| Primary information |
|---|
| SALID | SAL_24696 |
| Biomarker name | hsa-miR-24-3p |
| Biomarker Type | Diagnostic |
| Sampling Method | Differentially expressed miRNAs were obtained from salivary exosomes of four healthy controls and four OSCC patients using miRNA microarray analysis. |
| Collection Method | 5 ml of unstimulated whole saliva was obtained from patients and health controls under standard conditions. |
| Analysis Method | qRT-PCR |
| Collection Site | Saliva |
| Disease Category | Cancer |
| Disease/Condition | Oral Cancer |
| Disease Subtype | Oral squamous cell carcinoma (OSCC) |
| Fold Change/ Concentration | >2 |
| Up/Downregulated | Upregulated |
| Exosomal | Exosomal |
| Organism | Homo sapiens |
| PMID | 31704611 |
| Year of Publication | 2020 |
| Biomarker ID | hsa-miR-24-3p |
| Biomarker Category | miRNA |
| Sequence | UGGCUCAGUUCAGCAGGAACAG |
| Title of study | Salivary exosomal miR-24-3p serves as a potential detective biomarker for oral squamous cell carcinoma screening |
| Abstract of study | OBJECTIVES: miRNAs in salivary exosomes are used as novel non-invasive biomarkers for detection strategies of human disease. Here, we aimed to investigate the diagnostic potential of salivary exosomal miRNAs as biomarkers for screening oral squamous cell carcinoma (OSCC) and to explore the underlying mechanisms of OSCC pathogenesis.MATERIALS AND METHODS: Differentially expressed miRNAs were obtained from salivary exosomes of four healthy controls and four OSCC patients using miRNA microarray analysis. The expression of miR-24-3p in the salivary exosomes was then verified by qRT-PCR. The diagnostic power was assessed by receiver operating characteristic (ROC) analysis. Cell proliferation was measured using CCK-8 cell viability assay and colony formation assay. The target gene of miR-24-3p was confirmed by dual luciferase reporter assay.RESULTS: A total of 109 miRNAs were found to be more than 2-fold altered in the salivary of patients and healthy individuals by miRNA microarray. qRT-PCR analysis further confirmed a significant increase of miR-24-3p in the salivary exosomes from 45 preoperative OSCC patients compared to 10 normal controls. ROC analysis showed that miR-24-3p has excellent diagnostic accuracy for OSCC (area under the ROC curve [AUC] = 0.738; P = 0.02). Similarly, we found that miR-24-3p expressed a higher level in OSCC neoplastic tissues, suggesting that circulating miR-24-3p may originate from tumor cells. Furthermore, exogenous exosomal miR-24-3p increased proliferation of recipient malignant cells. Additionally, overexpression of miR-24-3p promoted the proliferation of OSCC cells and regulated the expression of cell cycle-related genes. Dual luciferase reporter assay indicated that miR-24-3p can interact with PER1 directly.CONCLUSIONS: Salivary exosomal miR-24-3p is a potential novel diagnostic biomarker for OSCC, and miR-24-3p can maintain the proliferation of OSCC cells through targeting PER1. |