Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_24673 details
Primary information
SALIDSAL_24673
Biomarker namehsa-miR-144-3p
Biomarker TypeDiagnostic
Sampling MethodThe number of participants of the no/mild periodontitis group, the moderate periodontitis group, and the severe periodontitis group was 26, 58, and 36 respectively
Collection MethodUnstimulated whole saliva (1- 2 mL) was collected.
Analysis MethodqRT-PCR
Collection SiteSupernatant Saliva
Disease CategoryDental Disorder
Disease/ConditionPeriodontitis
Disease SubtypeChronic Periodontitis
Fold Change/ Concentration2.16
Up/DownregulatedUpregulated
ExosomalExosomal
OrganismHomo sapiens
PMID30875931
Year of Publication2019
Biomarker IDhsa-miR-144-3p
Biomarker CategorymiRNA
SequenceUACAGUAUAGAUGAUGUACU
Title of studyDetection of Salivary miRNAs Reflecting Chronic Periodontitis: A Pilot Study
Abstract of studyThe purpose of this cross-sectional pilot study was to find salivary microRNAs (miRNAs) reflecting periodontal condition in chronic periodontitis. One hundred and twenty chronic periodontitis patients (mean age, 68.4 years) participated in the study, from whom unstimulated whole saliva was collected. A multiphase study was conducted to explore salivary miRNAs as biomarkers of periodontitis. At first, a polymerase chain reaction (PCR) array was performed to compare salivary miRNAs profiles in no and mild (no/mild) and severe periodontitis patients. Next, the relative expression of salivary miRNAs on individual samples was assessed by real-time reverse transcription-PCR. The numbers (%) of patients were 26 (21.6%, no/mild), 58 (48.3%, moderate) and 36 (30.0%, severe), respectively. Among 84 miRNAs, only the relative expression of hsa-miR-381-3p in the severe periodontitis group was significantly higher than that of the no/mild periodontitis group (p < 0.05). Among the 120 patients, there was also a significant correlation between the relative expression of hsa-miR-381-3p and the mean probing pocket depth (PPD) (r = 0.181, p < 0.05). Salivary hsa-miR-381-3p was correlated with periodontitis condition in chronic periodontitis patients.