| Primary information |
|---|
| SALID | SAL_24679 |
| Biomarker name | hsa-miR-99a |
| Biomarker Type | Diagnostic |
| Sampling Method | Patients (total n = 190) were included those with visible oral mucosal abnormalities (MA) who were attending for their oral mucosal condition (n = 136) and those with no mucosal abnormalities (NMA) who were attending for dental needs (n = 54). |
| Collection Method | Oral swirls were centrifuged at 4000g for 4 min at 4 degree C |
| Analysis Method | qRT-PCR |
| Collection Site | Saliva |
| Disease Category | Cancer |
| Disease/Condition | Oral Cancer |
| Disease Subtype | Oral squamous cell carcinoma (OSCC) |
| Fold Change/ Concentration | 0.49 |
| Up/Downregulated | NA |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 31422202 |
| Year of Publication | 2019 |
| Biomarker ID | hsa-miR-99a |
| Biomarker Category | miRNA |
| Sequence | CCCAUUGGCAUAAACCCGUAGAUCCGAUCUUGUGGUGAAGUGGACCGCACAAGCUCGCUUCUAUGGGUCUGUGUCAGUGUG |
| Title of study | Non-invasive screening of a microRNA-based dysregulation signature in oral cancer and oral potentially malignant disorders |
| Abstract of study | INTRODUCTION: We have previously shown that oral swirls are a robust source of microRNA protected by extracellular vesicles, potentially useful to detect oral squamous cell carcinoma (OSCC)-associated molecular aberration.OBJECTIVES: To study a developed dysregulation score and risk classification algorithm based upon a panel of OSCC-associated microRNA in oral swirls from individuals with OSCC and oral potentially malignant disorders (OPMDs).MATERIALS AND METHODS: An OSCC-associated panel of 5 microRNAs (miR-24; miR-21; miR-99a; let-7c; miR-100;) was quantified by qPCR in 190 individuals with and without mucosal abnormalities, including OSCC (n = 53) and OPMDs (n = 74). Each sample was analyzed using a developed dysregulation score (dSCORE) and risk classification algorithm, allocating a LOW- or HIGH-RISK score. The influence of demographic, systemic, oral health and mucosal disease factors on the developed test was analyzed.RESULTS: MicroRNA for analysis can be predictably isolated from oral swirls sourced from individuals with a range of demographic, systemic and oral health findings. Utilizing the presence of HIGH-RISK identified OSCC patients with 86.8% sensitivity and 81.5% specificity. Older age and female gender were associated with higher dSCOREs and higher proportions of HIGH-RISK classification amongst individuals with no mucosal abnormalities. The dSCOREs for all subgroups of OPMDs were significantly different from the OSCC group.CONCLUSION: This is the first comparison of microRNA sourced from oral swirls from individuals with OPMDs with individuals with and without OSCC. A HIGH-RISK dysregulation signature was found to be accurate in indicating the presence of OSCC and exampled to parallel malignant transformation. |