| Primary information |
|---|
| SALID | SAL_24746 |
| Biomarker name | hsa-miR-193a-3p |
| Biomarker Type | Diagnostic/Prognostic |
| Sampling Method | In total 48 HNSCC patients treated by definitive IMRT were enrolled in this study. |
| Collection Method | Total RNA from 200 µl saliva was extracted using a miRNeasy Serum/Plasma kit (Qiagen) as per manufacturer’s recommendations. |
| Analysis Method | qRT-PCR |
| Collection Site | Saliva |
| Disease Category | Cancer |
| Disease/Condition | Head and Neck Cancer |
| Disease Subtype | Head and Neck Squamous Cell Carcinoma (HNSCC) |
| Fold Change/ Concentration | -3.02 |
| Up/Downregulated | Downregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 32266559 |
| Year of Publication | 2020 |
| Biomarker ID | hsa-miR-193a-3p |
| Biomarker Category | miRNA |
| Sequence | AACUGGCCUACAAAGUCCCAGU |
| Title of study | Salivary microRNAs identified by small RNA sequencing as potential predictors of response to intensity-modulated radiotherapy in head and neck cancer patients |
| Abstract of study | PURPOSE: Progress in radiation therapy of head and neck squamous cell carcinomas (HNSCCs) is logically linked to the development of molecular predictors that would help to enhance individually tailored treatment. MicroRNA (miRNA) expression profiles in tumors have repeatedly been tested to optimize the molecular diagnostics of HNSCC. In addition to tumor tissues, miRNAs are stably present in body fluids, including saliva, and can thus be collected non-invasively. The aim of our current study was to evaluate whether salivary miRNAs have potential as response predictors in HNSCC patients treated with intensity modulated radiation therapy (IMRT).METHODS: In total 48 HNSCC patients treated by definitive IMRT were enrolled in our prospective study. To identify predictive salivary miRNAs, we used small RNA sequencing in 14 saliva samples of HNSCC patients and qRT-PCR validation of selected miRNA candidates in an independent set of 34 patients.RESULTS: We found that salivary miR-15a-5p and miR-15b-5p exhibited differential levels between patients with and without complete remission (p = 0.025 and p = 0.028, respectively). Subsequent Kaplan-Meier analysis confirmed that patients with higher levels of miR-15a-5p reached a significantly longer locoregional progression-free survival (LPFS) than those with low levels (p = 0.024). Finally, multivariate Cox regression analysis revealed that miR-15a-5p may serve as an independent predictive biomarker of LPFS in HNSCC patients treated with IMRT (HR 0.104; 95% CI 0.004-0.911; p = 0.04).CONCLUSIONS: We conclude that salivary miR-15a-5p may represent a potential biomarker for individualized treatment decision-making in HNSCC patients. |