Concussion |
| Disease Subtype | NA |
| Fold Change/ Concentration | 11.4 |
| Up/Downregulated | Upregulated |
| Exosomal | Exosomal |
| Organism | Homo sapiens |
| PMID | 33092191 |
| Year of Publication | 2020 |
| Biomarker ID | hsa-miR-28-3p |
| Biomarker Category | miRNA |
| Sequence | CACUAGAUUGUGAGCUCCUGGA |
| Title of study | Saliva microRNA Biomarkers of Cumulative Concussion |
| Abstract of study | Recurrent concussions increase risk for persistent post-concussion symptoms, and may lead to chronic neurocognitive deficits. Little is known about the molecular pathways that contribute to persistent concussion symptoms. We hypothesized that salivary measurement of microribonucleic acids (miRNAs), a class of epitranscriptional molecules implicated in concussion pathophysiology, would provide insights about the molecular cascade resulting from recurrent concussions. This hypothesis was tested in a case-control study involving 13 former professional football athletes with a history of recurrent concussion, and 18 age/sex-matched peers. Molecules of interest were further validated in a cross-sectional study of 310 younger individuals with a history of no concussion (n = 230), a single concussion (n = 56), or recurrent concussions (n = 24). There was no difference in neurocognitive performance between the former professional athletes and their peers, or among younger individuals with varying concussion exposures. However, younger individuals without prior concussion outperformed peers with prior concussion on three balance assessments. Twenty salivary miRNAs differed (adj. p < 0.05) between former professional athletes and their peers. Two of these (miR-28-3p and miR-339-3p) demonstrated relationships (p < 0.05) with the number of prior concussions reported by younger individuals. miR-28-3p and miR-339-5p may play a role in the pathophysiologic mechanism involved in cumulative concussion effects. |