| Primary information |
|---|
| SALID | SAL_24718 |
| Biomarker name | hsa-miR-21 |
| Biomarker Type | Diagnostic |
| Sampling Method | Thirty-one samples of EDTA stabilized peripheral blood and 34 saliva samples were obtained from patients with CRC at stages II-IV. Thirty-four EDTA stabilized peripheral blood samples and 34 saliva samples were collected from healthy volunteers. |
| Collection Method | Saliva collection was carried out in the morning on an empty stomach, after a light oral hygiene rinsing with 100 ml of sterile water. |
| Analysis Method | qRT-PCR |
| Collection Site | Saliva |
| Disease Category | Cancer |
| Disease/Condition | Colorectal Cancer (CRC) |
| Disease Subtype | Colon Cancer |
| Fold Change/ Concentration | 4 |
| Up/Downregulated | Upregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 32104546 |
| Year of Publication | 2020 |
| Biomarker ID | hsa-miR-21 |
| Biomarker Category | miRNA |
| Sequence | UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA |
| Title of study | Biomarkers for detecting colorectal cancer non-invasively: DNA, RNA or proteins? |
| Abstract of study | Colorectal cancer (CRC) is a global problem affecting millions of people worldwide. This disease is unique because of its slow progress that makes it preventable and often curable. CRC symptoms usually emerge only at advanced stages of the disease, consequently its early detection can be achieved only through active population screening, which markedly reduces mortality due to this cancer. CRC screening tests that employ non-invasively detectable biomarkers are currently being actively developed and, in most cases, samples of either stool or blood are used. However, alternative biological substances that can be collected non-invasively (colorectal mucus, urine, saliva, exhaled air) have now emerged as new sources of diagnostic biomarkers. The main categories of currently explored CRC biomarkers are: (1) Proteins (comprising widely used haemoglobin); (2) DNA (including mutations and methylation markers); (3) RNA (in particular microRNAs); (4) Low molecular weight metabolites (comprising volatile organic compounds) detectable by metabolomic techniques; and (5) Shifts in gut microbiome composition. Numerous tests for early CRC detection employing such non-invasive biomarkers have been proposed and clinically studied. While some of these studies generated promising early results, very few of the proposed tests have been transformed into clinically validated diagnostic/screening techniques. Such DNA-based tests as Food and Drug Administration-approved multitarget stool test (marketed as Cologuard®) or blood test for methylated septin 9 (marketed as Epi proColon® 2.0 CE) show good diagnostic performance but remain too expensive and technically complex to become effective CRC screening tools. It can be concluded that, despite its deficiencies, the protein (haemoglobin) detection-based faecal immunochemical test (FIT) today presents the most cost-effective option for non-invasive CRC screening. The combination of non-invasive FIT and confirmatory invasive colonoscopy is the current strategy of choice for CRC screening. However, continuing intense research in the area promises the emergence of new superior non-invasive CRC screening tests that will allow the development of improved disease prevention strategies. |