| Primary information |
|---|
| SALID | SAL_24670 |
| Biomarker name | hsa-miR-543 |
| Biomarker Type | Diagnostic |
| Sampling Method | The number of participants of the no/mild periodontitis group, the moderate periodontitis group, and the severe periodontitis group was 26, 58, and 36 respectively |
| Collection Method | Unstimulated whole saliva (1- 2 mL) was collected. |
| Analysis Method | qRT-PCR |
| Collection Site | Supernatant Saliva |
| Disease Category | Dental Disorder |
| Disease/Condition | Periodontitis |
| Disease Subtype | Chronic Periodontitis |
| Fold Change/ Concentration | 2.7 |
| Up/Downregulated | Upregulated |
| Exosomal | Exosomal |
| Organism | Homo sapiens |
| PMID | 30875931 |
| Year of Publication | 2019 |
| Biomarker ID | hsa-miR-543 |
| Biomarker Category | miRNA |
| Sequence | UACUUAAUGAGAAGUUGCCCGUGUUUUUUUCGCUUUAUUUGUGACGAAACAUUCGCGGUGCACUUCUUUUUCAGUAUC |
| Title of study | Detection of Salivary miRNAs Reflecting Chronic Periodontitis: A Pilot Study |
| Abstract of study | The purpose of this cross-sectional pilot study was to find salivary microRNAs (miRNAs) reflecting periodontal condition in chronic periodontitis. One hundred and twenty chronic periodontitis patients (mean age, 68.4 years) participated in the study, from whom unstimulated whole saliva was collected. A multiphase study was conducted to explore salivary miRNAs as biomarkers of periodontitis. At first, a polymerase chain reaction (PCR) array was performed to compare salivary miRNAs profiles in no and mild (no/mild) and severe periodontitis patients. Next, the relative expression of salivary miRNAs on individual samples was assessed by real-time reverse transcription-PCR. The numbers (%) of patients were 26 (21.6%, no/mild), 58 (48.3%, moderate) and 36 (30.0%, severe), respectively. Among 84 miRNAs, only the relative expression of hsa-miR-381-3p in the severe periodontitis group was significantly higher than that of the no/mild periodontitis group (p < 0.05). Among the 120 patients, there was also a significant correlation between the relative expression of hsa-miR-381-3p and the mean probing pocket depth (PPD) (r = 0.181, p < 0.05). Salivary hsa-miR-381-3p was correlated with periodontitis condition in chronic periodontitis patients. |