| Primary information |
|---|
| SALID | SAL_24868 |
| Biomarker name | eca-miR-33a |
| Biomarker Type | NA |
| Sampling Method | The saliva samples were collected from 3-year-old Arabian horses (8 females and 5 males) running in the same race (1,200 m sand track) in Sü anlõurfa Hippodrome, as before and immediately after the end of the race. |
| Collection Method | Saliva was extracted according to the manufacturerÕs kit protocol, only 1.25 mL carrier RNA (Qiagen) was added to the QIAzol Lysis stage. |
| Analysis Method | qPCR |
| Collection Site | Saliva |
| Disease Category | Metabolic Disorder |
| Disease/Condition | Lipid Metabolism |
| Disease Subtype | NA |
| Fold Change/ Concentration | 5.97 |
| Up/Downregulated | Upregulated |
| Exosomal | NA |
| Organism | Equus caballus |
| PMID | 32972679 |
| Year of Publication | 2020 |
| Biomarker ID | eca-miR-33a |
| Biomarker Category | miRNA |
| Sequence | CUGUGGUGCAUUGUAGUUGCAUUGCAUGUUCUGGCGGUACCCAUGCAAUGUUUCCACAGUGCAUCACAG |
| Title of study | Affecting Lipid Metabolism Salivary MicroRNAs Expressions in Arabian Racehorses Before and After the Race |
| Abstract of study | The active roles of microribonucleic acids (miRNAs) in gene regulation have made miRNAs a key point for the scientific world in the study of physiological processes. Although saliva includes the largest number of miRNAs, there is no miRNA study in saliva on horses has been found. Our study is the first study on miRNAs isolation from saliva in horses. In the present study, saliva was studied in Arabian racehorses to better understand the molecular mechanisms of expression levels that are effective in lipid metabolism of miRNAs and their target genes during the race. Identification of lipid metabolism of miRNAs and their target genes is an opportunity to provide information about biomarkers in Arabian racehorses on energy supply for race performance. Arabian racehorses have low glycogen content and high triglyceride storage capability, thanks to the high amount of oxidative type I fiber in their muscle tissue. Therefore, Arabian racehorses can provide higher levels of energy using more fat. The aim of this study is to determine the prerace and postrace expression levels of eight miRNAs in saliva that are known to affect lipid metabolism in Arabian racehorses. The expression level of eca-miR-33a was found to be statistically significant (P < .05). Target genes of eca-miR-33a have been copredicted as ABCA1, CROT, ABHD2, and SATB2, with three validated databases and other analysis tools. In conclusion, these findings revealed that both eca-miR-33a and its target genes could be potential core genes that play important roles in lipid metabolism in Arabian racehorses to provide energy during the race. |