| Primary information |
|---|
| SALID | SAL_24781 |
| Biomarker name | hsa-miR-409-3p |
| Biomarker Type | Diagnostic |
| Sampling Method | Twenty-four patients turned out to fulfill the classification criteria for pSS, whereas 16 patients did not (non-pSS, randomly selected from the original nonpSS cohort). |
| Collection Method | For saliva samples, the miRNeasy Serum/Plasma Kit (Qiagen) was used after manufacturer's instructions. |
| Analysis Method | qPCR |
| Collection Site | Saliva |
| Disease Category | Immune System Disorder |
| Disease/Condition | Primary Sjogren's Syndrome |
| Disease Subtype | NA |
| Fold Change/ Concentration | -5.15 |
| Up/Downregulated | Downregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 32799333 |
| Year of Publication | 2020 |
| Biomarker ID | hsa-miR-409-3p |
| Biomarker Category | miRNA |
| Sequence | GAAUGUUGCUCGGUGAACCCCU |
| Title of study | Distinct microRNA expression profiles in saliva and salivary gland tissue differentiate patients with primary Sjögren's syndrome from non-Sjögren's sicca patients |
| Abstract of study | OBJECTIVES: Increasing evidence suggests that aberrant expression of microRNAs (miRNAs) is involved in the pathogenesis of primary Sjögren's syndrome (pSS). The aim was thus to characterize the miRNA profile in saliva, salivary gland tissue, and plasma from patients with pSS and compare findings with those of patients having Sjögren-like disease (non-pSS). In addition, to correlate miRNA levels and clinicopathological features of pSS.METHODS: miRNA real-time quantitative polymerase chain reaction was performed on saliva, plasma, and salivary gland tissue samples from 24 patients with pSS and 16 non-pSS in 384-well plates. T test was used for comparison of miRNA profiles, followed by Benjamini-Hochberg correction. The discriminatory power of miRNAs was evaluated by receiver-operating characteristic curves, and Pearson/Spearman correlation was used for correlation analyses.RESULTS: In saliva, 14 miRNAs were significantly differentially expressed between pSS and non-pSS, including downregulation of the miR-17 family in pSS. In salivary gland tissue of patients with pSS, miR-29a-3p was significantly upregulated. Plasma miRNAs did not differ between the two groups, although the miR-17 family tended to be downregulated. The combination of miR-17-5p and let-7i-5p in saliva yielded an area under curve of 97% (CI 92%-100%). Several miRNAs correlated significantly with one another and with salivary flow rates and histopathology.CONCLUSION: Our findings indicate that the miRNA expression profile in saliva may enable to discriminate between pSS and non-pSS patients. However, further validation in larger cohorts is needed as well as functional analyses of the miRNAs of interest. |