| Primary information |
|---|
| SALID | SAL_24720 |
| Biomarker name | hsa-miR-3928 |
| Biomarker Type | Diagnostic |
| Sampling Method | 6 miRNA were taken for further analysis from the saliva of 12 HNSCC patients and 12 healthy controls. Their differential expressed miRNAs were subsequently validated by RT-qPCR using saliva samples from healthy controls (n = 80) and HNSCC patients (n = 150). |
| Collection Method | A maximum of 8 mL of whole saliva was collected from each subject within a duration of 20 - 30 min. |
| Analysis Method | qRT-PCR |
| Collection Site | Saliva |
| Disease Category | Cancer |
| Disease/Condition | Head and Neck Cancer |
| Disease Subtype | Head and Neck Squamous Cell Carcinoma (HNSCC) |
| Fold Change/ Concentration | NA |
| Up/Downregulated | Downregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 32208417 |
| Year of Publication | 2020 |
| Biomarker ID | hsa-miR-3928 |
| Biomarker Category | miRNA |
| Sequence | GCUGAAGCUCUAAGGUUCCGCCUGCGGGCAGGAAGCGGAGGAACCUUGGAGCUUCGGC |
| Title of study | Salivary microRNA miR-let-7a-5p and miR-3928 could be used as potential diagnostic bio-markers for head and neck squamous cell carcinoma |
| Abstract of study | BACKGROUNDS: MicroRNAs (miRNA) are a class of non-protein-coding RNAs that have significant biological and pathological functions. The importance of miRNAs as potential cancer diagnostic biomarkers is gaining attention due to their influence in the regulation of cellular processes such as cell differentiation, proliferation and apoptosis. The aim of this study was to identify significant miRNAs from saliva as potential diagnostic biomarkers in the early diagnosis and prognosis of head and neck squamous cell carcinoma (HNSCC).MATERIALS AND METHODS: Five differentially expressed miRNAs (miR-7703, miR- let-7a-5p, miR- 345-5p, miR- 3928 and miR- 1470) were selected from Next Generation Sequencing (NGS) miRNA data generated from our previous study using saliva of 12 HNSCC patients and 12 healthy controls. Their differential expressed miRNAs were subsequently validated by RT-qPCR using saliva samples from healthy controls (n = 80) and HNSCC patients (n = 150). Total RNA was isolated from 150 saliva samples of HNSCC patients and was transcripted into cDNA by TaqMan MicroRNA Reverse Transcription Kit. Using quantitative RT-PCR analysis, salivary miRNAs were identified in HNSCC patients (n = 150) and healthy controlled cases (n = 80). T-tests were used to compare the differences among the various clinical variants.RESULTS: On average 160 ng/μl was isolated from 500 μl of saliva. Overall, a good correlation observed between the HNSCC and some of miRNAs expression levels. Salivary miR-let-7a-5p (P<0.0001) and miR-3928 (P< 0.01) were significantly down regulated in saliva of HNSCC patients relative to age and sex-matched healthy controls. A number of salivary miRNAs (miR-let-7a-5p and miR-3928) were correlated with lymph node metastasis (p = 0.003, p = 0.049) and tumour size (p = 0.01, p = 0.02), respectively. However, our preliminary analysis showed no significant differences in salivary miR-1470, miR-345-5p or miR-7703 expression between patients and healthy controls. Most notably, our analysis showed that salivary miR-let-7a-5p and miR-3928 expression levels have significant sensitivity and specificity to distinguish between patients with HNSCC and healthy controls.CONCLUSION: This study concluded that salivary miR-let-7a-5p and miR-3928 has the potential to be novel non-invasive biomarkers for early detection and prognosis of HNSCC. |