Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_24663 details
Primary information
SALIDSAL_24663
Biomarker namehsa-miR-3146
Biomarker TypeDiagnostic
Sampling MethodA total of 218 samples were collected from 50 amateur MMA fights (42 unique, 8 repeat fighters), including 87 saliva and 131 serum samples.
Collection MethodSaliva was collected by expectoration into Oragene RNA collection vials (RE-100, DNA Genotek, Ottawa, ON) or by swab absorption using the Oragene Nucleic Acid Stabilizing Kit swab
Analysis MethodqRT-PCR
Collection SiteSaliva
Disease CategoryNeurological Disorder
Disease/ConditionMild Traumatic Brain Injury (mTBI)
Disease SubtypeNA
Fold Change/ ConcentrationNA
Up/DownregulatedDownregulated
ExosomalNA
OrganismHomo sapiens
PMID30601825
Year of Publication2019
Biomarker IDhsa-miR-3146
Biomarker CategorymiRNA
SequenceGCUAAGUCCCUUCUUUCUAUCCUAGUAUAACUUGAAGAAUUCAAAUAGUCAUGCUAGGAUAGAAAGAAUGGGACUUGGC
Title of studyComparison of serum and saliva miRNAs for identification and characterization of mTBI in adult mixed martial arts fighters
Abstract of studyTraumatic brain injury (TBI) is a major cause of death and disability worldwide, with mild TBI (mTBI) accounting for 85% of cases. mTBI is also implicated in serious long-term sequelae including second impact syndrome and chronic traumatic encephalopathy. mTBI often goes undiagnosed due to delayed symptom onset and limited sensitivity of conventional assessment measures compared with severe TBI. Current efforts seek to identify accurate and reliable non-invasive biomarkers associated with functional measures relevant to long-term outcomes. Here we evaluated the utility of serum and salivary microRNAs (miRNAs) to serve as sensitive and specific peripheral biomarkers of possible mTBI. Our primary objectives were to establish the relationship between peripheral measures of miRNA, objective quantification of head impacts, and sensitive indices of balance and cognitive function in healthy young adult athletes. A secondary objective was to compare the sensitivity of miRNA versus commonly used blood-based protein biomarkers. 50 amateur mixed martial arts (MMA) fighters participated. 216 saliva and serum samples were collected at multiple time points, both pre- and post-fight. Levels of 10 serum proteins were compared in a subset of the fighters (n = 24). Levels of miRNAs were obtained by next generation sequencing. Functional outcomes were evaluated using a computerized assessment system that measured cognitive performance, body sway, and combined cognitive performance and body sway during dual task completion. Data were analyzed using multivariate logistic regression for predictive classification, analysis of variance, correlation analysis and principal component analysis. We identified a subset of salivary and serum miRNAs that showed robust utility at predicting TBI likelihood and demonstrated quantitative associations with head impacts as well as cognitive and balance measures. In contrast, serum proteins demonstrated far less utility. We also found that the timing of the responses varies in saliva and serum, which is a critical observation for biomarker studies to consider.