Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_24778 details
Primary information
SALIDSAL_24778
Biomarker namehsa-miR-146a
Biomarker TypeDiagnostic
Sampling MethodFifty-three subjects (27 males and 26 females, mean age 36.26 +- 13.57 year), chosen among individuals with diabetes (n = 24) and non-diabetics (n = 29) were included in the study.
Collection MethodUsing passive drool method, 2-5 ml of unstimulated whole saliva was collected from each patient.
Analysis MethodqPCR
Collection SiteSaliva
Disease CategoryMetabolic Disorder
Disease/ConditionDiabetes Mellitus
Disease SubtypeNA
Fold Change/ Concentration12
Up/DownregulatedUpregulated
ExosomalNA
OrganismHomo sapiens
PMID32756589
Year of Publication2020
Biomarker IDhsa-miR-146a
Biomarker CategorymiRNA
SequenceCCGAUGUGUAUCCUCAGCUUUGAGAACUGAAUUCCAUGGGUUGUGUCAGUGUCAGACCUCUGAAAUUCAGUUCUUCAGCUGGGAUAUCUCUGUCAUCGU
Title of studySalivary microRNA 155, 146a/b and 203: A pilot study for potentially non-invasive diagnostic biomarkers of periodontitis and diabetes mellitus
Abstract of studyDysregulated expression of MicroRNAs (miRNAs) plays substantial role in the initiation and progression of both diabetes and periodontitis. The aim of the present study was to validate four miRNAs in saliva as potential predictive biomarkers of periodontal disease among patients with and without diabetes mellitus (DM). MiRNAs were extracted from the saliva of 24 adult subjects with DM and 29 healthy controls. Each group was subdivided into periodontally healthy or having periodontitis. In silico analysis identified 4 miRNAs (miRNA 155, 146 a/b and 203) as immune modulators. The expression of miRNAs-146a/b, 155, and 203 was tested using quantitative PCR. The expression levels in the study groups were compared to explore the effect of diabetes on periodontal status and vice versa. In our cohort, the four miRNAs expression were higher in patients with periodontitis and/or diabetes. miRNA-155 was the most reliable predictors of periodontitis among non-diabetics with an optimum cut-off value of < 8.97 with accuracy = 82.6%. MiRNA 146a, on the other hand, was the only reliable predictor of periodontitis among subjects with diabetes with optimum cut-off value of ≥11.04 with accuracy = 86.1%. The results of the present study concluded that MiRNA-146a and miRNA155 in saliva provide reliable, non-invasive, diagnostic and prognostic biomarkers that can be used to monitor periodontal health status among diabetic and non-diabetic patients.