| Primary information |
|---|
| SALID | SAL_24676 |
| Biomarker name | hsa-miR-34a-5p |
| Biomarker Type | Diagnostic |
| Sampling Method | saliva of young subjects was evalauted (age 11 +- 3.467 years) with migraine without aura (MWA), while some underwent pharmacological treatment, and healthy young subjects were used as controls |
| Collection Method | 2 mL of saliva was taken; total RNA was extracted from 200 mL of biological fluid (blood and saliva) by using miRNeasy Serum/Plasma Kit (Qiagen). |
| Analysis Method | qRT-PCR |
| Collection Site | Saliva |
| Disease Category | Headache Disorder |
| Disease/Condition | Migraine |
| Disease Subtype | NA |
| Fold Change/ Concentration | NA |
| Up/Downregulated | Upregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 31252698 |
| Year of Publication | 2019 |
| Biomarker ID | hsa-miR-34a-5p |
| Biomarker Category | miRNA |
| Sequence | UGGCAGUGUCUUAGCUGGUUGU |
| Title of study | Hsa-miR-34a-5p and hsa-miR-375 as Biomarkers for Monitoring the Effects of Drug Treatment for Migraine Pain in Children and Adolescents: A Pilot Study |
| Abstract of study | MicroRNAs (miRs) have emerged as biomarkers of migraine disease in both adults and children. In this study we evaluated the expression of hsa-miR-34a-5p and hsa-miR-375 in serum and saliva of young subjects (age 11 ± 3.467 years) with migraine without aura (MWA), while some underwent pharmacological treatment, and healthy young subjects were used as controls. miRs were determined using the qRT-PCR method, and gene targets of hsa-miR-34a-5p and hsa-miR-375 linked to pain-migraine were found by in silico analysis. qRT-PCR revealed comparable levels of hsa-miRs in both blood and saliva. Higher expression of hsa-miR-34a-5p and hsa-miR-375 was detected in saliva of untreated MWAs compared to healthy subjects (hsa-miR-34a-5p: p < 0.05; hsa-miR-375 p < 0.01). Furthermore, in MWA treated subjects, a significant decrease of hsa-miR-34a-5p and of hsa-miR-375 was documented in saliva and blood compared to MWA untreated ones. Altogether, these findings suggested thathsa-miR-34a-5p and hsa-miR-375 are expressed equally in blood and saliva and that they could be a useful biomarker of disease and of drug efficacy in patients with MWA. |