| Primary information |
|---|
| SALID | SAL_24674 |
| Biomarker name | hsa-miR-143-3p |
| Biomarker Type | Diagnostic |
| Sampling Method | Profiling of miRNAs in two unstimulated saliva samples collected by passive drool method from a patient diagnosed with generalized chronic periodontitis and a healthy control. |
| Collection Method | Approximately 2 mL saliva was collected in sterile test tubes and placed in dry ice |
| Analysis Method | qRT-PCR |
| Collection Site | Saliva |
| Disease Category | Dental Disorder |
| Disease/Condition | Periodontitis |
| Disease Subtype | NA |
| Fold Change/ Concentration | 5.82 |
| Up/Downregulated | Upregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 31021403 |
| Year of Publication | 2019 |
| Biomarker ID | hsa-miR-143-3p |
| Biomarker Category | miRNA |
| Sequence | UGAGAUGAAGCACUGUAGCUC |
| Title of study | Identification of a novel salivary biomarker miR-143-3p for periodontal diagnosis: A proof of concept study |
| Abstract of study | BACKGROUND: Though the use of salivary miRNAs as potential biomarkers has been reported in few diseases/conditions such as rheumatoid arthritis and oral cancer, there are no reported studies on their utility in periodontal diagnostics. Thus, the aim of the present study was to profile salivary miRNAs and identify the most suitable salivary miRNA biomarker in chronic periodontitis.METHODS: In this study, we have explored the potential application of next generation sequencing (NGS) technology for profiling miRNAs in two unstimulated saliva samples collected by passive drool method from a patient diagnosed with generalized chronic periodontitis and a healthy control. Subsequently, the validation of most highly expressed known miRNA in periodontitis was performed in saliva samples collected from an independent set of 16 chronic periodontitis patients and 16 periodontally healthy controls using quantitative real-time PCR (qRT-PCR). Target gene prediction and pathway mapping were performed using bioinformatic tools.RESULTS: NGS analysis identified 40 upregulated and 40 downregulated known miRNAs in chronic periodontitis compared to healthy controls, of which miR-143-3p was the most highly expressed miRNA in periodontitis (Read count - 227630; fold change - 5.82). Validation using qRT-PCR showed significant upregulation of miR-143-3p expression in the test group compared with controls (P < 0.05). K-RAS (V-Ki-ras2 Kirsten rat sarcoma viral oncogene) gene was predicted as the target gene for miR-143-3p in humans. KEGG (Kyoto Encyclopedia of genes and genomes) pathway mapping revealed the involvement of K-RAS in mitogen-activated protein kinases (MAPK) pathway.CONCLUSIONS: The application of NGS for miRNA expression profiling can be considered a valuable tool in detection of novel biomarkers in periodontal diagnostics. Also, the results of the study points to the potential utility of miR143-3p as a novel salivary biomarker for chronic periodontitis. |